ID: 1105567124

View in Genome Browser
Species Human (GRCh38)
Location 13:21560675-21560697
Sequence TGCAATAATCCCAATGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105567124_1105567131 15 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567131 13:21560713-21560735 TAGATTAGGGGTTACAAACTAGG 0: 1
1: 0
2: 1
3: 14
4: 127
1105567124_1105567129 2 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567129 13:21560700-21560722 TACACTGAATTTATAGATTAGGG 0: 1
1: 1
2: 3
3: 44
4: 316
1105567124_1105567128 1 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567128 13:21560699-21560721 TTACACTGAATTTATAGATTAGG 0: 1
1: 0
2: 7
3: 93
4: 707
1105567124_1105567132 23 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567132 13:21560721-21560743 GGGTTACAAACTAGGTCAACAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1105567124_1105567130 3 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567130 13:21560701-21560723 ACACTGAATTTATAGATTAGGGG 0: 1
1: 0
2: 2
3: 24
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105567124 Original CRISPR TGCAATAATCCCAATGGGGT AGG (reversed) Intronic
907322935 1:53617006-53617028 TGCATGAAGCCCCATGGGGTGGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913244542 1:116860108-116860130 AGCAATAATCTGAATGAGGTAGG - Intergenic
916145787 1:161738095-161738117 GGCAATAAGCCCAATGGGGCTGG - Intergenic
916835598 1:168541804-168541826 TGCAATAATCGCTATTCGGTTGG + Intronic
916839006 1:168580344-168580366 TGCAATAATCGCTATTCGGTTGG - Intronic
917470068 1:175318922-175318944 TTCAATAATCCCAAAGAAGTTGG - Exonic
919546309 1:198923888-198923910 TGCTATAATGCCTATGGGATAGG - Intergenic
922688282 1:227665043-227665065 TGGTATAATCCCCATTGGGTAGG - Intronic
1063089040 10:2845323-2845345 TGCAACGATCCCGATGGGCTGGG + Intergenic
1066217987 10:33306721-33306743 AAAAATATTCCCAATGGGGTAGG + Intronic
1066271239 10:33826018-33826040 TCCAATACTCCCAGTGGGGTAGG - Intergenic
1067702408 10:48583339-48583361 TGCAGTGATCCCCCTGGGGTAGG + Intronic
1072966423 10:99977139-99977161 TGCACTCATTCCAATGGAGTAGG - Intronic
1079379154 11:19921789-19921811 TGCTATAAATCCAATGAGGTAGG - Intronic
1079587105 11:22139664-22139686 AGCCATAATCCCAATGCGTTGGG + Intergenic
1082085554 11:48046730-48046752 TGTAATAATCCACATAGGGTAGG - Intronic
1085269254 11:75260583-75260605 TGCAATTGTCCCAGTGAGGTGGG + Intergenic
1086297873 11:85391377-85391399 TGGAATAGTACCAATGGGATTGG - Intronic
1088407205 11:109495166-109495188 TGCAGTAATCAAGATGGGGTAGG + Intergenic
1093183607 12:15994905-15994927 TGCAGTAATCCCAAGAGGGAGGG + Intronic
1097548724 12:61039031-61039053 TGAAATATTCCCACTGTGGTGGG + Intergenic
1103757935 12:123224574-123224596 TGCAGTGATCTCAATGGGGAAGG + Intronic
1104050767 12:125192163-125192185 TTCAACAACCCTAATGGGGTAGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1107770313 13:43781966-43781988 AGCAATCATCCCATTTGGGTGGG + Intronic
1109292386 13:60492419-60492441 TCCAAATATCCCAATGAGGTAGG + Intronic
1114693472 14:24606529-24606551 GGCAAGAATCCCCAAGGGGTGGG - Exonic
1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG + Intergenic
1118273303 14:64363313-64363335 TGCAATATTTCCCATGGGGGAGG + Intergenic
1123158436 14:106252939-106252961 TGCAAGAATCACAAAGGGGAAGG - Intergenic
1202889267 14_KI270722v1_random:140450-140472 TGCACTAATCCCAATCAGGATGG + Intergenic
1129779121 15:78257871-78257893 TACAAAAAGCCCAATAGGGTGGG - Intergenic
1133258660 16:4534410-4534432 TGCAGTGATCACAATGGGGCTGG + Intronic
1134612575 16:15621622-15621644 TGCAATCATCACAAGGGGGTGGG + Intronic
1136924561 16:34359855-34359877 TGCAACACTCCCAATGGGGAGGG + Intergenic
1136980012 16:35051951-35051973 TGCAACACTCCCAATGGGGAGGG - Intergenic
1140152479 16:72383575-72383597 TCCAATCATACCATTGGGGTTGG - Intergenic
1140983573 16:80136142-80136164 TGCAATCAACCCTATTGGGTCGG + Intergenic
1149038586 17:52159919-52159941 TTCAATAACCCCAAAGAGGTAGG - Intronic
1149122114 17:53181940-53181962 TGGAATAATGCCAATAGGATTGG + Intergenic
1153325988 18:3820720-3820742 TGGAATAATCTCAATGAGCTAGG + Intronic
1153325997 18:3820883-3820905 TGGAATAATCTCAATGAGCTAGG + Intronic
1155311311 18:24526661-24526683 TGGAATAATCCCAATGGTATGGG + Intergenic
1164408366 19:27975408-27975430 TGCAACACTCCTAATGGGGAGGG - Intergenic
1202664662 1_KI270708v1_random:107219-107241 TGCACTAATCCCAATCAGGATGG + Intergenic
925449331 2:3954538-3954560 AGCAGTAACCCCAGTGGGGTGGG + Intergenic
925786056 2:7432056-7432078 TGCATTAATCTCATCGGGGTTGG + Intergenic
926232781 2:11017642-11017664 AGCATTAATCCCTGTGGGGTAGG + Intergenic
926312606 2:11685431-11685453 TGCAATAATCCAAGTGGGAGGGG + Intronic
927526314 2:23744573-23744595 TGCAGTAACCACCATGGGGTTGG + Intergenic
928359656 2:30652956-30652978 TGCAAATATCCAAATGGGGGTGG + Intergenic
931166536 2:59754989-59755011 TTCAAGAATCCTAATGGAGTAGG + Intergenic
931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG + Intergenic
933111044 2:78400701-78400723 TGCAATAGTGTCAATAGGGTAGG - Intergenic
933739653 2:85523512-85523534 TGCAACAATCCTAATGAGGTAGG + Intergenic
937467247 2:122145179-122145201 TCCAATATTTCAAATGGGGTGGG + Intergenic
940411650 2:153371045-153371067 TTTAATAATCCCAATTGTGTTGG - Intergenic
941111340 2:161421608-161421630 TTCAGTAATCCCAAGTGGGTGGG + Intronic
941132377 2:161669225-161669247 TCCCATAATCCCAATTTGGTAGG - Intronic
943158360 2:184214211-184214233 TGGAATAATTCCAATAGGATTGG + Intergenic
1168993362 20:2113660-2113682 TTCAATAATCCCAGTGCTGTAGG - Intronic
1170726644 20:18934018-18934040 TGGAATAATCTCAATAGGATTGG + Intergenic
1172731398 20:37091797-37091819 TGCAATAATCTAAAAGGGGTGGG + Intronic
1178678211 21:34648895-34648917 TGCAATCATGCCAGTGGAGTGGG + Intergenic
1179776229 21:43664944-43664966 TGTAATAATCCCCACGTGGTGGG - Intronic
1180331392 22:11484139-11484161 TGCACTAATCCCAATCAGGATGG + Intergenic
1181747002 22:24962443-24962465 TGCAATATTCCCAAGGGAATGGG - Intronic
1183133993 22:35869085-35869107 TGAAAGAATCACAGTGGGGTGGG - Intronic
949353758 3:3155151-3155173 TGCCATAATCCCTATGGACTGGG - Intronic
949478657 3:4472556-4472578 TGCAAGAAATCCTATGGGGTTGG + Intergenic
954134585 3:48576110-48576132 TACAAGAACCCCAATGGGGCAGG + Intronic
956661139 3:71599093-71599115 TGCTAAAATGCCAATGGAGTTGG - Intergenic
957091274 3:75732514-75732536 TGCACTAATCCCAATCAGGTTGG - Intronic
959451665 3:106511015-106511037 TTCAATAATCTCCGTGGGGTTGG + Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969398254 4:6937367-6937389 GGCACTAATCCCACTGGGGAGGG + Intronic
970283938 4:14488154-14488176 TGGAATAATGTCAATAGGGTTGG - Intergenic
971178132 4:24301402-24301424 TGCAAATAGCCCTATGGGGTAGG + Intergenic
973070356 4:45850652-45850674 TGCAATAATCTGAATAGGATTGG - Intergenic
974561489 4:63527900-63527922 TGTAATAATCCCTATGAGTTAGG + Intergenic
976771371 4:88656601-88656623 TGCAGTAATCCCAATGTTGGAGG - Intronic
978096096 4:104780318-104780340 TACAAAAATGCCAATGGGGTGGG + Intergenic
981246427 4:142545331-142545353 TGCAATTAACCCTATGAGGTAGG + Intronic
986548433 5:8924985-8925007 TGCAATAGTCCCAGTGGTGGTGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
992624510 5:78625087-78625109 TGCAATTCTCCAAATGGAGTTGG + Intronic
996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG + Intergenic
997763659 5:136476433-136476455 TGGAATAGTGCCAATGGGATTGG + Intergenic
1000308398 5:160017504-160017526 TGAAATAATCCCCATTGTGTTGG - Intronic
1002170944 5:177373893-177373915 TGCAAAGATTCCAATGGGGAAGG - Intergenic
1002698680 5:181107423-181107445 TGCAAAAAAGCCAGTGGGGTGGG - Intergenic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1004904138 6:20220487-20220509 GGCAATAACTCCAATGTGGTAGG - Intergenic
1007152554 6:39708455-39708477 TACAATAAGGCCAATGAGGTTGG - Intronic
1009792591 6:68422160-68422182 GTCAATGATCCCAATGGGATGGG + Intergenic
1010840360 6:80642403-80642425 GAGAATAATCCTAATGGGGTTGG + Intergenic
1011402145 6:86975217-86975239 TGGAATAAACTCAATGGAGTTGG - Intronic
1013634913 6:112020099-112020121 TGCACAAAGCCCCATGGGGTAGG + Intergenic
1015232892 6:130937059-130937081 GGTAATTATCCCAATGGGGGAGG - Intronic
1023353679 7:39345707-39345729 TGGAAGAATCCACATGGGGTAGG + Intronic
1024498360 7:50072208-50072230 GGCAATAATCCCACTGGCCTGGG + Intronic
1024516678 7:50265294-50265316 TGCAAAAATGCCAAAGGGGCAGG + Intergenic
1026127655 7:67593690-67593712 TGCCATCCTCCCAATGAGGTTGG - Intergenic
1026225663 7:68437875-68437897 GGAAATAATTCCAATGGTGTGGG - Intergenic
1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG + Intergenic
1027556039 7:79665883-79665905 AGCAAAAAACCCAAAGGGGTTGG - Intergenic
1032518179 7:132522348-132522370 AGCAATAATCCTAATGGGTTGGG - Intronic
1034035960 7:147822460-147822482 TGCAATACTTCCAACAGGGTGGG - Intronic
1042433334 8:68734600-68734622 TACAATAATGGCAATGAGGTGGG - Intronic
1042439052 8:68803305-68803327 TGCAATAAACTCAATGTAGTAGG - Intronic
1043033849 8:75172028-75172050 GGCTATAATCCCAATGCTGTGGG + Intergenic
1045718556 8:105078116-105078138 TGCACTAATCCAAATGGGTCAGG + Intronic
1047979837 8:130169589-130169611 AGCAATAATACCAACGGGTTTGG + Intronic
1053474823 9:38375203-38375225 AGCAACAAGCCCAAGGGGGTGGG - Intergenic
1059943981 9:119387274-119387296 TGCAAAAATGCCACTGAGGTTGG - Intergenic
1187247111 X:17562570-17562592 TGCTATAATCACAAAGGGGTGGG + Intronic
1198762617 X:140048936-140048958 TGCCAAACTCCCAATGAGGTAGG - Intergenic
1200854823 Y:7926165-7926187 TCCAATAATCCCAATAGCATTGG + Intergenic