ID: 1105567128

View in Genome Browser
Species Human (GRCh38)
Location 13:21560699-21560721
Sequence TTACACTGAATTTATAGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 0, 2: 7, 3: 93, 4: 707}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105567124_1105567128 1 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567128 13:21560699-21560721 TTACACTGAATTTATAGATTAGG 0: 1
1: 0
2: 7
3: 93
4: 707
1105567127_1105567128 -5 Left 1105567127 13:21560681-21560703 CCATTGGGATTATTGCAATTACA 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1105567128 13:21560699-21560721 TTACACTGAATTTATAGATTAGG 0: 1
1: 0
2: 7
3: 93
4: 707
1105567125_1105567128 -3 Left 1105567125 13:21560679-21560701 CCCCATTGGGATTATTGCAATTA 0: 1
1: 0
2: 1
3: 22
4: 180
Right 1105567128 13:21560699-21560721 TTACACTGAATTTATAGATTAGG 0: 1
1: 0
2: 7
3: 93
4: 707
1105567126_1105567128 -4 Left 1105567126 13:21560680-21560702 CCCATTGGGATTATTGCAATTAC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1105567128 13:21560699-21560721 TTACACTGAATTTATAGATTAGG 0: 1
1: 0
2: 7
3: 93
4: 707

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105567128 Original CRISPR TTACACTGAATTTATAGATT AGG Intronic
901047869 1:6409342-6409364 TTAGACTGAGTTTATTGATAAGG + Intergenic
901115683 1:6841948-6841970 CTACACTGACTTCAAAGATTTGG - Intronic
901819668 1:11819789-11819811 CTACATTAAATTTACAGATTAGG - Intronic
901862670 1:12084892-12084914 TTACACTCAATTTGCAGATGAGG + Intronic
903291882 1:22319096-22319118 TTACACTCACTTTACAGATGAGG - Intergenic
903496646 1:23772593-23772615 TTACATTTAATTTATAAATTAGG + Intergenic
903644167 1:24882345-24882367 TTGCACTGAATCTATAGATCAGG + Intergenic
904335624 1:29795766-29795788 TCAGGCTGAATTTATTGATTTGG + Intergenic
904628114 1:31819929-31819951 TTTCATCGAATTTACAGATTAGG + Intergenic
904794590 1:33049782-33049804 TAACATTTAATTTATAAATTAGG + Intronic
905353781 1:37366573-37366595 TCAAGCTGAATTTATTGATTTGG + Intergenic
905464923 1:38145891-38145913 TCAGGCTGAATTTATTGATTTGG + Intergenic
906230463 1:44158281-44158303 TTAGCCTGAGGTTATAGATTTGG - Intergenic
906773112 1:48502819-48502841 TTATACTGATTTAATAGATGAGG - Intergenic
906879400 1:49574264-49574286 TTAGGCTGAATTTATTGATTTGG + Intronic
907238543 1:53067749-53067771 TTACACAAAATTTAAAAATTTGG + Intronic
907780051 1:57558631-57558653 TCAGGCTGAATTTATTGATTTGG + Intronic
908097374 1:60752987-60753009 TTACCCTGATTTTATAGTTGAGG - Intergenic
908369542 1:63468193-63468215 TTTCACAGAATTTATAAAATTGG - Intronic
908464448 1:64378114-64378136 TTACATTGAATCTGTAGATTGGG + Intergenic
908737273 1:67289889-67289911 TCAGGCTGAATTTATTGATTTGG + Intergenic
908917889 1:69153185-69153207 TTTCATTGAATCTGTAGATTGGG + Intergenic
908956032 1:69628554-69628576 TTACACAGAATCTATGGATCAGG - Intronic
909067953 1:70959251-70959273 TTGCATTGAATCTGTAGATTGGG + Intronic
909172892 1:72317662-72317684 TCAGGCTGAATTTATTGATTTGG - Intergenic
909495857 1:76278051-76278073 TTTCATTAAATTTATAGTTTTGG + Intronic
909549245 1:76879364-76879386 TCAGGCTGAATTTATTGATTTGG - Intronic
910106363 1:83635324-83635346 TTACACTGATTTTAAAGGTAAGG + Intergenic
910587911 1:88899527-88899549 TCAGGCTGAATTTATTGATTTGG + Intergenic
910595982 1:88981389-88981411 TTACACAGATTTTACAGCTTTGG - Exonic
910831446 1:91465918-91465940 TCAGGCTGAATTTATTGATTTGG - Intergenic
910948134 1:92615954-92615976 TCAGGCTGAATTTATTGATTTGG + Intronic
911305769 1:96230371-96230393 ATACATTTAATTTATAAATTTGG + Intergenic
911454985 1:98111306-98111328 TAACACTGCCTTTATAGATGTGG - Intergenic
911728193 1:101264546-101264568 TTTCACTGAATTTATAGATGAGG - Intergenic
911833676 1:102587501-102587523 TAACATTTAATTTATAAATTAGG + Intergenic
911883286 1:103268269-103268291 TCAGTCTGAATTTATTGATTTGG + Intergenic
911985671 1:104618666-104618688 TTACTCCTAATTTATAGATAAGG - Intergenic
912130193 1:106590257-106590279 TCAGGCTGAATTTATTGATTTGG - Intergenic
912821122 1:112868477-112868499 CTACAGTGACTTTAGAGATTAGG - Intergenic
912954720 1:114146845-114146867 TTACCCCCAATTTATAGATGAGG - Intronic
913039618 1:115009741-115009763 TCAGGCTGAATTTATTGATTTGG + Intergenic
913175512 1:116269434-116269456 TTAAAATGAAGTTATTGATTAGG - Intergenic
913421257 1:118672227-118672249 TTACACTGGAGAAATAGATTTGG + Intergenic
915292296 1:154894135-154894157 TTGCACTGAATCTATAAATTTGG - Intergenic
915400244 1:155616730-155616752 TTACACTAGATTTAGAGATGGGG + Intergenic
916602028 1:166302557-166302579 TTATCCTCAATTTATAGATGAGG + Intergenic
917631510 1:176895394-176895416 TTATACTCAGTTTATAGATGAGG + Intronic
917886882 1:179394939-179394961 GTACACTCAATTTCTTGATTTGG + Intronic
917990662 1:180375031-180375053 TTGCATTGAATTTATAAGTTAGG - Intronic
918024603 1:180731050-180731072 TTACATTGTATTAATATATTAGG + Intronic
918755251 1:188332343-188332365 TTGCATTGAATCTGTAGATTGGG + Intergenic
918957973 1:191235822-191235844 TCACGCTGAATTTATTGATTTGG + Intergenic
919184774 1:194131334-194131356 TTAAATTTAATTTATAAATTAGG + Intergenic
919230298 1:194764763-194764785 TCAGGCTGAATTTATTGATTTGG - Intergenic
919243061 1:194939643-194939665 TTACACTGGATTTTTGGGTTTGG - Intergenic
920197131 1:204236156-204236178 TCAGGCTGAATTTATTGATTTGG + Intronic
920567952 1:206990908-206990930 TTAAACTGAATGTTTGGATTAGG - Intergenic
921501138 1:215904775-215904797 TTCCTTTGAGTTTATAGATTGGG - Intronic
921517367 1:216112324-216112346 TTACAATGGAACTATAGATTAGG + Intronic
921687801 1:218110265-218110287 TTACTCTCACTTTATAGATGAGG + Intergenic
921833532 1:219754653-219754675 TTGCACTGAATCTACAGACTGGG - Intronic
921927632 1:220724886-220724908 TTGCATTGAACCTATAGATTTGG + Intergenic
922640846 1:227230397-227230419 TTTCATAGAATTTATAGATTAGG + Intronic
923848405 1:237764191-237764213 TTACCTTGATTTTATAGATAAGG + Intronic
924027635 1:239852130-239852152 TTACACTGAATTTGTTGAAGGGG + Intronic
924076679 1:240346236-240346258 TAAAACTTAATTTATAAATTAGG + Intronic
924528753 1:244875672-244875694 TTATTCTCAATTTATAGATATGG + Intergenic
924841036 1:247709750-247709772 TCAGGCTGAATTTATTGATTTGG - Intergenic
924847437 1:247787434-247787456 TCAGGCTGAATTTATTGATTTGG - Intergenic
1062853446 10:764421-764443 TTACATGGAATCTGTAGATTAGG - Intergenic
1063144755 10:3286755-3286777 TGACACTCAATTTTTAGTTTGGG - Intergenic
1064768142 10:18695821-18695843 TTACAATGCAATTAAAGATTTGG - Intergenic
1065256344 10:23872798-23872820 ATACACTTAATTTTTAGAATAGG + Intronic
1065622297 10:27594648-27594670 GTAGACTGCATTTATAGTTTGGG - Intergenic
1065645043 10:27825252-27825274 TTGAACTGAATTTAATGATTAGG + Intronic
1066543436 10:36474259-36474281 TCAGGCTGAATTTATTGATTTGG + Intergenic
1066547800 10:36519995-36520017 TTAGACTGAAGTTATGGGTTTGG - Intergenic
1066593667 10:37024352-37024374 TTACACTCCATTTTTAAATTTGG + Intergenic
1066754996 10:38702568-38702590 TTACACTGAATTTTAAAATAAGG - Intergenic
1067754697 10:48996262-48996284 TCAGACTGAATTTATTGATTTGG - Intergenic
1067909234 10:50328163-50328185 TTACATGGAATTTTTATATTAGG - Intronic
1068170267 10:53383554-53383576 GTACACTGATATTATACATTAGG + Intergenic
1068446924 10:57136383-57136405 TCAGGCTGAATTTATTGATTTGG + Intergenic
1068803313 10:61166081-61166103 TTACACTTAATTTCTTAATTAGG + Intergenic
1068804698 10:61182169-61182191 TTATCCTGAATTTATAGATGAGG - Intergenic
1069192611 10:65508576-65508598 TCAGGCTGAATTTATTGATTTGG - Intergenic
1070008172 10:72445788-72445810 TTATACTGATTTTATAGATGAGG - Intronic
1070056925 10:72944504-72944526 ATCCATTGAATGTATAGATTTGG + Intronic
1071378101 10:85031221-85031243 TCAGGCTGAATTTATTGATTTGG + Intergenic
1071561092 10:86647324-86647346 TTACACTGTTTTTACAGCTTGGG + Intergenic
1071914873 10:90282267-90282289 TAACATTTAATTTATAAATTAGG + Intergenic
1071934354 10:90510803-90510825 TTGCATTGAATTTATAGATTTGG - Intergenic
1072128430 10:92468404-92468426 TTTTATTGAATTTATATATTGGG - Intronic
1072209558 10:93233895-93233917 TCAGGCTGAATTTATTGATTTGG - Intergenic
1072360186 10:94651943-94651965 TCAGGCTGAATTTATTGATTTGG + Intergenic
1072509574 10:96106198-96106220 TTACATTGAATATATAAAGTTGG + Intergenic
1072860735 10:99002486-99002508 TTAAACTGAGGTTATAGATTTGG - Intronic
1072959073 10:99913291-99913313 TTATCCTCATTTTATAGATTGGG - Intronic
1073450943 10:103608480-103608502 TTTCATCGAATTTACAGATTAGG + Intronic
1073499549 10:103923434-103923456 TTCCACTGAAGTCATAGGTTTGG - Intergenic
1073576276 10:104628314-104628336 TTTGACTGAATTTTTATATTAGG - Intergenic
1073656949 10:105426514-105426536 TCAGGCTGAATTTATTGATTTGG - Intergenic
1073854808 10:107662009-107662031 TCAGGCTGAATTTATTGATTTGG + Intergenic
1074718468 10:116243213-116243235 TTAAAATGAATTTATAGTTTGGG - Intronic
1075606583 10:123815905-123815927 TCAGACTGAATTTATTGATTTGG + Intronic
1076927708 10:133501437-133501459 TCAGGCTGAATTTATTGATTTGG - Intergenic
1077645928 11:3923907-3923929 TTGCATTAAATCTATAGATTGGG + Intronic
1077822638 11:5764693-5764715 CTACTCTGAGTTTATACATTAGG + Intronic
1078547865 11:12259117-12259139 TTACACTGAACCTATATATTTGG - Intronic
1078817633 11:14842347-14842369 TTACTTGGAATTTATATATTAGG - Intronic
1078902388 11:15653427-15653449 CTACACTCACTTTATAGATAAGG + Intergenic
1079001187 11:16758182-16758204 TGATACTGAATTGATAGATCAGG - Intergenic
1079313038 11:19383024-19383046 CTACATTGAATTTCTACATTAGG + Intronic
1079869480 11:25779891-25779913 TTACACTCAACTTACAGATGAGG - Intergenic
1080368200 11:31603014-31603036 TGACACTGAATTTATTTATATGG - Intronic
1080843522 11:36006238-36006260 TTACAATTAATTCACAGATTAGG + Intronic
1080976561 11:37349631-37349653 TCAGGCTGAATTTATTGATTTGG + Intergenic
1081148285 11:39593583-39593605 TTATACTGATTTTATAGACAAGG + Intergenic
1082129083 11:48465939-48465961 TTACACTTATTTTACACATTAGG + Intergenic
1082248330 11:49951467-49951489 TTACACTTATTTTACACATTAGG - Intergenic
1082562620 11:54636897-54636919 TTACACTTATTTTACACATTAGG + Intergenic
1082764369 11:57155505-57155527 TTACAGTGATTTTACAGATGAGG - Intergenic
1082926869 11:58557902-58557924 TTACATTGAATTTACAGTTTAGG - Intronic
1082999331 11:59277328-59277350 TTAGGCTGAATTTATTGATTTGG + Intergenic
1083092861 11:60218887-60218909 TCAGGCTGAATTTATTGATTTGG + Intronic
1085246969 11:75109521-75109543 TTACACTTATTTTACAGAGTAGG - Intronic
1085658124 11:78335798-78335820 ATGCATTGAATCTATAGATTTGG + Intronic
1085698684 11:78727587-78727609 TTACAGTGAATATATAGAAAAGG + Intronic
1085747282 11:79126017-79126039 TCAGGCTGAATTTATTGATTTGG + Intronic
1085806278 11:79639607-79639629 TTATACTGATTTTATAGTTGAGG + Intergenic
1086007606 11:82056955-82056977 TTACCCTCATTTTATAGTTTAGG + Intergenic
1086141646 11:83506307-83506329 TCAGGCTGAATTTATTGATTTGG - Intronic
1086191684 11:84086879-84086901 TTACACGAAATTTCTAGAATAGG - Intronic
1086465202 11:87045982-87046004 TTACATTGAGTTTATAGTTTAGG + Intronic
1086517706 11:87632705-87632727 GGACACTGCAGTTATAGATTTGG + Intergenic
1086541625 11:87918988-87919010 TTATACTGTATTTACAGTTTAGG + Intergenic
1086833837 11:91598169-91598191 TTGGTCTGAATTTATTGATTTGG + Intergenic
1087269278 11:96095022-96095044 TTACCCTTAATTTATAAATAAGG + Intronic
1087411081 11:97790640-97790662 TCAGGCTGAATTTATTGATTTGG - Intergenic
1087464542 11:98488348-98488370 TTACACTGAAATTTTAGTTTAGG - Intergenic
1087661584 11:100995134-100995156 TTACACTGGAATTATGGGTTTGG - Intergenic
1087977505 11:104567558-104567580 TACCAATGAATTTAAAGATTTGG - Intergenic
1087999090 11:104852562-104852584 TTACCCTGATTTTATAAATGAGG - Intergenic
1088061047 11:105651173-105651195 TTTCAGTGACTTTATAAATTAGG - Intronic
1088191976 11:107236726-107236748 TCAGGCTGAATTTATTGATTTGG - Intergenic
1088454381 11:110018259-110018281 TTACACTGAAATGGTAAATTGGG - Intergenic
1088787610 11:113196784-113196806 TTTCACTGATTTTGTAGGTTTGG + Intronic
1089805870 11:121088310-121088332 TTACACTTTACTCATAGATTGGG - Exonic
1089898186 11:121953553-121953575 TTTCACAGATTTTAGAGATTAGG - Intergenic
1090131264 11:124145008-124145030 TTACACTGGATTTAAAACTTAGG + Intronic
1090843136 11:130509967-130509989 TTACCCTGAGTTTACAGATCAGG + Intergenic
1091247925 11:134115589-134115611 TTAGACTTGGTTTATAGATTGGG + Intronic
1091502305 12:1030229-1030251 TTACACTTTATTTTTGGATTAGG + Intronic
1092073421 12:5652694-5652716 TTAGACTGAAGTTATGCATTTGG + Intronic
1092380988 12:7996971-7996993 TCAGGCTGAATTTATTGATTTGG + Intergenic
1092610472 12:10167087-10167109 TTACTCAGAAGTTACAGATTTGG + Intronic
1092766150 12:11854797-11854819 CAACACTGAGTTCATAGATTTGG - Intronic
1092825213 12:12392596-12392618 TTAGTCTCAATTTATAGATAAGG - Intronic
1092879040 12:12873599-12873621 TCAGCCTGAATTTACAGATTGGG + Intergenic
1093141323 12:15513438-15513460 TTATATTGAATTAATAAATTGGG - Intronic
1093463378 12:19426364-19426386 TTCCACTGACTTTACAGAATCGG + Intronic
1093864216 12:24205439-24205461 TTATACTAATTTTATAGATGAGG + Intergenic
1094102244 12:26777042-26777064 TCAGGCTGAATTTATTGATTTGG + Intronic
1094210030 12:27879385-27879407 ATACACTGATTTTATATTTTTGG + Intergenic
1094240136 12:28212977-28212999 TTATAGTGAGTTTATTGATTGGG + Intronic
1094557232 12:31513156-31513178 TTATACTGAGTTTATAGGTTTGG + Intronic
1094608227 12:31968046-31968068 TTACACTGAATTGTTAGTATTGG + Intronic
1095503682 12:42868877-42868899 TTACAGGTAATTTATAGATAAGG - Intergenic
1095504733 12:42882998-42883020 TTATACTCAAGTTAGAGATTAGG + Intergenic
1095856513 12:46865890-46865912 TCAGGCTGAATTTATTGATTTGG - Intergenic
1097431796 12:59518452-59518474 TCAGGCTGAATTTATTGATTTGG - Intergenic
1097483738 12:60166645-60166667 AAAAACTGAATTTATAAATTGGG + Intergenic
1097501071 12:60403062-60403084 TTACAATTAATTTATTTATTTGG - Intergenic
1097509833 12:60524564-60524586 TTGCATTGAATTTGTAGACTGGG + Intergenic
1097685337 12:62685537-62685559 TTATACCCAATTTACAGATTGGG - Intronic
1097799912 12:63902371-63902393 TTAAACTTATTTTATAGATGAGG + Intronic
1097821728 12:64134730-64134752 TCAGGCTGAATTTATTGATTTGG - Intronic
1097843661 12:64344986-64345008 TCAGGCTGAATTTATTGATTTGG - Intronic
1098805162 12:75013855-75013877 TCAGACTGAATTTATTGATTTGG + Intergenic
1099184084 12:79498891-79498913 TCATGCTGAATTTATTGATTTGG - Intergenic
1099186399 12:79520287-79520309 TTATATTTAATTTATACATTTGG + Intergenic
1099379952 12:81940967-81940989 TCAGGCTGAATTTATTGATTTGG - Intergenic
1099401402 12:82206927-82206949 TCAGGCTGAATTTATTGATTTGG - Intergenic
1100067181 12:90663690-90663712 TTACAGGTAATTTAAAGATTGGG + Intergenic
1100092747 12:90991678-90991700 TGACACTGAAAATATAGATGAGG + Intronic
1100154216 12:91777974-91777996 TAAAATTGAATTTATAAATTAGG - Intergenic
1100241462 12:92713913-92713935 TCAGGCTGAATTTATTGATTTGG - Intergenic
1100744332 12:97628908-97628930 TTAAAATGTATTAATAGATTAGG - Intergenic
1101259699 12:103015836-103015858 TTCCACTCAGTTAATAGATTAGG - Intergenic
1101378853 12:104195218-104195240 TTGCACTGAATCTTTAGATTAGG + Intergenic
1101514981 12:105426282-105426304 TTACATTGACTTTATAAATAAGG + Intergenic
1101542790 12:105680430-105680452 TCAGGCTGAATTTATTGATTTGG + Intergenic
1102359444 12:112271526-112271548 TTAGACTGAAGTTACGGATTGGG - Intronic
1103000303 12:117380611-117380633 TAACCCTCATTTTATAGATTAGG + Intronic
1103035274 12:117651509-117651531 TCAGGCTGAATTTATTGATTTGG + Intronic
1103257977 12:119559343-119559365 TTACAGTAAATACATAGATTAGG - Intergenic
1103784767 12:123424057-123424079 TTAGACTCATTTTATAGGTTAGG - Intronic
1104473153 12:129047405-129047427 TTTAACTTGATTTATAGATTGGG - Intergenic
1104621895 12:130320216-130320238 TTGCAGTGAATCTATAGATCTGG - Intergenic
1105333824 13:19444629-19444651 TTGCATTGAATTTATAGACTGGG - Intronic
1105390637 13:19974294-19974316 TTACACTTAATTTATATTTGTGG + Intronic
1105567128 13:21560699-21560721 TTACACTGAATTTATAGATTAGG + Intronic
1105861114 13:24414764-24414786 TTGCATTGAATTTATAGACTGGG + Intergenic
1105922467 13:24977158-24977180 TTGCATTGAATTTATAGACTGGG - Intergenic
1106203963 13:27571652-27571674 TTACAATGAATTTATAAAATAGG + Intronic
1106460971 13:29968210-29968232 TAGCACTGAATATATACATTAGG + Intergenic
1106479481 13:30126266-30126288 TTACATGTAATTGATAGATTTGG + Intergenic
1106556756 13:30816496-30816518 TCACCCTGACTTTATAGATGGGG + Intergenic
1107206901 13:37802503-37802525 TTAAACTGAGGTTATGGATTTGG + Intronic
1107209943 13:37840903-37840925 TGACACTGAATTTGTAGAGAAGG - Intronic
1107487965 13:40849134-40849156 TTGCGTTGAATTTATAGATTGGG - Intergenic
1107583835 13:41822247-41822269 TTTCATTGAATTTGTACATTGGG + Intronic
1107983862 13:45758191-45758213 TCAGGCTGAATTTATTGATTTGG - Intergenic
1108093089 13:46871267-46871289 ACCCACTGAATTTATGGATTTGG - Intronic
1108109999 13:47059774-47059796 TTGAATTGAATTTGTAGATTAGG + Intergenic
1108351123 13:49591915-49591937 TTGCATTGAAATTAAAGATTAGG - Intergenic
1108421011 13:50249490-50249512 TTAAACTGAGTTTATACTTTTGG - Intronic
1108596893 13:51956951-51956973 TTACTCTTAATTTACAGATGAGG - Intronic
1108658551 13:52560721-52560743 TTGCGTTGAATCTATAGATTGGG + Intergenic
1108903999 13:55447748-55447770 TCAGGCTGAATTTATTGATTTGG + Intergenic
1109636741 13:65129410-65129432 TTACATTGAATCTGTAGATTAGG + Intergenic
1109998498 13:70162839-70162861 TTACACTAATTTTTTAGATCTGG + Intergenic
1110114525 13:71795517-71795539 TTACACTGAAATCATTTATTTGG + Intronic
1110346972 13:74459954-74459976 GTATACTCACTTTATAGATTTGG + Intergenic
1110477685 13:75936625-75936647 TTATACTGAAATTTTATATTTGG + Intergenic
1110571324 13:77008120-77008142 TAACACTAAACTTATAGGTTAGG + Intronic
1110835541 13:80078041-80078063 TTGCACTGAATTTCAAGGTTTGG + Intergenic
1111016471 13:82388044-82388066 TCAGGCTGAATTTATTGATTTGG - Intergenic
1111432474 13:88161816-88161838 TTAGCCTGAATTTATTGATATGG - Intergenic
1111783626 13:92759575-92759597 TTTCACTGAATTAATTTATTGGG + Intronic
1111994229 13:95147631-95147653 ATACATAGAATTTATACATTTGG + Intronic
1112045990 13:95598530-95598552 AAATACTGAATTTATATATTAGG + Intronic
1112231424 13:97592380-97592402 TTAGGCTGAATTTATTGATTTGG - Intergenic
1112242857 13:97699315-97699337 TGATACTGATTTTATACATTGGG - Intergenic
1112428088 13:99323237-99323259 TTAAACTTACTTTAGAGATTTGG + Intronic
1113003105 13:105666364-105666386 TTACATTGAATCTACAGATTAGG - Intergenic
1113454151 13:110435970-110435992 TTACAATGAATTTCTATATATGG - Intronic
1113637107 13:111927178-111927200 TAACCCTGAATTTCTAGAATAGG + Intergenic
1113972912 13:114203872-114203894 TTGTATTGAATTTGTAGATTGGG - Intergenic
1114205623 14:20568877-20568899 TCAGGCTGAATTTATTGATTTGG + Intergenic
1114336374 14:21694947-21694969 TTACACCCAACTTATAGATGAGG - Intergenic
1114650391 14:24280973-24280995 TTACACTGAATTCTGAGCTTCGG - Intergenic
1115845497 14:37527837-37527859 TTATACTAAATATATATATTAGG - Intronic
1116183468 14:41566322-41566344 TTACAATGAGTATATAAATTAGG + Intergenic
1116204162 14:41840009-41840031 TTAAATTAAATTTACAGATTGGG - Intronic
1117001292 14:51374069-51374091 TCAGGCTGAATTTATTGATTTGG + Intergenic
1117216534 14:53557883-53557905 TCAGGCTGAATTTATCGATTTGG + Intergenic
1117519056 14:56531980-56532002 TTAAAATGAAATGATAGATTGGG - Intronic
1117596566 14:57332114-57332136 TCAGGCTGAATTTATTGATTTGG - Intergenic
1117882567 14:60326736-60326758 TTCCACTGATTTAATAAATTTGG + Intergenic
1117982075 14:61351488-61351510 TTATTCTGAATTTTAAGATTTGG + Intronic
1118421009 14:65603541-65603563 TTGCATTGAATTTGTAGATTTGG + Intronic
1118660208 14:68000922-68000944 TTACATCGAATTCATAAATTGGG + Intronic
1118667332 14:68085280-68085302 TTAGGCTGGATGTATAGATTGGG + Intronic
1119178190 14:72585131-72585153 GTAGACTGAAAGTATAGATTTGG - Intergenic
1120556286 14:85932664-85932686 TCAGGCTGAATTTATTGATTTGG - Intergenic
1120791911 14:88591946-88591968 TTATTCTTCATTTATAGATTAGG - Intronic
1120973363 14:90228237-90228259 TCAGGCTGAATTTATTGATTTGG + Intergenic
1121012240 14:90527099-90527121 TTACACTGGAGTTATGGGTTTGG + Exonic
1121371079 14:93359069-93359091 TCAGGCTGAATTTATTGATTTGG + Intronic
1121673021 14:95727606-95727628 TTACACTGTATTTATAAACATGG + Intergenic
1123834445 15:24174269-24174291 TTAGACTGAATTTGTAGATGTGG + Intergenic
1123854135 15:24389823-24389845 TTAGACTGAAGTTGTAGATGTGG + Intergenic
1123870095 15:24562446-24562468 TTAGACTGAAGTTGTAGATGTGG + Intergenic
1125153211 15:36557260-36557282 TTGCATTGAGTCTATAGATTTGG + Intergenic
1125382693 15:39104007-39104029 ATCCATTGATTTTATAGATTCGG + Intergenic
1126430979 15:48584228-48584250 TTACCCTCATTGTATAGATTAGG + Intronic
1126594782 15:50374516-50374538 TTATCCTAAATTTATAGATAAGG - Intergenic
1127028764 15:54837530-54837552 TAAAACTGAAGTGATAGATTGGG + Intergenic
1127281422 15:57496778-57496800 TTATCCTGATTTTATTGATTAGG - Intronic
1128410736 15:67394360-67394382 TTACACTCATTTTACAGATGAGG + Intronic
1129581617 15:76817901-76817923 TTGCATTGAATTTATAAATCAGG - Intronic
1129675144 15:77629057-77629079 TTACTCTCACTTTATAGATAAGG + Intronic
1129961684 15:79692282-79692304 TCAGGCTGAATTTATTGATTTGG - Intergenic
1130704642 15:86221231-86221253 CTGCACTGATTTTATAGAATAGG - Intronic
1131468822 15:92677605-92677627 TTGCATTGAGTTTAGAGATTAGG + Intronic
1131632343 15:94192194-94192216 TTACACTGTATTTTTAATTTTGG - Intergenic
1131974472 15:97930465-97930487 TGACTCTGTATTTAAAGATTTGG - Intergenic
1133608492 16:7411512-7411534 TTAGACTGGGGTTATAGATTTGG - Intronic
1135043933 16:19138966-19138988 TTAACCTAAATTTATAGATCTGG + Intronic
1135242013 16:20815815-20815837 TTCCAATGAAATAATAGATTTGG + Intronic
1135699569 16:24620250-24620272 TTATTATGAATTTATAGATAGGG - Intergenic
1136727686 16:32374273-32374295 TTACACTGAATTTTAAAATAAGG + Intergenic
1137343546 16:47634151-47634173 TTATTCTCAATTTATAGATGAGG + Intronic
1138772637 16:59684074-59684096 TTACAATAAATCTATAAATTAGG + Intergenic
1138907549 16:61355604-61355626 TTGCACTGAATCCATAAATTGGG - Intergenic
1139157689 16:64463989-64464011 TTACATTGAATTTATATAAAGGG - Intergenic
1139969971 16:70768244-70768266 TTATACTGAGTTTAAAGATGAGG + Intronic
1140142922 16:72276093-72276115 TTACCCTAAATTTACTGATTTGG - Intergenic
1141086416 16:81098694-81098716 TTACACTCATTTCATAGATGAGG + Intergenic
1203130346 16_KI270728v1_random:1679885-1679907 TTACACTGAATTTTAAAATAAGG - Intergenic
1143464708 17:7128778-7128800 TTAAACTGAGTTTACACATTTGG - Intergenic
1143984784 17:10902947-10902969 TCATACTCAATTTATAGTTTAGG + Intergenic
1144016629 17:11202257-11202279 TTACAGTGAATTCATAATTTAGG + Intergenic
1144395232 17:14836925-14836947 TTACACTGAAATGATTGCTTCGG - Intergenic
1145805166 17:27721792-27721814 TTACACTAGAATTACAGATTGGG + Intergenic
1146036311 17:29409928-29409950 TGACATTGAATTTATAGGATGGG + Intronic
1146566890 17:33921251-33921273 TTACACTGGTTTTATAGGTGAGG - Intronic
1146836212 17:36112949-36112971 TCAGGCTGAATTTATTGATTTGG + Intergenic
1148038303 17:44685798-44685820 TTACTCTCAATTTATAGAAGAGG + Intronic
1148330820 17:46812925-46812947 TTACACTCATTTTACAGATGAGG + Intronic
1149236576 17:54597723-54597745 TTGAATTGAATATATAGATTAGG - Intergenic
1149695637 17:58614161-58614183 TTATACTCATTTTATAGATGAGG + Intronic
1149732578 17:58960966-58960988 TCACATTAAATTTATAGATTTGG - Intronic
1150189143 17:63219455-63219477 TTGCACTGAATGTATAGACGAGG - Intronic
1151037911 17:70822437-70822459 TCAGGCTGAATTTATTGATTTGG - Intergenic
1153034326 18:745288-745310 TTTCACTGGATTTATACTTTAGG + Intronic
1153131558 18:1859913-1859935 TCAGGCTGAATTTATTGATTTGG - Intergenic
1153218002 18:2837829-2837851 TCACACTGAATTTATTGATTTGG - Intergenic
1153563067 18:6391927-6391949 TTGCACTGAATTTGTACTTTGGG - Intronic
1154068178 18:11128912-11128934 TCAGCCTGAATTTATTGATTTGG + Intronic
1156164468 18:34401525-34401547 TTACTGTTAATTTACAGATTTGG + Intergenic
1156756073 18:40527877-40527899 TAATACTGAGTTTATGGATTTGG - Intergenic
1156990579 18:43402924-43402946 TCAGACTGAATTTATTAATTTGG - Intergenic
1157155559 18:45262259-45262281 CTACCCTCATTTTATAGATTAGG + Intronic
1158136639 18:54215057-54215079 TTACACTAGATTTATAGTTGAGG + Intronic
1159079298 18:63718352-63718374 TTATATAGAATCTATAGATTTGG + Intronic
1159146618 18:64462656-64462678 TTACACTGCATTTGTGGGTTTGG - Intergenic
1159287500 18:66373242-66373264 TCAGGCTGAATTTATTGATTTGG + Intergenic
1159335519 18:67059926-67059948 TTACATTGATTTTATTTATTCGG - Intergenic
1160595506 18:79971078-79971100 TTATACGGAATTTCTAGAATAGG - Exonic
1164336959 19:24334186-24334208 CAACACTGACTTTATAGATTCGG + Intergenic
1164924179 19:32113953-32113975 TGACTCTTCATTTATAGATTCGG - Intergenic
1165575523 19:36813317-36813339 TTTCACTGAATCTATAGGTCAGG + Intergenic
1166250397 19:41565399-41565421 TTACCCTGAAGTTACAGATCTGG + Intronic
1166676007 19:44741599-44741621 TTACCCTCATTTTATAGATGAGG + Intergenic
1167826965 19:51982608-51982630 TTTCATTGAATCTGTAGATTTGG - Intronic
1168428825 19:56260896-56260918 TTACACTCATTTTATAGAAATGG + Intronic
1168539657 19:57199580-57199602 TCAGGCTGAATTTATTGATTTGG - Intronic
925460434 2:4058250-4058272 TCAGGCTGAATTTATTGATTTGG + Intergenic
925499689 2:4489137-4489159 TTAGTCTGAATTTATGGATTTGG - Intergenic
926282597 2:11462345-11462367 TAACATTTAATTTATAGATCGGG + Intronic
926505997 2:13716791-13716813 TGACACTGCATTGATACATTTGG - Intergenic
927008615 2:18878884-18878906 TTAGGCTGAATTTGTCGATTTGG + Intergenic
927729600 2:25459349-25459371 TTACACTGAACTTAAAGACACGG - Intronic
928963974 2:36958504-36958526 ATCCACTGAATTTTTAGTTTTGG - Intronic
929664554 2:43823502-43823524 TTCCACTGAATTTGAAAATTAGG + Intronic
930440973 2:51405415-51405437 TTCCACTGAATCTATAGAGCAGG + Intergenic
930456554 2:51613994-51614016 TTAGGTTGAATTTATTGATTTGG - Intergenic
930536878 2:52654490-52654512 TCAGGCTGAATTTATTGATTCGG - Intergenic
931477236 2:62601102-62601124 TAGCACTGAATCTATAAATTTGG + Intergenic
931996950 2:67847884-67847906 TTAAACTGAATTCAGAAATTAGG - Intergenic
932263880 2:70349803-70349825 TTACATTAAATTTATAATTTCGG - Intergenic
932637256 2:73401344-73401366 TAACACCGAATGTATATATTAGG - Intronic
933265991 2:80180946-80180968 TCAGGCTGAATTTATTGATTTGG - Intronic
933621287 2:84544937-84544959 TTACAATGGATTTATACAGTAGG + Intronic
934318287 2:91946803-91946825 TTACACTGAATTTTAAAATAAGG - Intergenic
934605611 2:95692975-95692997 TTACCCTCATTTTATAGATGAGG + Intergenic
935018222 2:99204808-99204830 TTGCACTGAATCTGTAGATTGGG + Intronic
935425387 2:102913550-102913572 TCAGTCTGAATTTATTGATTTGG - Intergenic
935480125 2:103576713-103576735 ATATACTGAATTTATCGATCAGG - Intergenic
935564607 2:104592458-104592480 TCAGGCTGAATTTATTGATTTGG - Intergenic
936507021 2:113116092-113116114 TTACTCTCATTTTATAGATGTGG + Intronic
936539077 2:113335515-113335537 TTACCCTCATTTTATAGATGAGG + Intergenic
936645987 2:114373642-114373664 TTCCACTGAATTTAATGAATTGG + Intergenic
936785654 2:116090973-116090995 TTCCATTGAATCTATAGATTGGG + Intergenic
937525656 2:122766170-122766192 TAACATTGAAAGTATAGATTGGG - Intergenic
937785486 2:125889932-125889954 TCAGGCTGAATTTATTGATTTGG - Intergenic
937852847 2:126650943-126650965 TCAGGCTGAATTTATTGATTTGG - Intergenic
938600508 2:132833921-132833943 TTGCATTGAATCTCTAGATTAGG + Intronic
938606853 2:132903040-132903062 TTACTCTCATTTTATAGATTGGG - Intronic
939179676 2:138789698-138789720 TTACAGGGTTTTTATAGATTTGG + Intergenic
939213530 2:139209689-139209711 TCAAGCTGAATTTATTGATTTGG + Intergenic
939223199 2:139330152-139330174 GTACACTGAATACATATATTGGG - Intergenic
939368189 2:141262957-141262979 TTATGTTAAATTTATAGATTGGG + Intronic
939672794 2:145034227-145034249 TTAGAATGACTTTATAGATTTGG + Intergenic
939788968 2:146548303-146548325 TCAGGCTGAATTTATTGATTTGG - Intergenic
940219784 2:151340179-151340201 TTTCACTGAATGTATAGGTGTGG - Intergenic
941330963 2:164176805-164176827 TCAGGCTGAATTTATTGATTTGG - Intergenic
941426427 2:165351068-165351090 TTACATTTATTTTATAGATGAGG + Intronic
941667714 2:168258952-168258974 TCAGGCTGAATTTATTGATTTGG + Intergenic
941835924 2:170020509-170020531 GTACACTAATTTTATAGATGAGG - Intronic
942718026 2:178916644-178916666 TCACACTGAGTTCTTAGATTTGG + Intronic
942767336 2:179472316-179472338 ATATACTGCATTTTTAGATTAGG - Intronic
942965234 2:181884505-181884527 TTATTCTCACTTTATAGATTGGG - Intergenic
943017803 2:182535265-182535287 TTACATTCATTTTATAGATGAGG + Intergenic
943318130 2:186413875-186413897 TCAGGCTGAATTTATTGATTTGG - Intergenic
943384305 2:187183081-187183103 TGACACTGAATTTATTGATTTGG - Intergenic
943415913 2:187603700-187603722 TTATATTGAATTTATAGGTCAGG - Intergenic
943522029 2:188963535-188963557 TTACTCTCACTTTATAGATTTGG - Intergenic
943840016 2:192568124-192568146 TTACACTGGAGTTATAGGTTTGG - Intergenic
945501992 2:210587564-210587586 TTATACTGATTTTATCCATTAGG + Intronic
945558465 2:211308114-211308136 TTGAACTGAATTTATTGATACGG - Intergenic
945626795 2:212218823-212218845 TTACACATAATATATAGAATGGG + Intronic
946368761 2:219267292-219267314 TTACCCCCAATTTATAGATGAGG - Intronic
946672742 2:222123665-222123687 TTACTTAGAATTTATGGATTTGG - Intergenic
946790645 2:223297525-223297547 TCAGGCTGAATTTATAGATATGG + Intergenic
946827013 2:223689525-223689547 TTACCCTGGTTTTACAGATTAGG + Intergenic
947250340 2:228095961-228095983 TTAATCTGAATTTAAAAATTTGG + Intronic
947878498 2:233484264-233484286 TTTCACTGAATTTACAGACTTGG + Intronic
1169621323 20:7509533-7509555 TTACACTAAATTGAAACATTGGG - Intergenic
1169635581 20:7688109-7688131 TTGCAATGAATCTATAGATTTGG + Intergenic
1171069712 20:22056679-22056701 TTAAACTTATTTTATAGAGTGGG - Intergenic
1171152911 20:22843456-22843478 TTTCCCTGAATTTATAGATAGGG + Intergenic
1171184572 20:23116109-23116131 ACACAGTGAATTTATAGGTTGGG + Intergenic
1171319641 20:24230666-24230688 TTGCATTGAATCTGTAGATTGGG - Intergenic
1171368292 20:24642269-24642291 TTAGACTGAGGTTATAGACTTGG + Intronic
1174193609 20:48757544-48757566 TTACACAGATTTTATAGATGAGG - Intronic
1174728245 20:52888126-52888148 TTAGACTGAAGTTATGGGTTTGG - Intergenic
1174940853 20:54925222-54925244 TTATACTGGAGTTTTAGATTTGG + Intergenic
1176739231 21:10584043-10584065 TTGCATTGAATTTATAGACTGGG + Intronic
1176889366 21:14295576-14295598 TTATTTTTAATTTATAGATTTGG - Intergenic
1176894408 21:14359389-14359411 AAACAATGAATTTATAGACTTGG - Intergenic
1176943491 21:14952057-14952079 TTTCACTGGATTCATACATTCGG + Intergenic
1177363439 21:20103626-20103648 TCAGACTGAATTTATTGATTTGG + Intergenic
1177505903 21:22016740-22016762 TCAGACTGAATTTATTGATTTGG - Intergenic
1177709062 21:24747239-24747261 TTGCATTGAATCTATAGATTGGG - Intergenic
1178020042 21:28397212-28397234 TTACAATGATTTCATGGATTAGG - Intergenic
1178061032 21:28853375-28853397 TCAGGCTGAATTTATTGATTTGG - Intergenic
1178061772 21:28860797-28860819 TCAGGCTGAATTTATTGATTTGG + Intergenic
1178075980 21:29013387-29013409 TTGCATTGAAATTAAAGATTAGG + Intronic
1178083331 21:29088680-29088702 CAACACTCATTTTATAGATTGGG - Intronic
1178220315 21:30649992-30650014 TTACATTGAATCTATAAAGTTGG - Intergenic
1178764115 21:35433160-35433182 TCAGGCTGAATTTATTGATTTGG - Intronic
1178979118 21:37246367-37246389 TTACACTGGAATGACAGATTAGG - Intronic
1180306467 22:11130484-11130506 TTACACTGAATTTTAAAATAAGG - Intergenic
1180544986 22:16492667-16492689 TTACACTGAATTTTAAAATAAGG - Intergenic
1180856051 22:19046093-19046115 TTATACTGAATCTATAATTTGGG + Intronic
1180888514 22:19267385-19267407 TTACATTGAATTTATCAATTTGG - Intronic
1182327764 22:29526801-29526823 TTAGACTGAGATTATGGATTTGG - Intronic
1182805843 22:33069555-33069577 TTACACTCATTTTACAGATAGGG - Intergenic
1183916096 22:41120673-41120695 TTATGCTGAATCTAAAGATTGGG - Intronic
1184530302 22:45051348-45051370 TTACACTGAACTTCTGGAGTGGG - Intergenic
949125948 3:445383-445405 TCAGGCTGAATTTATTGATTTGG - Intergenic
949142993 3:657902-657924 ATAAACTCATTTTATAGATTTGG - Intergenic
950598875 3:14012964-14012986 TTGCACTGAATTTGGAGATTAGG + Intronic
950812472 3:15662186-15662208 TTGCACTGAATCTATAAAGTTGG + Intergenic
951003286 3:17590276-17590298 TCAGGCTGAATTTATTGATTTGG + Intronic
951599124 3:24353657-24353679 TTTCTCTGACTTTATATATTAGG + Intronic
952666878 3:35917603-35917625 TAACATTGAATTTCTAGATTGGG + Intergenic
953425241 3:42790718-42790740 TTACATTGAATTTATAAATTTGG - Intronic
953496949 3:43395807-43395829 TTATACTGAATCTATAGAACAGG + Intronic
953663241 3:44906153-44906175 ATACACTGAATTCACAGGTTTGG + Intronic
954053825 3:48005470-48005492 TCAGGCTGAATTTATTGATTTGG + Intronic
954511833 3:51132208-51132230 TCAGGCTGAATTTATTGATTTGG - Intronic
954512043 3:51133786-51133808 TCAGGCTGAATTTATTGATTTGG + Intronic
955782741 3:62503340-62503362 ATACTCTCAATTTATAGATGAGG - Intronic
955913667 3:63884394-63884416 TTACATTTATTTTATATATTGGG - Intronic
956074591 3:65491276-65491298 CTTCACTGAATTTTTAGATGGGG - Intronic
956494188 3:69806633-69806655 TTCCACTTAATTTTTAGGTTGGG + Intronic
956509355 3:69978135-69978157 TCAGGCTGAATTTATTGATTTGG + Intergenic
957247820 3:77735558-77735580 TCAGGCTGAATTTATTGATTTGG - Intergenic
957714533 3:83908054-83908076 ATAAACAGAATTTATAAATTTGG - Intergenic
958174657 3:89981446-89981468 TTATTCTTATTTTATAGATTGGG + Intergenic
958485413 3:94700283-94700305 TTAGACTGAGATTATGGATTTGG - Intergenic
958486949 3:94724916-94724938 TTACCCTGAATTTTTAGTGTGGG + Intergenic
958490933 3:94772196-94772218 TTACACTTAATTTTTGAATTGGG - Intergenic
958901687 3:99894546-99894568 TTACTCTGAATTTAGATCTTAGG + Intronic
958906934 3:99952086-99952108 TTAAAGAGAATATATAGATTTGG + Intronic
959227058 3:103599520-103599542 TCAGGCTGAATTTATTGATTCGG - Intergenic
959377676 3:105605393-105605415 TCAGGCTGAATTTATTGATTTGG - Intergenic
959604433 3:108226650-108226672 TTATGCTAAATTTATAGATTGGG - Intergenic
959853668 3:111121604-111121626 TTACAATTAATTAATATATTGGG - Intronic
961126571 3:124424058-124424080 TTATTCTCATTTTATAGATTAGG + Intronic
963355953 3:144209072-144209094 TCAGGCTGAATTTATTGATTTGG - Intergenic
963453443 3:145514868-145514890 ATAGGCTGAATTTATTGATTTGG + Intergenic
963566573 3:146938462-146938484 TCAGGCTGAATTTATTGATTGGG + Intergenic
963630017 3:147720997-147721019 TCAGGCTGAATTTATTGATTTGG + Intergenic
963707323 3:148703589-148703611 TTATCCTTATTTTATAGATTGGG + Intronic
964124000 3:153217136-153217158 TTACACCCATTTTATAGATGAGG + Intergenic
964447362 3:156773961-156773983 TTCTACTCAATTTATAGATGAGG + Intergenic
964787607 3:160415493-160415515 TTACACAATAATTATAGATTAGG + Intronic
964858753 3:161176610-161176632 TCACAGTGAATTTATATCTTTGG - Intronic
964943841 3:162193784-162193806 TTACAGTGAATTTAGAATTTGGG + Intergenic
965191105 3:165530772-165530794 TCAGGCTGAATTTATTGATTTGG - Intergenic
965440401 3:168705973-168705995 ATACACTGAATTTACTGATTGGG - Intergenic
965887395 3:173464246-173464268 TTACTCTAATTTTATAGATGTGG + Intronic
966773150 3:183521656-183521678 TTACCCTCAATGTATAGATGAGG - Intronic
966934588 3:184697643-184697665 CTACACAGAATTTAAAAATTAGG - Intergenic
967505568 3:190249406-190249428 TCAGGCTGAATTTATTGATTTGG - Intergenic
967526049 3:190494013-190494035 TTAGACTGAGGTTATAGGTTTGG + Intergenic
967640405 3:191855950-191855972 TCAGTCTGAATTTACAGATTTGG - Intergenic
967831477 3:193923757-193923779 TCAGGCTGAATTTATTGATTTGG + Intergenic
969683933 4:8658708-8658730 TTATATTGAGTCTATAGATTGGG + Intergenic
969692832 4:8714200-8714222 TTGCATTAAATCTATAGATTAGG + Intergenic
970089480 4:12388582-12388604 TCAGGCTGAATTTATTGATTTGG - Intergenic
970570894 4:17381515-17381537 TTAAACTCATTTTATAGATGTGG - Intergenic
970640972 4:18065818-18065840 TTACACTGAACTTACGGATATGG + Intergenic
970780427 4:19731156-19731178 TTACATTGGCATTATAGATTAGG + Intergenic
970839749 4:20453558-20453580 TTAGTCTTAATTTATAGATTAGG + Intronic
971356589 4:25900638-25900660 TTATCCTCAATTTATAGATGAGG + Intronic
971685268 4:29757356-29757378 TCAGGCTGAATTTATTGATTTGG + Intergenic
972094275 4:35328901-35328923 TTACACTGAATTTATGGAGAAGG - Intergenic
972095230 4:35340458-35340480 TCATGCTGAATTTATTGATTTGG + Intergenic
972098339 4:35378750-35378772 TTACACTGAAGTTATAGACATGG - Intergenic
972251125 4:37303517-37303539 TTACATTGAATCTGTAGATTAGG + Intronic
973118154 4:46486815-46486837 TCAGGCTGAATTTATTGATTTGG + Intergenic
974262659 4:59544513-59544535 TCAGTCTGAATTTATTGATTTGG - Intergenic
974289308 4:59910539-59910561 TCAGACTGAATTTATTGATTTGG + Intergenic
974644900 4:64677003-64677025 TCAGCCTGAATTTATTGATTTGG - Intergenic
974726794 4:65809237-65809259 TCATGCTGAATTTATTGATTTGG + Intergenic
975398607 4:73907075-73907097 TGACAGTGACTTTATAAATTTGG - Intergenic
975558285 4:75685849-75685871 TTACTGTCACTTTATAGATTTGG - Intronic
975733989 4:77364246-77364268 TCAGGCTGAATTTATTGATTTGG - Intronic
975774439 4:77769234-77769256 CTACCCTGAATTTAGATATTGGG - Intronic
975962527 4:79929966-79929988 TTATACTGAATTTATAGATGAGG + Intronic
975982912 4:80179500-80179522 TCAGGCTGAATTTATTGATTTGG - Intergenic
976138420 4:81963655-81963677 GGACATTGAATTCATAGATTTGG + Intronic
976418908 4:84814780-84814802 TAACATTTAATTTATAAATTAGG - Intronic
976727231 4:88226588-88226610 TTATTCTCATTTTATAGATTAGG + Intronic
976808692 4:89076591-89076613 TTATAAGGAAGTTATAGATTAGG + Intronic
977207586 4:94180681-94180703 TTACATTTAATTTATACATATGG + Intergenic
977626885 4:99197551-99197573 TCAGGCTGAATTTATTGATTTGG - Intergenic
977702030 4:100032116-100032138 TCAGGCTGAATTTATTGATTTGG - Intergenic
977799788 4:101213450-101213472 TTATACTGAAATTAAATATTGGG - Intronic
978244351 4:106554530-106554552 TTAGAATAAATCTATAGATTTGG - Intergenic
978341945 4:107728493-107728515 TCAGACTGAATGTATTGATTTGG - Intergenic
978829173 4:113062294-113062316 TGATACTTAAATTATAGATTAGG - Intronic
978966561 4:114748708-114748730 CTAGGCTGAATTTATTGATTTGG + Intergenic
978972408 4:114825391-114825413 TTACAATGAATTTACAGAAATGG - Intergenic
979017988 4:115459122-115459144 TCAGGCTGAATTTATTGATTTGG - Intergenic
979414806 4:120423630-120423652 TTATACTCATTTTAAAGATTAGG + Intergenic
979506334 4:121502095-121502117 TTACTCTGAAGTTATGGATTTGG + Intergenic
979575373 4:122285015-122285037 TTAAAGTAAATTTCTAGATTTGG + Intronic
979653234 4:123160846-123160868 TGACATTTAATTTATAAATTAGG + Intronic
979766740 4:124472571-124472593 TCAGGCTGAATTTATTGATTTGG + Intergenic
980628383 4:135405435-135405457 TCAGGCTGAATTTATTGATTTGG + Intergenic
980957482 4:139444145-139444167 TCAGGCTGAATTTATTGATTTGG + Intergenic
981126131 4:141108984-141109006 TTATTCTGACTTTATAGATGGGG - Intronic
981326611 4:143455678-143455700 CTACTCTGAATTTACAGATGTGG - Intronic
981462500 4:145029568-145029590 TCAGGCTGAATTTATTGATTTGG + Intronic
981834566 4:149040231-149040253 TTAGGCTGAATTTATTGCTTTGG + Intergenic
982020519 4:151199150-151199172 ATACAGTAAATTTCTAGATTTGG + Intronic
982502895 4:156180351-156180373 TTATATTGGATTTAAAGATTTGG - Intergenic
982990526 4:162268254-162268276 TTGCACTAAATCTGTAGATTGGG - Intergenic
983184770 4:164689377-164689399 TCAGGCTGAATTTATTGATTTGG + Intergenic
983498416 4:168471440-168471462 TTACACTGACTATATAGAAAAGG + Intronic
984396062 4:179201349-179201371 TAACGCTTAATTTATAAATTAGG + Intergenic
984894012 4:184519327-184519349 TTACATTGAATATATTAATTTGG + Intergenic
985076256 4:186218217-186218239 TAACACTGAAATCTTAGATTTGG - Intronic
985090495 4:186358032-186358054 TTAGATTAAAATTATAGATTGGG + Intergenic
986037328 5:3952670-3952692 TCAGGCTGAATTTATTGATTTGG - Intergenic
986625238 5:9717435-9717457 TTGCACTACATTTATAAATTAGG - Intergenic
987152885 5:15059449-15059471 TCAGGCTGAATTTATTGATTTGG + Intergenic
987458668 5:18178828-18178850 TTAAAGTGAATTTATTGCTTTGG + Intergenic
987504119 5:18747630-18747652 TCAGGCTGAATTTATTGATTTGG + Intergenic
987524367 5:19029246-19029268 ATACACAGATTCTATAGATTAGG + Intergenic
987541088 5:19257073-19257095 TTAGACTGAATTGTTAGAATTGG + Intergenic
987588985 5:19898104-19898126 TTGCAATGCATTTATAGACTTGG + Intronic
987621541 5:20342677-20342699 TCAGACTGCATTTATTGATTTGG + Intronic
988107481 5:26770291-26770313 TCAGGCTGAATTTATTGATTTGG + Intergenic
988161099 5:27519106-27519128 TCAGGCTGAATTTATTGATTTGG - Intergenic
988169467 5:27635047-27635069 TCAGGCTGAATTTATTGATTTGG - Intergenic
988188491 5:27899020-27899042 TCAGGCTGAATTTATTGATTTGG + Intergenic
988228503 5:28445919-28445941 TCAGGCTGAATTTATTGATTTGG + Intergenic
988233560 5:28509309-28509331 TCAGGCTGAATTTATTGATTTGG - Intergenic
988267775 5:28973583-28973605 TCAGACTGAATTTATTGATTTGG - Intergenic
988512362 5:31876020-31876042 TTTCACTGAAGTTATTAATTGGG + Intronic
988989793 5:36659251-36659273 TCACTCTGCATTTATGGATTAGG - Intronic
989018423 5:36969229-36969251 TTATACTGAATTTATAGATACGG - Intronic
989020701 5:37003537-37003559 TAAAACTTAATTTATAAATTAGG - Intronic
989045601 5:37270463-37270485 TCAGGCTGAATTTATTGATTTGG - Intergenic
989749148 5:44870368-44870390 TTTCACTGATTTTAGACATTGGG - Intergenic
989755957 5:44954457-44954479 TTACACTGAAAATATACATAAGG - Intergenic
990423539 5:55661505-55661527 TTGCACTGGATTTATTGATGTGG - Intronic
990458044 5:56006857-56006879 TTACACTGATTTTCTGCATTTGG - Intergenic
991945851 5:71897909-71897931 TGAAGCTGAATTTATTGATTTGG + Intergenic
992242588 5:74787219-74787241 TCAGGCTGAATTTATTGATTCGG + Intronic
993319554 5:86456365-86456387 TCAGGCTGAATTTATTGATTTGG + Intergenic
993412867 5:87594045-87594067 TCAGGCTGAATTTATTGATTTGG - Intergenic
993791498 5:92216689-92216711 TCAGGCTGAATTTATTGATTTGG + Intergenic
993854613 5:93057843-93057865 ATACACTGATTTAAAAGATTGGG + Intergenic
994836844 5:104865924-104865946 TCAGGCTGAATTTATTGATTTGG + Intergenic
994865383 5:105262186-105262208 TTACTCTTAATTGATAAATTTGG - Intergenic
994905268 5:105832950-105832972 TTACCCTGAATTTGAACATTTGG - Intergenic
995269837 5:110207695-110207717 TCAGGCTGAATTTATTGATTTGG - Intergenic
995279355 5:110316127-110316149 TTAGGCTGAATTTATTGATTTGG - Intronic
995306181 5:110653562-110653584 TCACCCAGAATTTAGAGATTAGG + Intronic
995428027 5:112046004-112046026 TCAGCCTGAATTTATTGATTTGG - Intergenic
995570389 5:113474026-113474048 TCACACTGATCTTTTAGATTAGG + Intronic
995776597 5:115729911-115729933 TCAGACTGAATTTATTGATTTGG - Intergenic
995954454 5:117759110-117759132 TTACACTCATTTCATAAATTAGG + Intergenic
996002468 5:118381088-118381110 TTTCACTGTATTCATAGTTTTGG + Intergenic
996266281 5:121544351-121544373 TCAGTCTGAATTTATTGATTTGG + Intergenic
996267995 5:121565762-121565784 CTATATTGCATTTATAGATTTGG - Intergenic
996825269 5:127675589-127675611 TCAGGCTGAATTTATTGATTTGG + Intergenic
998201924 5:140131763-140131785 TTACCCTCAATTTATAGATGAGG + Intergenic
998290621 5:140910810-140910832 TCAGGCTGAATTTATTGATTTGG - Intronic
998302447 5:141037294-141037316 TTACAATCAATTTACAGATATGG + Intergenic
998525127 5:142835922-142835944 TTACACCCATTTTATATATTAGG + Intronic
999263680 5:150253066-150253088 TTATCCTGATTTTATAGATGAGG - Intronic
999351097 5:150872623-150872645 TCAGGCTGAATTTATTGATTAGG + Intronic
999457240 5:151727440-151727462 TCACACTGTATTTATACATCAGG - Intergenic
999579420 5:153019297-153019319 TTACATGGAATCTGTAGATTAGG - Intergenic
999615146 5:153415247-153415269 TTAAACTCAAGTTTTAGATTTGG - Intergenic
999909156 5:156178006-156178028 TCACACTTAAGATATAGATTAGG - Intronic
999913110 5:156227666-156227688 TTGCATTGAATTTGTAGATTGGG + Intronic
999975197 5:156905365-156905387 TTACACAAAATTTCTAGAATAGG - Intergenic
1000133516 5:158322248-158322270 TTGCCCTGAATTTACAGATGAGG + Intergenic
1000455584 5:161444593-161444615 TTGCACTTAATTTATAATTTGGG + Intronic
1000472511 5:161662681-161662703 TTAAACTGGGGTTATAGATTTGG - Intronic
1001370649 5:171197381-171197403 TTATACTTATTTTATAGATGAGG + Intronic
1001802082 5:174553199-174553221 TTTCACTTAATTTATAACTTGGG - Intergenic
1003696193 6:8408329-8408351 TCAGGCTGAATTTATTGATTTGG - Intergenic
1005118101 6:22360647-22360669 TTACACTCATTTTATAAATGAGG - Intergenic
1005368389 6:25103170-25103192 TTGTACTGAATCTATAAATTTGG + Intergenic
1005503154 6:26447719-26447741 TTACCCTCATTTTATAGATTAGG + Intronic
1005690057 6:28296113-28296135 ATACACTGAATTTATTTATTTGG - Intronic
1006001208 6:30966544-30966566 TCAGGCTGAATTTATTGATTTGG + Intergenic
1006062055 6:31430929-31430951 TAAGGCTGAATTTATTGATTTGG + Intergenic
1006554903 6:34857732-34857754 TTTAACTGAATGTAGAGATTAGG - Exonic
1006560457 6:34907048-34907070 TTAGACTGAGGTTATGGATTTGG - Intronic
1006628673 6:35415554-35415576 TTACACTGAATCCAAACATTTGG + Intronic
1006875058 6:37288380-37288402 TTACTCTGAATTTGGAGATGAGG + Intronic
1007824965 6:44593571-44593593 TTACCTTGATTTTATAGATAAGG + Intergenic
1008171412 6:48212337-48212359 TTACATAGATTTTATAGCTTTGG - Intergenic
1008399995 6:51053255-51053277 TCAGGCTGAATTTATTGATTTGG + Intergenic
1009308358 6:62120068-62120090 TCAGGCTGAATTTATTGATTTGG + Intronic
1009554574 6:65147085-65147107 TTAAACTGCATTTATATTTTTGG + Intronic
1009559126 6:65216016-65216038 TTACATTGAAATTACAGGTTTGG - Intronic
1009829929 6:68917105-68917127 TACCACTGATTTTACAGATTTGG + Intronic
1009949893 6:70383305-70383327 TTACACTTAAGTTATTAATTGGG - Intergenic
1010323289 6:74538255-74538277 TCAGGCTGAATTTATTGATTTGG + Intergenic
1010552145 6:77236486-77236508 TCAGGCTGAATTTATTGATTTGG + Intergenic
1010818304 6:80385875-80385897 TCAGGCTGAATTTATTGATTGGG + Intergenic
1010908805 6:81526940-81526962 TTAAATTGATTTTCTAGATTTGG + Intronic
1011039647 6:83015487-83015509 TCAGCCTGAATTTATTGATTTGG - Intronic
1011068803 6:83359466-83359488 TCAGGCTGAATTTATTGATTTGG + Intronic
1011207908 6:84921077-84921099 TTTCATTTAATTTATATATTAGG + Intergenic
1011455755 6:87546848-87546870 TTGCAGGGACTTTATAGATTGGG - Intronic
1011933393 6:92741964-92741986 TTAAACTAAATTAATAGATTTGG + Intergenic
1012344290 6:98168091-98168113 TGAGGCTGAATTTATTGATTTGG + Intergenic
1012749880 6:103145220-103145242 TTACACTCAATTTATGAAATAGG - Intergenic
1012820519 6:104080695-104080717 TGAGGCTGAATTTATTGATTTGG + Intergenic
1013044090 6:106466834-106466856 TTTGTCTGAATTTAAAGATTGGG - Intergenic
1013422076 6:109976535-109976557 TTACACACAATTTATCCATTTGG - Intergenic
1014362437 6:120496850-120496872 TTTCACTGAGTTTATGGCTTTGG - Intergenic
1014521015 6:122441959-122441981 TTACATTGAATCTATAGATCAGG - Intergenic
1014534494 6:122598866-122598888 TCAGGCTGAATTTATTGATTTGG - Intronic
1014969967 6:127801982-127802004 TCACCCTGAATTTGTTGATTTGG + Intronic
1015081900 6:129237081-129237103 TTACATTGATTTTAAAGATGAGG - Intronic
1015211031 6:130698717-130698739 TACCTTTGAATTTATAGATTTGG + Intergenic
1015467219 6:133560464-133560486 TCAGGCTGAATTTATTGATTTGG - Intergenic
1015475444 6:133655088-133655110 TTAGGCTGAATTTATTGATTTGG + Intergenic
1015673412 6:135717962-135717984 TTCCGCTGATTTTACAGATTTGG + Intergenic
1016070691 6:139735266-139735288 TTACACTGAAATTGTTGAATTGG - Intergenic
1016098532 6:140068268-140068290 TTAGACTGAAGTAGTAGATTGGG + Intergenic
1016143998 6:140647175-140647197 TTAGGCTGAATATATTGATTTGG + Intergenic
1016147583 6:140694948-140694970 TCAGGCTGAATTTATTGATTTGG - Intergenic
1016158072 6:140838871-140838893 ATCCACTCAATTTTTAGATTTGG + Intergenic
1016384908 6:143521422-143521444 TTACACTCATTTTATAGATGAGG + Intergenic
1016420273 6:143875519-143875541 TCGGGCTGAATTTATAGATTTGG - Intronic
1016576541 6:145574825-145574847 TCAGACTAAATTTATTGATTTGG - Intronic
1016613499 6:146021110-146021132 TTACACTCAATTTATGAATTTGG + Intergenic
1016765876 6:147793236-147793258 TTAAACTGAGATTATGGATTTGG - Intergenic
1016769777 6:147836079-147836101 TTACAGTGAATGGATATATTAGG - Intergenic
1016811960 6:148270015-148270037 ATACACTGATGTTATAGATTTGG + Intergenic
1017977410 6:159370295-159370317 TCAGGCTGAATTTATTGATTTGG - Intergenic
1018281899 6:162195514-162195536 TTAAAATTAGTTTATAGATTAGG - Intronic
1018569674 6:165195850-165195872 TCAGGCTGAATTTATTGATTTGG + Intergenic
1019880678 7:3858013-3858035 ATTTACCGAATTTATAGATTTGG - Intronic
1020396420 7:7723304-7723326 TCAAGCTGAATTTATTGATTTGG + Intronic
1020459340 7:8411200-8411222 TTAAACTGAGGTTATAAATTTGG - Intergenic
1020567654 7:9817970-9817992 TCAGGCTGAATTTATTGATTTGG - Intergenic
1020710038 7:11595384-11595406 TCAGGCTGAATTTATTGATTTGG + Intronic
1020964815 7:14852023-14852045 TTTTACTGTGTTTATAGATTTGG - Intronic
1021045519 7:15918388-15918410 TTGCACTTTATTAATAGATTAGG - Intergenic
1021117284 7:16758508-16758530 TTTTGCTGAATTTATAGACTTGG + Intronic
1021766459 7:23954632-23954654 TTCCATTGAATCTATAGACTGGG - Intergenic
1022078599 7:26998096-26998118 TCAGGCTGAATTTATTGATTTGG + Intergenic
1022250553 7:28603230-28603252 GTATACTGAATTTATAAATTTGG - Intronic
1022856485 7:34320101-34320123 TTATTCTCATTTTATAGATTAGG + Intergenic
1023171917 7:37398349-37398371 TTTCCATGAATATATAGATTGGG - Intronic
1023318880 7:38972030-38972052 TTATCCTGATTTTATAGATGAGG - Intergenic
1023556945 7:41433244-41433266 TTAAAATGAATTTCTGGATTTGG + Intergenic
1023599874 7:41871616-41871638 TTGCATTAAGTTTATAGATTTGG - Intergenic
1024040170 7:45546925-45546947 TCAGGCTGAATTTATTGATTTGG - Intergenic
1024958547 7:54951309-54951331 TCAGGCTGAATTTATTGATTTGG - Intergenic
1027407098 7:77873287-77873309 TCAAGCTGAATTTATGGATTTGG - Intronic
1027535485 7:79394570-79394592 GTACAATGAAATTATAAATTAGG + Intronic
1027541159 7:79467604-79467626 TTCTATTGAATTTATATATTTGG - Intergenic
1027648182 7:80831294-80831316 TTATACTGATTTTAAAGATAAGG - Intronic
1027892640 7:83995874-83995896 TTAGAATGAGTTTATAGACTAGG + Intronic
1027905709 7:84178643-84178665 TTATATTTAATTTATATATTTGG - Intronic
1028014691 7:85692509-85692531 TTATACTGATTTTATATATGAGG - Intergenic
1028043576 7:86089231-86089253 TCAGGCTGAATTTATTGATTTGG + Intergenic
1028664950 7:93331187-93331209 TTGTACTGAACCTATAGATTTGG - Intronic
1029048759 7:97660779-97660801 TTAGACTGAATTTATTGATGTGG - Intergenic
1029872796 7:103713083-103713105 TCTCACAGAATTTATAGATGGGG + Intronic
1029960957 7:104688914-104688936 TCAGACTGAATTTATTGATATGG + Intronic
1029975004 7:104825479-104825501 TTACACCAATTTTATAGATCAGG - Intronic
1030256506 7:107514957-107514979 TTATGCTGAGTTTATAGATAAGG + Intronic
1030277164 7:107733877-107733899 TCAGGCTGAATTTATTGATTGGG + Intergenic
1030346678 7:108441703-108441725 TTATACTCATTTTATAGATGAGG - Intronic
1030368264 7:108670722-108670744 TCAGGCTGAATTTATTGATTTGG + Intergenic
1031236564 7:119185773-119185795 TCAGGCTGAATTTATTGATTTGG + Intergenic
1031376301 7:121030709-121030731 TAAAGCTGAATTTATAAATTAGG - Intronic
1031474730 7:122207570-122207592 TCAGGCTGAATTTATAGATTTGG - Intergenic
1031566945 7:123311141-123311163 TAAAACTTAATTTATAAATTAGG + Intergenic
1031676273 7:124616112-124616134 TCAGGCTGAATTTATTGATTTGG + Intergenic
1031779408 7:125942475-125942497 TCAGGCTGAATTTATGGATTTGG - Intergenic
1031799094 7:126220186-126220208 TTGCATTGAATTTATACAATTGG + Intergenic
1031841630 7:126748553-126748575 TTGCATTGAATCTATAGATTTGG - Intronic
1031874220 7:127119928-127119950 TTAGACTGCATTTATAGGTTTGG - Intronic
1033075922 7:138250472-138250494 TCAGACTGAATTTATTGATTTGG + Intergenic
1033357573 7:140612805-140612827 TTACACTAAATTTAAAAATAAGG + Intronic
1033566626 7:142585046-142585068 TTAGACAGGAATTATAGATTTGG - Intergenic
1033830377 7:145244524-145244546 TTGTATTGAATCTATAGATTTGG - Intergenic
1034169705 7:149053470-149053492 TCAGGCTGAATTTATTGATTTGG + Intergenic
1035509635 8:167234-167256 TTACACTGAAAGTATTGATGAGG - Intergenic
1038247315 8:25870769-25870791 TTACACTGAATAAGTAGATAAGG + Intronic
1038817138 8:30915653-30915675 GTAAACTGAAGTTGTAGATTTGG - Intergenic
1039156297 8:34562312-34562334 GTCCACAGAATTTATACATTTGG - Intergenic
1039356607 8:36824437-36824459 TAACATTTAATTTATAAATTAGG - Intronic
1040454475 8:47582285-47582307 TTACACTGAATATGTAGATAGGG - Intronic
1042209166 8:66361310-66361332 TTAGACTGAGCTTATAGATTTGG + Intergenic
1042252528 8:66771215-66771237 TCACACTTCATTTATAGAGTGGG - Intronic
1042727909 8:71898552-71898574 TTATGCTGAATTTTTAGATTCGG - Intronic
1043733649 8:83717547-83717569 TGATGCTGAATTTATTGATTTGG + Intergenic
1044446952 8:92289445-92289467 TTATTCTGAATTCACAGATTTGG + Intergenic
1045221478 8:100204443-100204465 TCAGGCTGAATTTATTGATTTGG + Intronic
1045852897 8:106724439-106724461 TGACACTGTATTTATAAATTTGG + Intronic
1045896875 8:107229712-107229734 TTAAACTTGATTTATAAATTAGG - Intergenic
1046368218 8:113265642-113265664 TTACAATGAATATTCAGATTCGG - Intronic
1046417935 8:113940057-113940079 TCAGGCTGAATTTATTGATTTGG - Intergenic
1046461846 8:114548774-114548796 TTGGACTGGATTTATGGATTTGG - Intergenic
1046548280 8:115679675-115679697 TTTAACTGAATTTATAAATTTGG - Intronic
1047014491 8:120709256-120709278 TTTCCCTGATTTTATAGAATAGG - Intronic
1047057093 8:121177324-121177346 TAAAACTTAATTTATAAATTAGG + Intergenic
1048036221 8:130679790-130679812 TTTCACTGAACTCATAGAGTAGG + Intergenic
1048188931 8:132270848-132270870 TTATACTGAATTTGTGTATTTGG + Intronic
1048436231 8:134420750-134420772 TTAGACTGAACTAATAGATATGG - Intergenic
1048480444 8:134785867-134785889 CTTCAGTGAATTTATAGATTTGG + Intergenic
1048654637 8:136522456-136522478 TCAGGCTGAATTTATTGATTTGG - Intergenic
1050396949 9:5208514-5208536 TTACACTGTATTTTGAAATTTGG - Intergenic
1050447341 9:5739364-5739386 TCAGGCTGAATTTATTGATTTGG - Intronic
1050590136 9:7151945-7151967 ATACACAGAATGTATAGTTTAGG + Intergenic
1050746763 9:8885246-8885268 TTACCCTCATTTTATAGATGAGG + Intronic
1050840757 9:10146122-10146144 TTTCACTTAATTTTTAGCTTTGG - Intronic
1050920409 9:11194635-11194657 TTATTATGAATTTATAGATGTGG - Intergenic
1051881843 9:21848409-21848431 TCAGGCTGAATTTATTGATTTGG + Intronic
1051966124 9:22832005-22832027 TTAGGCTGAATTTATTGATTTGG + Intergenic
1052227320 9:26106143-26106165 TCAGGCTGAATTTATTGATTTGG + Intronic
1053088776 9:35253091-35253113 TTACTATGTATTTATAAATTTGG + Intronic
1054737650 9:68771578-68771600 TTACCCTTATTTTATAGATAAGG - Intronic
1054901685 9:70375644-70375666 TTACACTGAGTTTAAATAATTGG - Intergenic
1055131974 9:72786129-72786151 TTATACTGAATTTCTTGACTTGG - Intronic
1058259529 9:102811904-102811926 TCAGGCTGAATTTATTGATTTGG - Intergenic
1059012767 9:110480464-110480486 TTACACTAAATGAATACATTAGG + Intronic
1059122168 9:111650878-111650900 TTTCACTGAAATTAAAGTTTTGG + Intronic
1059568886 9:115412982-115413004 TTAAACTAAGTTTATAGATTTGG + Intergenic
1059723964 9:116987699-116987721 TAACATTTAATTTATAAATTAGG + Intronic
1060558527 9:124523104-124523126 TTACCCTCATTTTATAGATAAGG + Intronic
1060695393 9:125705315-125705337 TTAACCTCAATTTACAGATTAGG - Intronic
1185914008 X:4014883-4014905 TCACACTGAATCTACAGATGAGG - Intergenic
1186245639 X:7613678-7613700 TTACTCTAAAATTTTAGATTTGG + Intergenic
1186279346 X:7975921-7975943 TCAGGCTGAATTTATTGATTTGG + Intergenic
1186470079 X:9814317-9814339 TCAGGCTGAATTTATTGATTTGG - Intronic
1186797447 X:13060734-13060756 TCTCTCTGAATTTATAGATTTGG + Intergenic
1186799685 X:13080205-13080227 TTACAATGAATTTACTAATTTGG + Intergenic
1187485260 X:19697255-19697277 TTACATTGTATTTATTAATTTGG - Intronic
1187604590 X:20869829-20869851 TCAGACTGAATTTGTTGATTTGG + Intergenic
1188114805 X:26230019-26230041 TTACACTGAATTTATAAAAATGG + Intergenic
1188174199 X:26967760-26967782 TAAAGCTTAATTTATAGATTAGG + Intergenic
1188266685 X:28085653-28085675 CTACACAGAATTTGTAGGTTGGG + Intergenic
1188684251 X:33049866-33049888 TTATATTGAATTTACATATTTGG - Intronic
1188781122 X:34286728-34286750 TTACCCTGAATTTGGAAATTTGG - Intergenic
1189055175 X:37692053-37692075 TTTCATTGAATTGATATATTAGG + Intronic
1189338890 X:40189106-40189128 TTAGCCTGCATTTATAGATGAGG + Intergenic
1190387216 X:49894071-49894093 TTATACAGAATTTATTTATTTGG - Intergenic
1191742817 X:64453534-64453556 TCACGCTGAATTTATTGATTTGG - Intergenic
1191941524 X:66486091-66486113 TCAGGCTGAATTTATTGATTTGG - Intergenic
1192298006 X:69870223-69870245 TCAGGCTGAATTTATTGATTTGG - Intronic
1192903793 X:75527603-75527625 TTGCATTGAATCTATGGATTGGG + Intergenic
1193053141 X:77122945-77122967 TCAGGCTGAATTTATTGATTTGG + Intergenic
1193297509 X:79850461-79850483 TCAGACTGAATTTGTTGATTTGG + Intergenic
1193433174 X:81437652-81437674 TCAGGCTGAATTTATTGATTTGG - Intergenic
1193637915 X:83975827-83975849 TTACAGCTAATTTATAAATTGGG - Intergenic
1193646300 X:84072962-84072984 TTGCATTGAATCTGTAGATTGGG - Intronic
1193760310 X:85457607-85457629 TTACCCTGATTTTACAGATCTGG - Intergenic
1193764987 X:85516811-85516833 TTACACATTATTTATAAATTAGG - Intergenic
1193877002 X:86873067-86873089 TCAGGCTGAATTTATTGATTTGG + Intergenic
1193916062 X:87365280-87365302 TTACAGTGAGTTTTGAGATTGGG - Intergenic
1194209992 X:91060120-91060142 TCAGGCTGAATTTATTGATTTGG + Intergenic
1194282070 X:91965546-91965568 TTAAACTTAATTTATAGAGGAGG + Intronic
1194335204 X:92638428-92638450 TTACAGGGATTTTATAGTTTTGG - Intergenic
1194343032 X:92728875-92728897 TCAGGCTGAATTTATTGATTTGG + Intergenic
1194443281 X:93958863-93958885 TCAGGCTGAATTTATTGATTTGG + Intergenic
1194604680 X:95964219-95964241 TCAGGCTGAATTTATTGATTTGG - Intergenic
1194673518 X:96765569-96765591 TAACACTTAATTTATAAATTAGG - Intronic
1194833648 X:98656562-98656584 TCAGATTGAATTTATTGATTTGG + Intergenic
1194930795 X:99885066-99885088 TACCATTGAATCTATAGATTAGG - Intergenic
1195418353 X:104644707-104644729 TTAGACTGAATTTACTGGTTTGG - Intronic
1195749138 X:108146911-108146933 TCAGGCTGAATTTATTGATTTGG - Intronic
1195760459 X:108240283-108240305 TGGCATTGAATTTGTAGATTTGG + Intronic
1196178269 X:112663923-112663945 TTACTCTGATTTTACAGATGAGG - Intronic
1196318390 X:114257328-114257350 TTATACTGAATGAATAAATTAGG - Intergenic
1196372616 X:114996336-114996358 TCAGGCTGAATTTATTGATTTGG - Intergenic
1196402196 X:115328580-115328602 TTACACTGTATTTATTGGTTCGG + Intergenic
1196460591 X:115925142-115925164 TTGCATTGAATCTGTAGATTAGG - Intergenic
1197044174 X:121976209-121976231 TTAGGCTGAATTTAATGATTTGG + Intergenic
1197245395 X:124161550-124161572 TCAGGCTGAATTTATTGATTTGG - Intronic
1197390292 X:125855160-125855182 TTGCATTGAATCTGTAGATTTGG + Intergenic
1197409501 X:126098066-126098088 TCAGGCTGAATTTATTGATTTGG - Intergenic
1197426023 X:126297846-126297868 TCAGGCTGAATTTATTGATTTGG - Intergenic
1198201247 X:134420985-134421007 TTGTACTAAATTTATACATTTGG - Intronic
1198588816 X:138153321-138153343 TTACACTGATTTTATACTTCTGG + Intergenic
1198933679 X:141885301-141885323 TCAGACTGAATTTATTGATTTGG + Intronic
1199024102 X:142917480-142917502 TCAAGCTGAATTTATTGATTTGG + Intergenic
1200365538 X:155658254-155658276 TTACATTGATTCTGTAGATTGGG + Intronic
1200599665 Y:5190207-5190229 TTAAACTTAATTTATAGAGGAGG + Intronic
1200651392 Y:5845541-5845563 TCAGGCTGAATTTATTGATTTGG + Intergenic
1200770585 Y:7121244-7121266 AAACCCTGAATTTATAGAATGGG + Intergenic
1201185838 Y:11401884-11401906 TTACACTGAATTTTAAAATAAGG - Intergenic
1201464156 Y:14261528-14261550 TTACCCTAAAATTTTAGATTTGG + Intergenic
1201585188 Y:15552507-15552529 TCCCACTGAGTTTATAGTTTTGG + Intergenic
1202100160 Y:21299199-21299221 TCACGCTGAATTTATTGATTTGG + Intergenic