ID: 1105567129

View in Genome Browser
Species Human (GRCh38)
Location 13:21560700-21560722
Sequence TACACTGAATTTATAGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105567125_1105567129 -2 Left 1105567125 13:21560679-21560701 CCCCATTGGGATTATTGCAATTA 0: 1
1: 0
2: 1
3: 22
4: 180
Right 1105567129 13:21560700-21560722 TACACTGAATTTATAGATTAGGG 0: 1
1: 1
2: 3
3: 44
4: 316
1105567126_1105567129 -3 Left 1105567126 13:21560680-21560702 CCCATTGGGATTATTGCAATTAC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1105567129 13:21560700-21560722 TACACTGAATTTATAGATTAGGG 0: 1
1: 1
2: 3
3: 44
4: 316
1105567127_1105567129 -4 Left 1105567127 13:21560681-21560703 CCATTGGGATTATTGCAATTACA 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1105567129 13:21560700-21560722 TACACTGAATTTATAGATTAGGG 0: 1
1: 1
2: 3
3: 44
4: 316
1105567124_1105567129 2 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567129 13:21560700-21560722 TACACTGAATTTATAGATTAGGG 0: 1
1: 1
2: 3
3: 44
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105567129 Original CRISPR TACACTGAATTTATAGATTA GGG Intronic
900039962 1:451887-451909 TACACTGAAAGTATTGATGATGG - Intergenic
900061394 1:686863-686885 TACACTGAAAGTATTGATGATGG - Intergenic
901819667 1:11819788-11819810 TACATTAAATTTACAGATTAGGG - Intronic
902152722 1:14457663-14457685 TTCAATGAATTTATAGATTAAGG + Intergenic
903315702 1:22503752-22503774 TACACTTAATTTGAAGACTAAGG - Intronic
904628115 1:31819930-31819952 TTCATCGAATTTACAGATTAGGG + Intergenic
904794591 1:33049783-33049805 AACATTTAATTTATAAATTAGGG + Intronic
905613512 1:39376511-39376533 TAAACTGTGTTTGTAGATTAAGG + Intronic
906812423 1:48841992-48842014 TAAACTGAATTTAAAAAGTAAGG - Intronic
906879401 1:49574265-49574287 TAGGCTGAATTTATTGATTTGGG + Intronic
906994317 1:50774400-50774422 GAATCTGAATTTATAGATTCAGG + Intronic
908038487 1:60081912-60081934 TATACTTGGTTTATAGATTAAGG - Intergenic
908304959 1:62803704-62803726 TATACTGACTTTAAAAATTAAGG - Exonic
908471081 1:64444538-64444560 TACCCTTATTTTATAGATGAAGG + Intergenic
908706755 1:66965699-66965721 TACAATTAAGTTATTGATTATGG + Intronic
909378218 1:74965187-74965209 TAAACTGAATTAACAGATTTTGG + Intergenic
910128720 1:83876512-83876534 TACATTGAATTTACAGATGTAGG + Intronic
915292295 1:154894134-154894156 TGCACTGAATCTATAAATTTGGG - Intergenic
915454941 1:156034132-156034154 TACATTGAAGTTATGGACTACGG - Intergenic
915800353 1:158784891-158784913 TATACTGATTTTATTTATTATGG - Intergenic
917990661 1:180375030-180375052 TGCATTGAATTTATAAGTTAGGG - Intronic
918337074 1:183527067-183527089 TACATTTAATTTAGAAATTATGG - Intronic
918957974 1:191235823-191235845 CACGCTGAATTTATTGATTTGGG + Intergenic
921596695 1:217062032-217062054 TTGAGTGAATTTATAGATTGAGG + Intronic
921749308 1:218774555-218774577 TAAACTGGATTTGAAGATTATGG + Intergenic
922640847 1:227230398-227230420 TTCATAGAATTTATAGATTAGGG + Intronic
923059235 1:230455358-230455380 TGTACTCTATTTATAGATTAAGG - Intergenic
923901650 1:238332687-238332709 TATACTGATTTTACAGTTTAAGG - Intergenic
924211434 1:241771792-241771814 TATAATGAATTTATATATTAAGG - Intronic
924547160 1:245040247-245040269 TTTACTGAATTAATAGACTATGG - Intronic
1062853445 10:764420-764442 TACATGGAATCTGTAGATTAGGG - Intergenic
1064590351 10:16883860-16883882 AACACTGAGTTTACAGTTTACGG + Intronic
1066335762 10:34476583-34476605 GCCTCTGAATTTATAAATTAGGG - Intronic
1067754696 10:48996261-48996283 CAGACTGAATTTATTGATTTGGG - Intergenic
1068851272 10:61744199-61744221 TACACAGGATTTATAGAAGAGGG + Intronic
1069117359 10:64524506-64524528 GAGACTGAAATTATATATTATGG - Intergenic
1070008171 10:72445787-72445809 TATACTGATTTTATAGATGAGGG - Intronic
1071019915 10:81041048-81041070 TTCACTGAATTTATAGGCTCAGG - Intergenic
1071115312 10:82211868-82211890 TACACTGCATTTCTAGTATAGGG - Intronic
1071519473 10:86320098-86320120 AAAACTCAATTTATAGATTACGG + Intronic
1071934353 10:90510802-90510824 TGCATTGAATTTATAGATTTGGG - Intergenic
1072272648 10:93791852-93791874 TAAACTGAATTTGTAGACCACGG + Intronic
1072505914 10:96067033-96067055 TATGTTAAATTTATAGATTAAGG - Intergenic
1073450944 10:103608481-103608503 TTCATCGAATTTACAGATTAGGG + Intronic
1073913039 10:108368998-108369020 TACACTGTATTTTTTAATTAAGG + Intergenic
1074653293 10:115550756-115550778 TACAGTAAAATTATAGATTCAGG + Intronic
1074718467 10:116243212-116243234 TAAAATGAATTTATAGTTTGGGG - Intronic
1074749251 10:116568135-116568157 GACACAGAACTTAAAGATTATGG - Intergenic
1075242106 10:120788396-120788418 TACACTGAATTAATAGTTACTGG + Intergenic
1075606584 10:123815906-123815928 CAGACTGAATTTATTGATTTGGG + Intronic
1076966186 11:87795-87817 TACACTGAAAGTATTGATGATGG - Intergenic
1078324028 11:10364373-10364395 TAAACTCAAATTATAGAATACGG + Intronic
1079779198 11:24577765-24577787 TACACCTACTTTATAGATAATGG + Intronic
1080041560 11:27764555-27764577 TGCAGTGAATTTATAGTTTGTGG - Intergenic
1080320158 11:30999000-30999022 TAGACTGAAATTATTGATTTTGG - Intronic
1080843523 11:36006239-36006261 TACAATTAATTCACAGATTAGGG + Intronic
1081111034 11:39133621-39133643 TACACTGATTTTGTAGCCTAAGG + Intergenic
1081148286 11:39593584-39593606 TATACTGATTTTATAGACAAGGG + Intergenic
1081370504 11:42295292-42295314 TACACTGAATGTACAGATCAAGG + Intergenic
1082056179 11:47818942-47818964 TACAATGACATTAAAGATTATGG - Intronic
1082926868 11:58557901-58557923 TACATTGAATTTACAGTTTAGGG - Intronic
1082999332 11:59277329-59277351 TAGGCTGAATTTATTGATTTGGG + Intergenic
1085246692 11:75107690-75107712 AACACTTATTTTATAGGTTAGGG + Intronic
1085246968 11:75109520-75109542 TACACTTATTTTACAGAGTAGGG - Intronic
1085658125 11:78335799-78335821 TGCATTGAATCTATAGATTTGGG + Intronic
1085925379 11:81013261-81013283 TACACAGATTTTTTAAATTAAGG - Intergenic
1086191683 11:84086878-84086900 TACACGAAATTTCTAGAATAGGG - Intronic
1086802153 11:91190091-91190113 TTCCATGAATTTATTGATTATGG + Intergenic
1087156749 11:94911998-94912020 TACACTAAATTTATAGAAAAAGG + Intergenic
1087443386 11:98214816-98214838 CACACTGTATTAATACATTATGG - Intergenic
1087491386 11:98831638-98831660 TACCCTAAATTTATATAGTAGGG - Intergenic
1088616823 11:111638776-111638798 GACCTAGAATTTATAGATTATGG - Intronic
1090231357 11:125107999-125108021 TGCATTGAATTTATAGGTTAAGG - Intronic
1090298884 11:125616503-125616525 TACACTGAATTTATTTTTCAAGG + Intronic
1092766149 12:11854796-11854818 AACACTGAGTTCATAGATTTGGG - Intronic
1093054389 12:14540723-14540745 TTCTCAGAATTTATAGAGTATGG - Intronic
1093298548 12:17422951-17422973 TGCATTGAATTTATAGATCAAGG + Intergenic
1093975462 12:25416196-25416218 TAGACTGAATTAACAAATTATGG - Intronic
1094557233 12:31513157-31513179 TATACTGAGTTTATAGGTTTGGG + Intronic
1095286706 12:40420683-40420705 TATACTGACTATCTAGATTATGG + Intronic
1095636575 12:44441088-44441110 AACACTGAAATTATATATTAAGG - Intergenic
1095848846 12:46778283-46778305 TACAGTGAACTTAAAGAGTAAGG - Exonic
1097912281 12:64983402-64983424 TACACTATATTTATAACTTAAGG - Intergenic
1098805163 12:75013856-75013878 CAGACTGAATTTATTGATTTGGG + Intergenic
1099275548 12:80571147-80571169 AGCACTGAATCTATAAATTATGG + Intronic
1099692341 12:85973414-85973436 TACATTGAAATTATAGACTAAGG + Exonic
1099794529 12:87382388-87382410 TAAACTGCCTTTATAGATAAAGG - Intergenic
1099974386 12:89531216-89531238 TACACTCTATTTGTACATTATGG + Intergenic
1100650455 12:96582885-96582907 TAAACTTAAGTTATAAATTAAGG - Intronic
1101872344 12:108576438-108576460 TACACAACATTTATTGATTAAGG + Intergenic
1103374508 12:120445415-120445437 TACACTTGATTTATTCATTATGG - Intronic
1104188488 12:126455496-126455518 TACACTGAATATACAATTTATGG + Intergenic
1105333823 13:19444628-19444650 TGCATTGAATTTATAGACTGGGG - Intronic
1105567129 13:21560700-21560722 TACACTGAATTTATAGATTAGGG + Intronic
1105861115 13:24414765-24414787 TGCATTGAATTTATAGACTGGGG + Intergenic
1105922466 13:24977157-24977179 TGCATTGAATTTATAGACTGGGG - Intergenic
1106514583 13:30442320-30442342 TTCACTGAATTTATAAGTTTTGG - Intergenic
1106701600 13:32234938-32234960 TCCACTGAATTTCTAGAACAAGG - Intronic
1106811845 13:33365717-33365739 TGCAATGAATTTATAGTTCATGG - Intergenic
1106975802 13:35212382-35212404 TAAAATGAATTAATAAATTATGG - Intronic
1107487964 13:40849133-40849155 TGCGTTGAATTTATAGATTGGGG - Intergenic
1108125955 13:47242964-47242986 TACACTGAAGTTATGGTTTTAGG + Intergenic
1108182050 13:47850011-47850033 TACACTGAATCTGTAGATTTTGG + Intergenic
1108821360 13:54354640-54354662 CAAAATGAATTTATAGAGTAAGG - Intergenic
1108835308 13:54538897-54538919 TAAACTGAATTTTTATATAAAGG - Intergenic
1109191927 13:59335305-59335327 TGCACTAAATTTATATTTTATGG + Intergenic
1109482241 13:62971595-62971617 TAGAATGAATTCATAAATTATGG + Intergenic
1110839772 13:80128467-80128489 TGCACTGAAGTTTTAGGTTATGG + Intergenic
1111507241 13:89208377-89208399 TACACTGATTATATGGTTTAAGG + Intergenic
1111525507 13:89463139-89463161 TTCACTGAAATTATCCATTAAGG + Intergenic
1112231423 13:97592379-97592401 TAGGCTGAATTTATTGATTTGGG - Intergenic
1112270614 13:97965415-97965437 TACCTTGAATCTATAGATTAAGG + Intronic
1112463966 13:99626882-99626904 TACAAAGAATTTATATATTTCGG + Intronic
1114306978 14:21432237-21432259 TACAGTGACTCTATAGATAAAGG + Intronic
1114759265 14:25294808-25294830 TACACTGAGTTTATATATGAAGG + Intergenic
1115952654 14:38738292-38738314 AACACTGCGTTTATAGATGATGG - Intergenic
1117492565 14:56265065-56265087 TGTACTGAATTTACAGATTTTGG - Intronic
1117713200 14:58553975-58553997 TACACTCAATTGATAGTTGATGG + Intergenic
1117795810 14:59393221-59393243 TTCACTGCATTAATAGGTTATGG - Intergenic
1119178189 14:72585130-72585152 TAGACTGAAAGTATAGATTTGGG - Intergenic
1120500862 14:85295933-85295955 TACAGTGAAATAATAGATTATGG + Intergenic
1126484524 15:49165460-49165482 TACTCTGATTTTATAGACTCTGG - Intronic
1127461299 15:59201703-59201725 TACACTGAATTAAGAGTTTGTGG - Intronic
1127612295 15:60648849-60648871 TATACTGAATATATAGAAGATGG + Intronic
1131896962 15:97044064-97044086 AACAGTGAATTTATAAATTGTGG - Intergenic
1132013227 15:98293882-98293904 TCCACTGATAATATAGATTATGG + Intergenic
1132441945 15:101875730-101875752 TACACTGAAAGTATTGATGATGG + Intergenic
1134270432 16:12728365-12728387 TATACTGAATTCGTAGATTTAGG + Intronic
1137452641 16:48590976-48590998 TACTCTGAAATTATTGGTTAGGG + Intronic
1138902368 16:61288363-61288385 TACACTAAACTTAGAAATTAAGG - Intergenic
1143740764 17:8952360-8952382 TCCCCTGAATTTGTAGAATATGG + Intronic
1143984785 17:10902948-10902970 CATACTCAATTTATAGTTTAGGG + Intergenic
1144861118 17:18302902-18302924 TACACTCAGTTTAAAGGTTATGG - Intronic
1149385155 17:56135718-56135740 TCCTCTGAAGTTATTGATTAAGG + Intronic
1149671141 17:58412110-58412132 TCCACTGAATTTGTATATTTAGG - Intronic
1149904373 17:60511955-60511977 CACACTGAATATATAGATTCTGG + Intronic
1151117263 17:71751496-71751518 TACCCTGAATATATATATTCAGG - Intergenic
1153218001 18:2837828-2837850 CACACTGAATTTATTGATTTGGG - Intergenic
1153596793 18:6733961-6733983 TACAGTGCATTTCTAGATCATGG + Intronic
1154244623 18:12684849-12684871 TAAACTAATTTTATAGATTATGG - Intronic
1154259398 18:12816729-12816751 TTCAATGAATTAATACATTAAGG - Intronic
1156113240 18:33753880-33753902 TACACTGAGCTTACAGGTTAAGG - Intergenic
1156185389 18:34656793-34656815 TTCACTAAATTTTTAGATAACGG - Intronic
1156311663 18:35928298-35928320 TTCATTAAATTTATAAATTAAGG - Intergenic
1157060677 18:44285367-44285389 TACAATGGATATATAAATTATGG + Intergenic
1159391034 18:67791671-67791693 TACACTGTAGGTAGAGATTATGG + Intergenic
1159610690 18:70522179-70522201 TTCATTGAATATATAAATTAAGG + Intergenic
1159718342 18:71852724-71852746 ACCACTCAATTTATATATTAGGG - Intergenic
1159735733 18:72095216-72095238 TATACTGAAGTTATAGATTGTGG + Intergenic
1160642987 19:157422-157444 TACACTGAAAGTATTGATGATGG - Intergenic
1162353101 19:10163440-10163462 AACACTGAAGTTACAGGTTAGGG + Intronic
1162861705 19:13510492-13510514 TACAGTGTATTTATCCATTACGG - Intronic
1168505540 19:56931148-56931170 TAAACTGAATAAATATATTAAGG - Intergenic
925499688 2:4489136-4489158 TAGTCTGAATTTATGGATTTGGG - Intergenic
926893941 2:17663368-17663390 TACACAGAATTTAAACATTTTGG + Intergenic
926957579 2:18318485-18318507 CTCACTAAATTTAAAGATTATGG - Intronic
928564137 2:32526082-32526104 GATACTGAATTTTTGGATTAGGG - Intronic
929329780 2:40668158-40668180 TAAAGTGAATTTTTAGTTTATGG + Intergenic
931330857 2:61281695-61281717 AACACTGTATTTATATATTATGG - Intronic
932529906 2:72518400-72518422 CTTACTGAATTTATAGACTATGG + Intronic
932648127 2:73526650-73526672 TTTACTGAATTTATTGATTGTGG + Intronic
932933599 2:76074624-76074646 TTAACTGAATTTAAAGATGATGG - Intergenic
936292963 2:111241121-111241143 TACGCTGAATTCATAAATAAGGG + Intergenic
936683135 2:114798010-114798032 TAGACTGGAATTATAGGTTATGG - Intronic
937735714 2:125285887-125285909 TACATAAAATTCATAGATTATGG + Intergenic
937821024 2:126311135-126311157 TACATTGAAATTAAAGATTTTGG - Intergenic
938600509 2:132833922-132833944 TGCATTGAATCTCTAGATTAGGG + Intronic
939223147 2:139329339-139329361 TGCAATGGATTTATAGATTAAGG - Intergenic
939663667 2:144922440-144922462 TACACAAAATTTATTAATTATGG - Intergenic
939911980 2:147994284-147994306 TGCATTGAATTTATAGATCAAGG - Intronic
941097491 2:161255413-161255435 TACATTAAATTTATAAATGATGG + Intergenic
941947230 2:171112934-171112956 TGCATTCAATTTGTAGATTAGGG - Intronic
942260723 2:174159402-174159424 TACACTGATTTTATAAACAAAGG + Intronic
943225087 2:185162922-185162944 AACACTGATTTTATAGATTTTGG + Intergenic
943384304 2:187183080-187183102 GACACTGAATTTATTGATTTGGG - Intergenic
943522028 2:188963534-188963556 TACTCTCACTTTATAGATTTGGG - Intergenic
943840015 2:192568123-192568145 TACACTGGAGTTATAGGTTTGGG - Intergenic
944020204 2:195093867-195093889 AACAGTGAATTTAGAGAATATGG - Intergenic
945416154 2:209575599-209575621 AAGACTGAATATATAGAATAGGG + Intronic
947878499 2:233484265-233484287 TTCACTGAATTTACAGACTTGGG + Intronic
948039472 2:234888279-234888301 TACATTGAATTTATAGATTAAGG - Intergenic
948070672 2:235120818-235120840 TAGAATGAATATATAAATTATGG + Intergenic
1169359408 20:4935494-4935516 TGCACAGATTTTATATATTAAGG - Intronic
1169590454 20:7135466-7135488 TACTCTGAATCTTTAAATTATGG + Intergenic
1171415339 20:24975601-24975623 TGCATTGAATCTATAGATTAAGG - Intronic
1172108491 20:32531032-32531054 TCCACTGAATTTTTAAATTCAGG + Intronic
1173463131 20:43259999-43260021 TACACTGAGACTATGGATTAAGG - Intergenic
1174981237 20:55397465-55397487 TAGACTGAAATTATGGATTTTGG - Intergenic
1175449054 20:59046952-59046974 CACAGTGAATTTAGAGATAAAGG - Intergenic
1176739232 21:10584044-10584066 TGCATTGAATTTATAGACTGGGG + Intronic
1177071002 21:16508134-16508156 TACACTGAATTAATAGAAGTTGG + Intergenic
1177363440 21:20103627-20103649 CAGACTGAATTTATTGATTTGGG + Intergenic
1177505902 21:22016739-22016761 CAGACTGAATTTATTGATTTGGG - Intergenic
1178620218 21:34167675-34167697 TACAATGAATGAATATATTATGG - Intergenic
1178796662 21:35751310-35751332 TCCACTGACTTCATAGAGTAGGG + Intronic
1179507819 21:41853336-41853358 TACACTGCATTTATAAAACAAGG + Intronic
1184603859 22:45560620-45560642 TAGGCTGAATTTACAGATTTAGG - Intronic
949104692 3:189781-189803 CACACTGAATATATTCATTATGG + Intergenic
950019698 3:9778624-9778646 TAGACTGAGTTTATAGTCTATGG + Intronic
950817465 3:15721318-15721340 TACATTGATTTTATACATTCAGG + Intronic
952367770 3:32689975-32689997 TACACATAATTTATAGCATAGGG + Intronic
953496950 3:43395808-43395830 TATACTGAATCTATAGAACAGGG + Intronic
953937775 3:47060754-47060776 TACATGGAATTTATTAATTATGG - Intronic
954460062 3:50621293-50621315 TACACAAAATTTAAAAATTAGGG + Intronic
955137253 3:56232046-56232068 TACACTGAAGTTTGAGACTATGG - Intronic
955666182 3:61351335-61351357 TACATTGAATATATTAATTAAGG + Intergenic
956847952 3:73201320-73201342 GAAACTGAATTTATAGATATTGG - Intergenic
957254052 3:77813865-77813887 CTCACTGAATTTATAGAGCAGGG - Intergenic
957714532 3:83908053-83908075 TAAACAGAATTTATAAATTTGGG - Intergenic
957730105 3:84124207-84124229 TACAGTGACTTTATAGAGAAGGG - Intergenic
958520265 3:95176729-95176751 TACAGAGAATATTTAGATTAAGG - Intergenic
958901688 3:99894547-99894569 TACTCTGAATTTAGATCTTAGGG + Intronic
959636881 3:108584850-108584872 TACACTGAATTTAGAACTAAAGG - Intronic
960493542 3:118348155-118348177 TTCACTGCTTTCATAGATTAAGG - Intergenic
961113746 3:124310344-124310366 TATACTGGATTTATAGATCAAGG - Intronic
962483756 3:135821445-135821467 TTCACTGAATTTATTTATCAGGG - Intergenic
963453444 3:145514869-145514891 TAGGCTGAATTTATTGATTTGGG + Intergenic
964864821 3:161245245-161245267 TACATTTTATTTATAAATTAAGG + Intronic
965294107 3:166921062-166921084 TACATTAACTTTATAGATAAAGG - Intergenic
965435957 3:168651936-168651958 TACTCTGGTTTTATAGATGAAGG - Intergenic
966773149 3:183521655-183521677 TACCCTCAATGTATAGATGAGGG - Intronic
966934587 3:184697642-184697664 TACACAGAATTTAAAAATTAGGG - Intergenic
971293684 4:25369940-25369962 TAGACTGAATTTGAAGATGATGG + Exonic
972082959 4:35176583-35176605 TACAATGAATTTAAAGATTTAGG - Intergenic
972098245 4:35377391-35377413 TACACTGAAGTTATAGACACAGG - Intergenic
974289309 4:59910540-59910562 CAGACTGAATTTATTGATTTGGG + Intergenic
974701994 4:65463022-65463044 TAAACAGAATTTATAGATCATGG - Intronic
975774438 4:77769233-77769255 TACCCTGAATTTAGATATTGGGG - Intronic
976412103 4:84726175-84726197 GACAATGAATTAATAGATGAGGG + Intronic
976950185 4:90818945-90818967 TACACTGTATTTATCTACTAAGG + Intronic
978966562 4:114748709-114748731 TAGGCTGAATTTATTGATTTGGG + Intergenic
979236972 4:118411748-118411770 TGCATTGAATTTATAGATTTAGG + Intergenic
979414807 4:120423631-120423653 TATACTCATTTTAAAGATTAGGG + Intergenic
979506335 4:121502096-121502118 TACTCTGAAGTTATGGATTTGGG + Intergenic
979572814 4:122250224-122250246 TACATTACTTTTATAGATTAGGG + Intronic
979711708 4:123787679-123787701 GACACTGAATTCATAGAGTAAGG + Intergenic
980617218 4:135244686-135244708 TACAAGGAATATATAGAATATGG + Intergenic
981161027 4:141499000-141499022 TACTCTAAATTTATAGCTTATGG + Intergenic
982020520 4:151199151-151199173 TACAGTAAATTTCTAGATTTGGG + Intronic
982399268 4:154947961-154947983 TAGACTGAAATTAAAGATGAAGG - Intergenic
982491660 4:156038147-156038169 GAGACTGAAGTTCTAGATTATGG + Intergenic
983585151 4:169346440-169346462 CACATTCATTTTATAGATTAAGG - Intergenic
984253385 4:177361511-177361533 TACACTGTGTTTAGAGATTGAGG - Intronic
984302002 4:177932558-177932580 TACACAATATTTATAGAATAAGG - Intronic
984988610 4:185355447-185355469 ATCAGTGAATTTACAGATTAAGG + Intronic
985019868 4:185676175-185676197 AACCCTTAATTTATAGGTTATGG - Intronic
986625237 5:9717434-9717456 TGCACTACATTTATAAATTAGGG - Intergenic
988267774 5:28973582-28973604 CAGACTGAATTTATTGATTTGGG - Intergenic
989018422 5:36969228-36969250 TATACTGAATTTATAGATACGGG - Intronic
989416223 5:41179515-41179537 TATTCTGAATTAGTAGATTAAGG + Intronic
989970135 5:50513769-50513791 TACTCTGAATTTAGAGATAAAGG + Intergenic
989989941 5:50750816-50750838 TACAATGAAGTTATTCATTAAGG + Intronic
992031467 5:72725788-72725810 TACACAGCATTTTTAGATTCTGG - Intergenic
993206223 5:84882892-84882914 TACACTGAATTTCATAATTAAGG + Intergenic
993259001 5:85634257-85634279 TACACTGAAATTCTACATCATGG - Intergenic
994212051 5:97098183-97098205 TTGACTGAATTTATAAATTTAGG - Intronic
994995216 5:107053499-107053521 TTCACTGAATTTATTGTTAAAGG - Intergenic
995279354 5:110316126-110316148 TAGGCTGAATTTATTGATTTGGG - Intronic
995499447 5:112788335-112788357 TACATTAAATTTATAGATTAAGG + Intronic
995776596 5:115729910-115729932 CAGACTGAATTTATTGATTTGGG - Intergenic
998628172 5:143869262-143869284 TATAATGATTTTATAGATGAGGG - Intergenic
999041256 5:148415629-148415651 GACACTGAATTAAAAAATTATGG - Intronic
999351098 5:150872624-150872646 CAGGCTGAATTTATTGATTAGGG + Intronic
1000537545 5:162497595-162497617 TAGACATATTTTATAGATTAGGG + Intergenic
1000728714 5:164803951-164803973 TACATTGAATTTAAAGCTTTAGG - Intergenic
1002454010 5:179336010-179336032 TACATTGAAATTTCAGATTAGGG + Intronic
1002733885 5:181367056-181367078 TACACTGAAAGTATTGATGATGG + Intergenic
1002750658 6:107065-107087 TACACTGAAAGTATTGATGATGG - Intergenic
1003789713 6:9531531-9531553 TACACTGCACTTATATACTAAGG + Intergenic
1004668903 6:17777019-17777041 TAAACTCAATTTATATCTTAAGG + Intronic
1005177670 6:23065347-23065369 TACACTCAATTTATAATTCAAGG - Intergenic
1005690056 6:28296112-28296134 TACACTGAATTTATTTATTTGGG - Intronic
1008023890 6:46611798-46611820 TACACTGGCTTTATACATAAGGG - Intronic
1008170998 6:48205332-48205354 TACCCTGAGTTTATAGACTAAGG - Intergenic
1008326733 6:50191428-50191450 TAAACTGAATTTAGACATCAAGG + Intergenic
1008943991 6:57077039-57077061 GACATTGAATTTGTAGATCAAGG + Intergenic
1009272057 6:61626035-61626057 TATACTTCATTAATAGATTATGG - Intergenic
1010098730 6:72077736-72077758 TACCCTCAATTTACAGATGAGGG + Intronic
1010799288 6:80155778-80155800 TAAAATGAATTTCTAAATTAAGG - Intronic
1011933394 6:92741965-92741987 TAAACTAAATTAATAGATTTGGG + Intergenic
1012041299 6:94207435-94207457 TACACTGAGTTTCTATTTTAAGG - Intergenic
1012166740 6:95963649-95963671 TACACTGAATTAATTTATTTTGG - Intergenic
1012249638 6:96965226-96965248 TAGACTGAATTTAAAAAATATGG - Intronic
1014597527 6:123363672-123363694 GTCACTGAGTTTATAGAGTATGG - Intronic
1015081899 6:129237080-129237102 TACATTGATTTTAAAGATGAGGG - Intronic
1015223881 6:130834387-130834409 TTAACTGAAATTATATATTAAGG + Intronic
1015475445 6:133655089-133655111 TAGGCTGAATTTATTGATTTGGG + Intergenic
1016101831 6:140112128-140112150 TACAATGAATGGATAGATTTAGG + Intergenic
1016255383 6:142098748-142098770 AGCATTGAATTTATAGATGAAGG - Intergenic
1016384909 6:143521423-143521445 TACACTCATTTTATAGATGAGGG + Intergenic
1016410061 6:143773444-143773466 TGGACTGAATTTGTAGATTATGG + Intronic
1018411035 6:163548997-163549019 TTCACTGTAATTATAGAATATGG + Intronic
1018591259 6:165425199-165425221 TTGACTGAATGTATTGATTATGG - Intronic
1019238132 6:170639375-170639397 TACACTGAAAGTATTGATGATGG + Intergenic
1019880677 7:3858012-3858034 TTTACCGAATTTATAGATTTGGG - Intronic
1020714456 7:11652763-11652785 GAAACTGAATTTATGGTTTAGGG + Intronic
1022250552 7:28603229-28603251 TATACTGAATTTATAAATTTGGG - Intronic
1022341299 7:29470809-29470831 GACACTCAATTTCTAGCTTATGG - Intronic
1022397728 7:30005604-30005626 TAGACTGGTTTTATAGATTATGG + Intergenic
1022759787 7:33335622-33335644 TATCCTTAATTTATATATTATGG + Intronic
1024785142 7:52898751-52898773 TACACTGAATTTCTAGCATTAGG - Intergenic
1025731288 7:64110532-64110554 TAACCTAAATTTCTAGATTATGG + Intronic
1027965795 7:85005359-85005381 TACACTGAATATTTATTTTAAGG - Intronic
1028046682 7:86129253-86129275 TAGACTGGAGTTATAGATTTTGG + Intergenic
1028067294 7:86402715-86402737 TACACTGAATTTGAAGATACCGG + Intergenic
1028438006 7:90827497-90827519 GACACTGAGTATATAGATGAAGG + Intronic
1029048758 7:97660778-97660800 TAGACTGAATTTATTGATGTGGG - Intergenic
1029239937 7:99152926-99152948 TTAGTTGAATTTATAGATTATGG + Intergenic
1029943136 7:104501655-104501677 TACCCTGAATTGAAAGATTGTGG + Intronic
1030180158 7:106698854-106698876 TATATTGAATCTATAGATCAAGG + Intergenic
1031474729 7:122207569-122207591 CAGGCTGAATTTATAGATTTGGG - Intergenic
1031739026 7:125404448-125404470 TGCACTGGTTTTATGGATTAGGG + Intergenic
1032350794 7:131161404-131161426 TATTTTGAATTTTTAGATTAGGG - Intronic
1032887215 7:136153742-136153764 TACTCTGATTTCATAGATGAGGG + Intergenic
1033075923 7:138250473-138250495 CAGACTGAATTTATTGATTTGGG + Intergenic
1033722049 7:144071056-144071078 TACAATGAAGTTATTGACTATGG + Intergenic
1035509634 8:167233-167255 TACACTGAAAGTATTGATGAGGG - Intergenic
1036466941 8:9006937-9006959 TAAACTGTAATTATAGATCAAGG - Intronic
1037395915 8:18442796-18442818 TGCATTGAATCTATAGATCAAGG - Intergenic
1038036753 8:23692617-23692639 GACATTGAATCAATAGATTAAGG - Intergenic
1040611529 8:48988549-48988571 AACACTGAAGTTTTTGATTAGGG + Intergenic
1041343195 8:56867334-56867356 TACACCAAATGTATAGATGAAGG - Intergenic
1041714135 8:60918429-60918451 GACACTGATTTTACAGAGTAGGG - Intergenic
1042727908 8:71898551-71898573 TATGCTGAATTTTTAGATTCGGG - Intronic
1043316025 8:78923162-78923184 TACACTGGCTTTACAGATAAGGG + Intergenic
1046887746 8:119386580-119386602 TACACAGAATTCAGAGAATAGGG + Intergenic
1046967849 8:120187142-120187164 TACAATGCATTTTTAGATAAAGG - Intronic
1050702857 9:8360499-8360521 TAAACTGAACATATAGATCAAGG + Intronic
1051966125 9:22832006-22832028 TAGGCTGAATTTATTGATTTGGG + Intergenic
1052366359 9:27615868-27615890 TTCACTGAAGTGATAGATTTTGG - Intergenic
1052436157 9:28432077-28432099 TACAGTGCTTTTATAGAGTATGG - Intronic
1053362855 9:37501697-37501719 GCCACTGATTTTCTAGATTACGG + Exonic
1054737649 9:68771577-68771599 TACCCTTATTTTATAGATAAGGG - Intronic
1059568887 9:115412983-115413005 TAAACTAAGTTTATAGATTTGGG + Intergenic
1060574613 9:124679410-124679432 TACATTTAGTTTTTAGATTAAGG - Intronic
1062758339 9:138319670-138319692 TACACTGAAAGTATTGATGATGG + Intergenic
1185970524 X:4657465-4657487 TACATTGAATTGACAGATGATGG - Intergenic
1187692030 X:21878864-21878886 TAATCTGAATTTATAAAGTAAGG + Intronic
1187892741 X:23952107-23952129 TACTGTAAATTTATAGATCAGGG - Intergenic
1188114806 X:26230020-26230042 TACACTGAATTTATAAAAATGGG + Intergenic
1189055176 X:37692054-37692076 TTCATTGAATTGATATATTAGGG + Intronic
1189289339 X:39874200-39874222 TACACTGTATTTCTCAATTATGG + Intergenic
1189338891 X:40189107-40189129 TAGCCTGCATTTATAGATGAGGG + Intergenic
1189877348 X:45449840-45449862 TACACTGAGCTTAGAGATCATGG + Intergenic
1190617806 X:52254703-52254725 TGCACTGAATCTATAGATTAAGG + Intergenic
1191733298 X:64362246-64362268 TGTATTGAATTTATAGATTGAGG - Intronic
1191742816 X:64453533-64453555 CACGCTGAATTTATTGATTTGGG - Intergenic
1193512425 X:82419837-82419859 AACCCTGAATTTATACCTTAAGG + Intergenic
1193751729 X:85354177-85354199 TACATTAAAATTATAGATTAAGG - Intronic
1194166032 X:90517890-90517912 TGCATTGAATCTATAGAGTATGG - Intergenic
1194282071 X:91965547-91965569 TAAACTTAATTTATAGAGGAGGG + Intronic
1196037786 X:111166061-111166083 TACATTGGATTTGTAGATTTTGG + Intronic
1196164187 X:112520460-112520482 TTTACAGAATGTATAGATTATGG - Intergenic
1196275534 X:113761884-113761906 CAGACTGAATTTATTGATTTCGG + Intergenic
1196402197 X:115328581-115328603 TACACTGTATTTATTGGTTCGGG + Intergenic
1196479469 X:116129740-116129762 TAGAAAGTATTTATAGATTAAGG + Intergenic
1197574574 X:128195152-128195174 CACTCTGAATTTTTAGAATATGG + Intergenic
1198933680 X:141885302-141885324 CAGACTGAATTTATTGATTTGGG + Intronic
1199331713 X:146568175-146568197 TACACTGAAATTATAGGATACGG + Intergenic
1199353617 X:146834295-146834317 TACTAGGAATTTATAGATTTAGG + Intergenic
1200512301 Y:4095659-4095681 TGCATTGAATCTATAGAGTATGG - Intergenic
1200599666 Y:5190208-5190230 TAAACTTAATTTATAGAGGAGGG + Intronic
1201641687 Y:16185187-16185209 TACACTGATTTTCTGGGTTAGGG + Intergenic
1201661128 Y:16400137-16400159 TACACTGATTTTCTGGGTTAGGG - Intergenic
1202100161 Y:21299200-21299222 CACGCTGAATTTATTGATTTGGG + Intergenic