ID: 1105551717

View in Genome Browser
Species Human (GRCh38)
Location 13:21403437-21403459
Sequence AAATGTATGGAACACCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105551713_1105551717 27 Left 1105551713 13:21403387-21403409 CCACTAAATCCTAATATATACTA 0: 1
1: 0
2: 3
3: 16
4: 212
Right 1105551717 13:21403437-21403459 AAATGTATGGAACACCTGCTAGG 0: 1
1: 1
2: 3
3: 25
4: 188
1105551715_1105551717 -2 Left 1105551715 13:21403416-21403438 CCTAATACATATGTTCATTTAAA 0: 1
1: 1
2: 3
3: 75
4: 781
Right 1105551717 13:21403437-21403459 AAATGTATGGAACACCTGCTAGG 0: 1
1: 1
2: 3
3: 25
4: 188
1105551714_1105551717 18 Left 1105551714 13:21403396-21403418 CCTAATATATACTATTGTTGCCT 0: 1
1: 0
2: 1
3: 24
4: 271
Right 1105551717 13:21403437-21403459 AAATGTATGGAACACCTGCTAGG 0: 1
1: 1
2: 3
3: 25
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105551717 Original CRISPR AAATGTATGGAACACCTGCT AGG Intronic
901583238 1:10263568-10263590 ATATTTATGCAACACCTTCTAGG - Intronic
902112247 1:14091704-14091726 AAATCTATGGACCCCCTCCTAGG + Intergenic
902770880 1:18644905-18644927 AAATTTTTGGAGCACCTACTAGG + Intronic
903392384 1:22973459-22973481 AAATTTATGGAGCACTTACTAGG - Intergenic
903409781 1:23132042-23132064 AAAGGTAGGAAACACCAGCTTGG - Intronic
905894215 1:41534644-41534666 ATATGTATTGGGCACCTGCTGGG - Intronic
907482026 1:54751652-54751674 TAATGGAAGAAACACCTGCTGGG - Intergenic
911314023 1:96334227-96334249 AATTGTATTTAACACCTGCAGGG - Intergenic
911526196 1:98989556-98989578 AAATGTACAGAACACGGGCTTGG + Intronic
912229167 1:107772647-107772669 TAATTTATGTAACATCTGCTGGG - Intronic
912274436 1:108241450-108241472 AGATGAATGGAACATCTGCGAGG - Intronic
912286831 1:108378408-108378430 AGATGAATGGAACATCTGCGAGG + Intronic
915038961 1:152951785-152951807 AAATCTATCCAACACCTCCTAGG - Intergenic
916330309 1:163608726-163608748 CTATGTATTGAGCACCTGCTAGG + Intergenic
1065039952 10:21683018-21683040 AAATGTATTGAAAAACTGCTTGG - Intronic
1067553121 10:47248886-47248908 AAATGTAGGGAGCACCTGCAAGG + Intergenic
1072072057 10:91927599-91927621 AAATGTACTGAACACCCACTAGG - Intronic
1073271477 10:102268140-102268162 AAATGTTTGGAAGAACTTCTTGG - Intronic
1081773257 11:45662525-45662547 AGATGTCAGGACCACCTGCTGGG + Intronic
1086111414 11:83202958-83202980 ACATTTATTGAACATCTGCTAGG - Intronic
1088040904 11:105380556-105380578 ATATGTATTGAGCACCTACTTGG + Intergenic
1089174937 11:116541532-116541554 ACATATATTGAACACCTGCTAGG + Intergenic
1089312707 11:117570562-117570584 AAATGTATTCAGCACCTACTAGG - Intronic
1090439831 11:126716283-126716305 ATATGTATGGAGCACCTGCTAGG + Intronic
1091847456 12:3668535-3668557 GAATGTAAGGACCACCTGCCAGG + Intronic
1092191706 12:6526154-6526176 AATGGCATGGCACACCTGCTGGG - Exonic
1093003261 12:14024124-14024146 AAATGTGTGGAACACCTATTGGG + Intergenic
1096654512 12:53080063-53080085 ATATTTATTGAACACCTACTAGG + Intergenic
1098590582 12:72206506-72206528 ATATGCATTGAACACCTACTAGG - Intronic
1099787275 12:87282433-87282455 AAATCAATGGAACACTTGCATGG + Intergenic
1099918877 12:88932277-88932299 AAACGTATGTAATTCCTGCTTGG + Intergenic
1099951749 12:89311548-89311570 ATATGTATGGAGCACCTATTGGG - Intergenic
1100895074 12:99172394-99172416 AAAGGTATAGAAAACCTGCAAGG + Intronic
1101204721 12:102475265-102475287 AAACATATGGAACACATGCAGGG - Intronic
1102078922 12:110082359-110082381 AGAAGTATGGAACACCAGCCAGG - Intergenic
1103083269 12:118042091-118042113 AAATGTATGGAATTCCTTATTGG + Intronic
1103750590 12:123157234-123157256 AAATGTGTGAAGCACCTCCTAGG - Intronic
1104209959 12:126679180-126679202 AAATGTATGAAACAGCTTCATGG + Intergenic
1104665366 12:130643692-130643714 ACATTTATTGAACACCTGCGTGG + Intronic
1105551717 13:21403437-21403459 AAATGTATGGAACACCTGCTAGG + Intronic
1106322733 13:28657555-28657577 ATATGTATTGAACATTTGCTTGG - Intergenic
1107121006 13:36795760-36795782 AAATTTATGCAAACCCTGCTGGG - Intergenic
1109220768 13:59638902-59638924 GGATGTATTGAGCACCTGCTAGG + Intergenic
1110712938 13:78669948-78669970 AAATATATTGAGGACCTGCTGGG + Intergenic
1112460987 13:99603787-99603809 ATATGTATTGAATACCTGCCGGG + Intergenic
1112461049 13:99604202-99604224 ATATGTATTGAATACCTGCCAGG - Intergenic
1122184130 14:99976924-99976946 AAATGTAAGAAATACCTGCTTGG - Intronic
1122403656 14:101483175-101483197 AAATGTATCAAGCACCTGCTAGG + Intergenic
1123794960 15:23762189-23762211 AAATGTGTGGACCAACAGCTGGG + Intergenic
1124051540 15:26201257-26201279 AAATGTATGGAACGTCTGGGTGG + Intergenic
1125228008 15:37417907-37417929 AAATGTAAGAAACATCAGCTGGG - Intergenic
1126245742 15:46502943-46502965 CAGTGTATGGAACACCAGCTAGG - Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1129026102 15:72575767-72575789 AAATATGTGGAAAATCTGCTTGG - Intronic
1130832457 15:87615551-87615573 CAATGTTTGGAACAGGTGCTTGG - Intergenic
1131175833 15:90209157-90209179 ACATTTATGGAACAACTGCTGGG + Intronic
1133363102 16:5189504-5189526 AAATGTCTGGAAAACCTTCCTGG - Intergenic
1137522831 16:49209573-49209595 TAATGTATGTAAAACCAGCTAGG - Intergenic
1137618514 16:49860271-49860293 AAACGGATGGATCACCTGCTAGG + Intergenic
1138336598 16:56258450-56258472 AAATGTTTGGAAAACCTGAAAGG + Intronic
1139100738 16:63763359-63763381 AAATGTATTGATTACCTACTAGG + Intergenic
1143906894 17:10216313-10216335 CCAGGGATGGAACACCTGCTGGG + Intergenic
1147216721 17:38904119-38904141 CAATGTATGGTATACCTGCCTGG - Intronic
1147221904 17:38939406-38939428 ACATTTATTGAGCACCTGCTAGG + Intronic
1147653122 17:42073038-42073060 ACATTCATGGACCACCTGCTGGG + Intergenic
1151047170 17:70934496-70934518 AAGTGTATGAAACACATGTTAGG + Intergenic
1151464330 17:74274773-74274795 AACAGTATTGCACACCTGCTAGG + Intronic
1153590265 18:6666589-6666611 ACATGTGTTGAACACATGCTTGG + Intergenic
1157187533 18:45553237-45553259 AAATGTATGGAAGCCCTGTTGGG - Intronic
1159289216 18:66395360-66395382 AAATGTAAGCAACACCTGGAAGG + Intergenic
1159621087 18:70639194-70639216 AAAGGTATGGATTTCCTGCTAGG + Intronic
1162202646 19:9032257-9032279 ATATTTATTGAGCACCTGCTGGG - Intergenic
1164783065 19:30909139-30909161 AAATGGATTGCACACCTGCAGGG + Intergenic
1166771977 19:45289092-45289114 AAAAGTATGGGTCACCTGCCAGG + Intronic
1168276443 19:55281042-55281064 AAACGTATCAATCACCTGCTGGG + Intergenic
927677376 2:25116303-25116325 AAATGTATCTATCACCTCCTAGG - Intronic
927729860 2:25461661-25461683 CAATGTACGGAGCACCTACTAGG + Intronic
928380428 2:30813146-30813168 AAATTTATTGAGCACCTACTAGG - Intronic
930222341 2:48757285-48757307 ACACATATGGAACACCTACTAGG - Intronic
930250792 2:49031994-49032016 ACATTTATGGAGTACCTGCTGGG - Intronic
932626608 2:73301381-73301403 AAATGTAGGGATCACCGGTTTGG - Intergenic
935362939 2:102263148-102263170 ATATTTATTGAACATCTGCTCGG - Intergenic
938556636 2:132430554-132430576 AAATTCATGGACCACCAGCTTGG + Intronic
944505441 2:200405892-200405914 AAATGTATGGAGTGCCTCCTGGG - Intronic
944643640 2:201754964-201754986 AAATGTTTGGAATTCCAGCTGGG - Intronic
945626943 2:212220949-212220971 AAATATATGGAACACCTGCTAGG - Intronic
945984818 2:216345089-216345111 AAAAGTTGGGAACAGCTGCTAGG + Intronic
1168908479 20:1426119-1426141 ACATGTATTAAGCACCTGCTAGG - Intergenic
1169720845 20:8674643-8674665 AACTTTCTGGAACACCTTCTGGG + Intronic
1170354671 20:15479170-15479192 AAATGTGAGGAACACCAGCATGG + Intronic
1170361666 20:15553158-15553180 AAATTTCTGGAACCCCTACTAGG + Intronic
1170879115 20:20278861-20278883 ATATTTATTGAACACCTGCTAGG + Intronic
1171500139 20:25586613-25586635 ATATTTATCGAACACCTACTAGG + Intergenic
1172397646 20:34620459-34620481 ACATTTATGGATCACTTGCTAGG + Intronic
1172927188 20:38548725-38548747 GAATGTCTGGAAGACTTGCTTGG + Exonic
1176906983 21:14513389-14513411 AATTTTATAGAACACCTCCTAGG + Intronic
1182732810 22:32508779-32508801 ACATGTCCTGAACACCTGCTGGG + Intergenic
950628895 3:14268186-14268208 AAATGTCTTGAGCACTTGCTTGG - Intergenic
950839049 3:15949392-15949414 ACATTTATTGAGCACCTGCTGGG + Intergenic
952367720 3:32689527-32689549 AAATGTACAGAACCCTTGCTTGG + Intronic
952613410 3:35239294-35239316 ATATTTATTGAATACCTGCTAGG - Intergenic
954350581 3:50040078-50040100 AAATGCATGTAAGACCTGCAAGG + Intronic
954678760 3:52330184-52330206 AAGTTTATCGAACACCTGCAAGG + Intronic
955139128 3:56251683-56251705 AAATGCATTTAACACATGCTAGG + Intronic
955318288 3:57956863-57956885 GAATGGATGGAGCACCTGCTGGG + Intergenic
955413575 3:58671900-58671922 ACATTTATAGAGCACCTGCTGGG + Intergenic
955487081 3:59445936-59445958 AACTGCAGGGAACACTTGCTTGG + Intergenic
956445164 3:69318923-69318945 AAATGTATGTATGACCTGCCAGG + Intronic
958427998 3:94001720-94001742 ACATGTATCAAACACCTCCTTGG - Intronic
961575424 3:127832025-127832047 AAATGCATGCACCACCTGCAGGG - Intergenic
963067195 3:141273220-141273242 ACATGTATGGAGCACATGCTGGG - Intronic
966550928 3:181203152-181203174 ATATGTATGGAATAGCTGCTGGG + Intergenic
966589472 3:181665617-181665639 ATACTTATGGAGCACCTGCTGGG + Intergenic
968822874 4:2868941-2868963 AAATATGTGGAACACCTGCTGGG + Intronic
969359981 4:6657425-6657447 AAATGTACCGAGCCCCTGCTGGG + Intergenic
970366532 4:15364708-15364730 ACATGTATGGAACACCACCGTGG + Intronic
970777023 4:19686980-19687002 AAATGTGTGTAACATTTGCTTGG - Intergenic
972319128 4:37956468-37956490 ATATGTATTGAGCACCTACTGGG - Intronic
972919715 4:43923386-43923408 ACATGTAATGAGCACCTGCTAGG + Intergenic
973880358 4:55265394-55265416 AAATGTATGGAATAAAAGCTTGG - Intergenic
974967998 4:68787488-68787510 AAATTTAGGGAAGACCTGATGGG + Intergenic
975011417 4:69358188-69358210 AAATTTAGGGAAGACCTGATGGG + Intronic
975128197 4:70805464-70805486 GAGTGTATGAAACACATGCTTGG + Intronic
975563548 4:75729681-75729703 AAATGTAGTTAACACTTGCTTGG - Intronic
975943611 4:79677886-79677908 AAATGTAAGTATCACCTGGTGGG - Intergenic
978566871 4:110092064-110092086 AAATTTTTGAAACACATGCTAGG + Intronic
979960193 4:127009777-127009799 AAATCTATGGAACACATTTTAGG - Intergenic
980637791 4:135531389-135531411 AATTGTATTGACCACCTCCTAGG + Intergenic
981126363 4:141111218-141111240 AACTGTATTGTTCACCTGCTGGG + Intronic
982883819 4:160752485-160752507 AAATATAGGGAAAACCTTCTTGG - Intergenic
984274112 4:177587760-177587782 AAATCTATGGAATTCCTGCTGGG + Intergenic
984403020 4:179291172-179291194 AAATATATGTAACATCTACTAGG - Intergenic
985048168 4:185962437-185962459 AAATTTATGGAATATTTGCTGGG + Intergenic
985351241 4:189064383-189064405 ATATGTATGCAACAGCTGTTAGG - Intergenic
986831144 5:11579904-11579926 ATATGTAGGGAACAGCTGCCGGG - Intronic
987480150 5:18444887-18444909 AAATGTATGGATTACTTGCAAGG - Intergenic
987944676 5:24589130-24589152 AAATATATGGAGGACCTTCTAGG - Intronic
992118317 5:73564473-73564495 ACATTTATGGAGCACCTGGTAGG - Intronic
994443790 5:99845428-99845450 AAATAAATGAAACAGCTGCTTGG + Intergenic
995421911 5:111977272-111977294 ACATGTATTAAACACTTGCTAGG + Intronic
996370735 5:122749853-122749875 AAAAATATGGAAAACATGCTGGG - Intergenic
996814640 5:127561422-127561444 AAAGGGATGAAACACTTGCTTGG - Intergenic
996906956 5:128611809-128611831 AAATGTGTCAAACACCTGTTTGG + Intronic
997499425 5:134360498-134360520 AAATGCATGGAACATAGGCTGGG - Intronic
997849093 5:137314818-137314840 TAATTTATGGAGCACCTGCTTGG - Intronic
997952272 5:138252073-138252095 CCATTTATTGAACACCTGCTTGG - Intergenic
997971074 5:138402570-138402592 ACATTTATGGAATACCTGGTGGG - Intronic
998616745 5:143749140-143749162 AAATGTATAGAACACAAGCCAGG - Intergenic
999053269 5:148546796-148546818 AAATCTATGGAAATCCTGCTGGG - Intronic
999348310 5:150843944-150843966 AAATATGTTTAACACCTGCTGGG + Intergenic
999533946 5:152496032-152496054 AAATGTATGCAACAGCTCCCAGG - Intergenic
1000209600 5:159097558-159097580 GAATGGATGGAAAACATGCTCGG + Intronic
1001126986 5:169028657-169028679 AAATGTATGGACCTCTTCCTAGG - Intronic
1001233110 5:170006777-170006799 ATATTTCTGGAACATCTGCTAGG - Intronic
1002165776 5:177344573-177344595 AAATGTATGTAACACAGGCTGGG - Intronic
1002790096 6:430973-430995 ACATGTATTGAAAACCTCCTGGG + Intergenic
1003268591 6:4588192-4588214 ATCTGTATGGAGCACCTGCTAGG + Intergenic
1003280067 6:4683459-4683481 AAATGTATGGAGCAAGTCCTGGG - Intergenic
1004026414 6:11823571-11823593 ATATGTATTGAATACCTACTAGG + Intergenic
1006022472 6:31125521-31125543 AGATGTTCGGAACACCTGATTGG - Intronic
1006759183 6:36444116-36444138 AAATTTATGGAAGAGGTGCTAGG - Intronic
1007923181 6:45629131-45629153 ACATGAATGGAACACCTTTTAGG + Intronic
1008558820 6:52703373-52703395 AAATGAATGCAACACCTGGATGG + Intergenic
1010170787 6:72972729-72972751 CAATTTATTGAACACCTACTAGG - Intronic
1010792635 6:80082267-80082289 ATATTTACTGAACACCTGCTAGG - Intergenic
1011118281 6:83920775-83920797 ATATTTATTGAACACCTACTAGG + Intronic
1014643594 6:123945552-123945574 AGATTTAAGAAACACCTGCTGGG - Intronic
1016177916 6:141102874-141102896 AAATATATGGAACATATCCTTGG + Intergenic
1016800871 6:148167790-148167812 AAATGTATTGACCACTTACTAGG + Intergenic
1017019054 6:150125570-150125592 ACATGCATGGCACATCTGCTTGG - Intergenic
1017648138 6:156557492-156557514 ATATTTATAGAACACCTCCTAGG - Intergenic
1017818826 6:158034356-158034378 ACATGTATGGTACTCCTGCCAGG + Intronic
1018201754 6:161401709-161401731 AAATGTCTTGAACACTTTCTAGG + Intronic
1018432251 6:163731294-163731316 AAATGCATGGAGCACGTGTTAGG + Intergenic
1019131910 6:169883142-169883164 AGATTTATAGAGCACCTGCTGGG - Intergenic
1020579360 7:9975497-9975519 AGATGTATGGAACAGCCACTGGG + Intergenic
1021123404 7:16822557-16822579 ACATTTATTGAACACCTACTAGG - Intronic
1023035508 7:36128023-36128045 ACATTTATTGAACACCTACTGGG - Intergenic
1023514295 7:40985282-40985304 ACATTTATGGAGCACCTGGTTGG + Intergenic
1024291118 7:47805020-47805042 TCATTTATGGAACATCTGCTAGG + Intronic
1026171908 7:67961357-67961379 GATTGTATGTGACACCTGCTAGG - Intergenic
1026438644 7:70422956-70422978 ATATGTATTGAGCACCTTCTAGG + Intronic
1027934388 7:84584957-84584979 AAATGTATGGAGTACCTACTGGG - Intergenic
1028034028 7:85956718-85956740 ATATTTATGGATCAACTGCTAGG - Intergenic
1033487084 7:141801584-141801606 AAATAGAAGAAACACCTGCTAGG + Intergenic
1038517517 8:28199872-28199894 AGATTTATGGAACACCTTCTGGG - Intergenic
1038561788 8:28587082-28587104 AAATGAATTGAGCATCTGCTCGG - Intergenic
1040105586 8:43539768-43539790 TAATGGATTGAACACCTGCTGGG + Intergenic
1041053812 8:53962164-53962186 AAAAGTAAGGAACTCCTGCCGGG + Intergenic
1041567379 8:59294465-59294487 AAATTTATTGAACACATACTAGG + Intergenic
1043467830 8:80530374-80530396 AAATGTAGGGAAGAACTGATAGG - Intergenic
1044926816 8:97216224-97216246 ATATTTATTGAGCACCTGCTAGG + Intergenic
1044970255 8:97612637-97612659 AAATTTATTGAGCACCTGCCAGG + Intergenic
1047476861 8:125240857-125240879 AAATGTTAGGAACAACTGCATGG + Intronic
1048372291 8:133789718-133789740 AAATGTATTTAACACCTACTTGG - Intergenic
1050815339 9:9804585-9804607 AAATTTATTCAACACCTACTAGG - Intronic
1051930348 9:22377927-22377949 AAGTGAATGGCACACCTCCTAGG + Intergenic
1053172175 9:35895981-35896003 AAATGTGTGCAGCAGCTGCTAGG - Intergenic
1056993228 9:91430298-91430320 CCATTTATGGAGCACCTGCTGGG + Intergenic
1058336148 9:103831911-103831933 AATTGTCTGGAGCACATGCTTGG + Intergenic
1058596779 9:106623375-106623397 AAATGTATGAAGCACTGGCTGGG - Intergenic
1058668777 9:107343174-107343196 AAATGTATTGAGCACCTACTAGG - Intergenic
1058735588 9:107891151-107891173 AAATGCTTGGAAAACATGCTTGG + Intergenic
1059903352 9:118953542-118953564 AAATGTATGGATCACCATTTGGG + Intergenic
1059963734 9:119592920-119592942 ATATTTATAAAACACCTGCTAGG + Intergenic
1060496697 9:124124726-124124748 AAATGCATGACACTCCTGCTGGG - Intergenic
1186545530 X:10445172-10445194 ATATGTATGGACCAACTGCTAGG + Intergenic
1187284884 X:17895672-17895694 ATATGTATTGAACACTTACTTGG + Intergenic
1187520838 X:20012509-20012531 CAATGGATTGAACACCTGCCAGG - Exonic
1190427587 X:50347271-50347293 TGAGGTATGGAACACCTTCTAGG + Intronic
1191153702 X:57248330-57248352 ACATACAGGGAACACCTGCTAGG + Intergenic
1193509858 X:82385408-82385430 AAATGTTGAGGACACCTGCTTGG + Intergenic
1193512158 X:82416396-82416418 AAATGTATGGAACACTTACTAGG - Intergenic
1194263155 X:91722658-91722680 AAATTTGAGGAACACTTGCTAGG - Intergenic
1194917174 X:99720775-99720797 AAATGTTTCGAAGACCTGATGGG - Intergenic
1196768296 X:119269679-119269701 AAACGTATGGACCACTTTCTGGG + Intergenic
1199315046 X:146366984-146367006 ACATTTATTGAGCACCTGCTCGG + Intergenic
1199513611 X:148650944-148650966 ACATTTATCCAACACCTGCTAGG + Intronic