ID: 1105567130

View in Genome Browser
Species Human (GRCh38)
Location 13:21560701-21560723
Sequence ACACTGAATTTATAGATTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105567125_1105567130 -1 Left 1105567125 13:21560679-21560701 CCCCATTGGGATTATTGCAATTA 0: 1
1: 0
2: 1
3: 22
4: 180
Right 1105567130 13:21560701-21560723 ACACTGAATTTATAGATTAGGGG 0: 1
1: 0
2: 2
3: 24
4: 221
1105567126_1105567130 -2 Left 1105567126 13:21560680-21560702 CCCATTGGGATTATTGCAATTAC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1105567130 13:21560701-21560723 ACACTGAATTTATAGATTAGGGG 0: 1
1: 0
2: 2
3: 24
4: 221
1105567124_1105567130 3 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567130 13:21560701-21560723 ACACTGAATTTATAGATTAGGGG 0: 1
1: 0
2: 2
3: 24
4: 221
1105567127_1105567130 -3 Left 1105567127 13:21560681-21560703 CCATTGGGATTATTGCAATTACA 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1105567130 13:21560701-21560723 ACACTGAATTTATAGATTAGGGG 0: 1
1: 0
2: 2
3: 24
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105567130 Original CRISPR ACACTGAATTTATAGATTAG GGG Intronic
901289554 1:8113185-8113207 ACATTGAATCTGTAGCTTAGCGG - Intergenic
903689051 1:25157364-25157386 AAACTGAATTTATAGAGCAGTGG - Intergenic
906832726 1:49050516-49050538 ACAATGTATATATATATTAGTGG - Intronic
910163233 1:84296650-84296672 ACACAACATTTATAGATTAATGG + Intergenic
910386730 1:86691904-86691926 ACTCTTAATTGATAGTTTAGTGG + Intergenic
911405852 1:97438336-97438358 ATACTGTATTCATAGATCAGAGG - Intronic
911856038 1:102876267-102876289 ATACTGAATTTATAAAATAAAGG - Intergenic
912333313 1:108839544-108839566 CCACTAAATTAATAGATTAAAGG + Intronic
912373299 1:109190276-109190298 ACACTGTTTTTATGGATGAGGGG - Intronic
913003233 1:114602724-114602746 ACACAAAATTAAAAGATTAGTGG - Intronic
915292294 1:154894133-154894155 GCACTGAATCTATAAATTTGGGG - Intergenic
918713484 1:187760554-187760576 ACACTGACGTTATAGATTAGAGG - Intergenic
919230296 1:194764761-194764783 AGGCTGAATTTATTGATTTGGGG - Intergenic
919241518 1:194922302-194922324 AGGCTGAATTTATTGATTTGGGG + Intergenic
920678434 1:208054857-208054879 ACCCAGAATTTATAGAATAAAGG + Intronic
921311050 1:213843731-213843753 AAACTTAATGAATAGATTAGGGG + Intergenic
922944797 1:229503855-229503877 TCTCTGAATTTCTAGATTTGGGG + Intronic
922995140 1:229951390-229951412 ACACAGAGTTTAAATATTAGTGG + Intergenic
924191843 1:241561653-241561675 AAACTGAAATTATCTATTAGGGG - Intronic
924454357 1:244206746-244206768 AGACTGAAGTTAAAGACTAGAGG - Intergenic
924908486 1:248482668-248482690 ACACAGCATTTATATACTAGTGG - Intergenic
924915625 1:248565419-248565441 ACACAGCATTTATATACTAGTGG + Intergenic
1062783767 10:242378-242400 AGACTGAATTTATAGTACAGTGG + Intronic
1064883238 10:20080912-20080934 ACACTGAAATTCTAGCTTTGTGG - Intronic
1065206425 10:23361721-23361743 AAAATGGATTAATAGATTAGAGG + Intergenic
1068401711 10:56536259-56536281 ACAGTGAATCTCTACATTAGTGG + Intergenic
1069117358 10:64524505-64524527 AGACTGAAATTATATATTATGGG - Intergenic
1069519182 10:69104548-69104570 ACAGTGAATTTGTAGAGTGGGGG + Exonic
1071115311 10:82211867-82211889 ACACTGCATTTCTAGTATAGGGG - Intronic
1071695670 10:87866836-87866858 ACACTTAATTTCTAGAGTTGTGG + Intronic
1072026316 10:91462475-91462497 ACACTGAATCTGTAGATCAGTGG + Intronic
1074211792 10:111341906-111341928 ACAATCAATTTATACAATAGTGG + Intergenic
1077989954 11:7397584-7397606 GCACTAAATTTATAGATCAATGG + Intronic
1080006710 11:27415920-27415942 ACACAGACTTTATAAATAAGAGG + Intronic
1080738713 11:35043290-35043312 ATACTGCATTTTTAGATCAGTGG + Intergenic
1080843524 11:36006240-36006262 ACAATTAATTCACAGATTAGGGG + Intronic
1082926867 11:58557900-58557922 ACATTGAATTTACAGTTTAGGGG - Intronic
1084635354 11:70388559-70388581 GCAGTAAATTTAAAGATTAGCGG + Intergenic
1085363321 11:75913019-75913041 ACACAGGATTTAGAAATTAGAGG + Intronic
1087484087 11:98739225-98739247 ACACTTATTTGATAGATTACAGG - Intergenic
1087743871 11:101920518-101920540 ATACTGAAGTTATAGATTGTAGG - Intronic
1088731322 11:112686110-112686132 TCACAGAATTTACAGATCAGTGG + Intergenic
1093471990 12:19512004-19512026 ACACTTAAGTTCTTGATTAGGGG + Intronic
1094557234 12:31513158-31513180 ATACTGAGTTTATAGGTTTGGGG + Intronic
1095555673 12:43501022-43501044 ACACTGAATCTATAAATAGGTGG + Intronic
1097406150 12:59193182-59193204 ATAATGAATTTATACATGAGTGG + Intergenic
1098536742 12:71601823-71601845 ACACTAAATTTACACATTTGTGG - Intergenic
1099418292 12:82421294-82421316 ATAGAGAATTTATAGATTTGAGG + Intronic
1101075575 12:101126489-101126511 ATACTCACTTTATAGATGAGGGG + Intronic
1101876923 12:108602258-108602280 ACACAGAGTTTACAGAGTAGCGG + Intergenic
1102434414 12:112909833-112909855 AAACTGAACTTACTGATTAGTGG + Intronic
1105567130 13:21560701-21560723 ACACTGAATTTATAGATTAGGGG + Intronic
1105734094 13:23249251-23249273 AAACTGAATTTCTAGATTACTGG - Intronic
1106664133 13:31833947-31833969 ATAATCAAATTATAGATTAGAGG + Intergenic
1108591027 13:51913057-51913079 ACACCAAATTAATAGATGAGTGG + Intergenic
1108698087 13:52920530-52920552 ACAGAGAAGTTATAGTTTAGGGG - Intergenic
1110528521 13:76568871-76568893 ACACTGTATTTTTTGTTTAGAGG - Intergenic
1111024086 13:82496022-82496044 AAATTGTATTTATAGTTTAGAGG + Intergenic
1111276858 13:85960967-85960989 ACACTAAAATTATTGAATAGTGG - Intergenic
1111676289 13:91393735-91393757 AAACTGAAAATATAGATTAGTGG + Intergenic
1112270615 13:97965416-97965438 ACCTTGAATCTATAGATTAAGGG + Intronic
1113163661 13:107412489-107412511 ACACTGAACTCATAGATTGCTGG + Intronic
1115384693 14:32782779-32782801 ATACTGAATTCATGGATCAGAGG + Intronic
1116015168 14:39397439-39397461 AAACTTAATTTATAGACTAGAGG - Intergenic
1116422924 14:44753945-44753967 TCACTGAATTTATAGCTTAATGG + Intergenic
1116566491 14:46450760-46450782 ACACTGAAATTATATATTCTTGG - Intergenic
1116840072 14:49811027-49811049 ACAGTGAATTCCTAGATTACTGG + Intronic
1118061075 14:62138157-62138179 TCACTGAAATTATATATTAATGG + Intergenic
1119616869 14:76104637-76104659 ACACTGAATTCATGAATTTGGGG + Intergenic
1120337870 14:83181135-83181157 AGACTGAAATTATAGTTTAGAGG - Intergenic
1124068557 15:26369714-26369736 ACTCAGAATTTATAAACTAGTGG + Intergenic
1124084881 15:26538892-26538914 GCATTGAATTTATAGATTTGTGG - Intergenic
1125245967 15:37640306-37640328 CCAATGAATTTACAGATTATTGG + Intergenic
1125317537 15:38447185-38447207 ACACTGATTTGTTTGATTAGAGG - Intergenic
1125347614 15:38733945-38733967 ACACTGTATTTCTAAATTACAGG + Intergenic
1125777516 15:42230529-42230551 AAATTAAATTTATATATTAGGGG - Intronic
1126512562 15:49496356-49496378 AAACTGAATTTAGAAATTGGGGG + Intronic
1127737157 15:61852712-61852734 AAATTGAATTTCTATATTAGTGG - Exonic
1129497156 15:75995024-75995046 ACAATAAATTTAAAAATTAGAGG + Intronic
1130003954 15:80076344-80076366 ACACTGAATTTAAAATTTATAGG - Intronic
1131896961 15:97044063-97044085 ACAGTGAATTTATAAATTGTGGG - Intergenic
1137498136 16:48986839-48986861 ACAATCAATTTATACAATAGTGG + Intergenic
1138947427 16:61868727-61868749 ATTCTGAATTTTCAGATTAGGGG + Intronic
1139360052 16:66392017-66392039 ACACCCATTTTATAGATGAGGGG - Intronic
1140238190 16:73177787-73177809 TCAAGGAATTTATAGCTTAGTGG + Intergenic
1143720942 17:8808876-8808898 TCTCTGAATTTATAGATTTTAGG + Intronic
1143972918 17:10808525-10808547 ACACTGGATTACGAGATTAGGGG - Intergenic
1143984786 17:10902949-10902971 ATACTCAATTTATAGTTTAGGGG + Intergenic
1147764496 17:42824463-42824485 CCCCTGAATTTAGAGAATAGCGG - Intronic
1148258023 17:46154051-46154073 ACACTTAATTTTTGGAGTAGAGG + Intronic
1149746600 17:59105189-59105211 AAACTGATTTTATAATTTAGAGG + Intronic
1149904374 17:60511956-60511978 ACACTGAATATATAGATTCTGGG + Intronic
1151603665 17:75122776-75122798 TCACGGAGTTTATAGTTTAGTGG + Intronic
1151849844 17:76683818-76683840 ACACTGATTTCTTAGACTAGTGG - Intronic
1154244622 18:12684848-12684870 AAACTAATTTTATAGATTATGGG - Intronic
1156194303 18:34756360-34756382 ACACAGACTTTAAAGTTTAGTGG - Intronic
1157704779 18:49795945-49795967 ACACTGATTTTACAAATTAATGG + Intronic
1158068349 18:53440261-53440283 ACACTGATTTTACAAATTATAGG - Intronic
1159347681 18:67227957-67227979 ACACTCAATTTGTACAATAGCGG - Intergenic
1159735734 18:72095217-72095239 ATACTGAAGTTATAGATTGTGGG + Intergenic
1164812512 19:31168934-31168956 GAACTGAATTTATAAAATAGTGG - Intergenic
925987226 2:9226272-9226294 ACACTGAATGAATAAATAAGTGG - Intronic
927975738 2:27336769-27336791 ACAAAGAATTTAAAAATTAGTGG - Intronic
933401948 2:81809529-81809551 ACAATCAATTTATACAATAGTGG + Intergenic
934868207 2:97833321-97833343 ACAAAGAATATATAAATTAGGGG + Intronic
937362815 2:121240783-121240805 GCACTGCATTTATGGATTAGAGG - Intronic
937658388 2:124402830-124402852 ACTCTGAAATGATAGATTTGAGG - Intronic
940829148 2:158448712-158448734 ACATTTAATCTATAGATTAGAGG + Intronic
941291710 2:163683695-163683717 ACTCTGAATTAATTGGTTAGGGG + Intronic
941634499 2:167922075-167922097 ACATTAAATTTATTAATTAGAGG - Intergenic
943710444 2:191088502-191088524 CCATTGAATCTATAGATAAGTGG - Intronic
943840014 2:192568122-192568144 ACACTGGAGTTATAGGTTTGGGG - Intergenic
945796877 2:214375689-214375711 ACACTGTATCTATAGATTTGAGG + Intronic
946972218 2:225107060-225107082 ACACGGCATTTTTATATTAGTGG - Intergenic
947045169 2:225973990-225974012 AAACTTAGTTGATAGATTAGTGG - Intergenic
948335586 2:237204665-237204687 ACAGTGAAGCTATAGATTTGGGG - Intergenic
1169483769 20:6008957-6008979 ACAATGAAGTTATATATTAAAGG + Intronic
1170283071 20:14673450-14673472 AGACTGATTTTACAGATTTGAGG + Intronic
1176518568 21:7806680-7806702 ACACTGCATTAAAAGATTTGTGG + Intergenic
1177922638 21:27171629-27171651 ACAGAGAATTTATAAATTACAGG - Intergenic
1178652596 21:34436693-34436715 ACACTGCATTAAAAGATTTGTGG + Intergenic
1178796664 21:35751311-35751333 CCACTGACTTCATAGAGTAGGGG + Intronic
1178986290 21:37305925-37305947 ACACTGAATTTATGCTTTAAAGG - Intergenic
1180243599 21:46530052-46530074 CTACTGTATTTATAGATCAGAGG + Intronic
949518825 3:4831223-4831245 ACACTGAAGTTTTAGATATGGGG - Intronic
952081532 3:29764040-29764062 ATATTGAGTTTATAGATAAGAGG + Intronic
952120594 3:30238932-30238954 GCATTGAATTTGTAGATTACTGG + Intergenic
953135839 3:40181023-40181045 ACACTGAGCTTTAAGATTAGAGG - Intronic
953496951 3:43395809-43395831 ATACTGAATCTATAGAACAGGGG + Intronic
955590729 3:60532347-60532369 AAAATGAATTTAAACATTAGTGG - Intronic
957131769 3:76231982-76232004 AAAATAAATTTATAGATTAAAGG + Intronic
957254051 3:77813864-77813886 TCACTGAATTTATAGAGCAGGGG - Intergenic
957714531 3:83908052-83908074 AAACAGAATTTATAAATTTGGGG - Intergenic
957730104 3:84124206-84124228 ACAGTGACTTTATAGAGAAGGGG - Intergenic
957881683 3:86222404-86222426 AAACTGAAATTTTAGAATAGTGG - Intergenic
958709645 3:97701884-97701906 GCACTCAATTTATAAATTTGAGG - Intronic
959419709 3:106114002-106114024 AGACTGAATTAATAGAATTGTGG + Intergenic
961751714 3:129099687-129099709 AAACTTAATTTTTAAATTAGTGG + Intronic
962058230 3:131897118-131897140 ACATTAATTTTATAGACTAGTGG + Intronic
965962755 3:174448025-174448047 ACACTGATCTTTTAGATTTGTGG + Intronic
966773148 3:183521654-183521676 ACCCTCAATGTATAGATGAGGGG - Intronic
966934586 3:184697641-184697663 ACACAGAATTTAAAAATTAGGGG - Intergenic
966960461 3:184932217-184932239 ACACTTAGTTTATAGCTTAGTGG + Intronic
970505126 4:16721349-16721371 ACACAGAATTTAAAGACCAGAGG - Intronic
972362428 4:38339424-38339446 ACAATCAATTTATACAATAGTGG + Intergenic
973014693 4:45123681-45123703 ACACTGAAGTTAGAGAATATAGG - Intergenic
973892767 4:55384541-55384563 ACAAGGAATTTAAAAATTAGCGG + Intergenic
974726796 4:65809239-65809261 ATGCTGAATTTATTGATTTGGGG + Intergenic
975135759 4:70872758-70872780 ACACTGAATTTCCAGTTTACAGG + Intergenic
976352800 4:84079519-84079541 TTCCTGAATTTGTAGATTAGTGG + Intergenic
977004753 4:91551271-91551293 ACAGTGCCTTTATAGATTAAAGG + Intronic
979236973 4:118411749-118411771 GCATTGAATTTATAGATTTAGGG + Intergenic
979506336 4:121502097-121502119 ACTCTGAAGTTATGGATTTGGGG + Intergenic
980269673 4:130567832-130567854 ACAGTTAATTCATAGATAAGTGG + Intergenic
980397808 4:132238332-132238354 CCACTAAATTTGGAGATTAGTGG + Intergenic
980412380 4:132439130-132439152 TCACAGAATTTATAATTTAGTGG + Intronic
980623570 4:135343559-135343581 TCACTGAGTTTATGAATTAGTGG + Intergenic
981465975 4:145072587-145072609 ACCCTGAACTTATATAATAGAGG + Intronic
982491661 4:156038148-156038170 AGACTGAAGTTCTAGATTATGGG + Intergenic
982864859 4:160498235-160498257 TCAGTGAATTTATACAATAGTGG - Intergenic
983585150 4:169346439-169346461 ACATTCATTTTATAGATTAAGGG - Intergenic
984988611 4:185355448-185355470 TCAGTGAATTTACAGATTAAGGG + Intronic
985259293 4:188100285-188100307 ACAATAATTTTATAAATTAGGGG + Intronic
986349626 5:6865782-6865804 ACTATGAATGTATAGTTTAGGGG - Intergenic
987717161 5:21586706-21586728 ACAGTAAATTTACAGATCAGAGG + Intergenic
988169465 5:27635045-27635067 AGGCTGAATTTATTGATTTGGGG - Intergenic
988812697 5:34801360-34801382 ACACTGTATTTAAAAACTAGTGG - Intronic
988931401 5:36039124-36039146 ACTCTGAATGTATATACTAGGGG - Intronic
989970136 5:50513770-50513792 ACTCTGAATTTAGAGATAAAGGG + Intergenic
991315462 5:65299790-65299812 ATATAGAATTTATAGAATAGAGG - Intronic
991389660 5:66128939-66128961 ACACTGAATTAATAGAATAAAGG + Intergenic
992356696 5:75992795-75992817 TCAATGAAATTATAGAATAGGGG + Intergenic
992833100 5:80614713-80614735 TTAATGAATTAATAGATTAGTGG - Intergenic
993161993 5:84303571-84303593 CCAATGAATTTAGAGATTAAAGG + Intronic
994059205 5:95455541-95455563 TCAGGGAATTTATAGTTTAGTGG + Intergenic
996287131 5:121807417-121807439 ACACTGCATTTAAATATTTGAGG - Intergenic
996919495 5:128750907-128750929 ACAGTTATTTTATAAATTAGAGG + Intronic
998628171 5:143869261-143869283 ATAATGATTTTATAGATGAGGGG - Intergenic
998766488 5:145493432-145493454 ACACTGAAGCAATAGATCAGAGG - Intronic
998807820 5:145936143-145936165 TCTCTGAATTTAGAGATAAGAGG - Intergenic
1004359752 6:14960665-14960687 ACTCTGAAGGTATAGAATAGGGG + Intergenic
1004786168 6:18969954-18969976 ACACTGAATTTTTAAAATATAGG + Intergenic
1004930456 6:20458372-20458394 CTATTTAATTTATAGATTAGGGG - Intronic
1005631707 6:27714224-27714246 ACAATTATTTTATAGAGTAGGGG + Intergenic
1005690055 6:28296111-28296133 ACACTGAATTTATTTATTTGGGG - Intronic
1006209335 6:32381921-32381943 ACACTGATGATATAGATTTGAGG + Intergenic
1008288822 6:49687512-49687534 ACACTGAATTTCAAGATTCTAGG - Intergenic
1008322804 6:50138195-50138217 ACAGTTAATTTATAGATGATAGG + Intergenic
1009525805 6:64744265-64744287 AAATTGAATTTATAGATTAGTGG - Intronic
1010001138 6:70950630-70950652 ATACTGATTATATAGATCAGAGG + Intronic
1010139042 6:72591858-72591880 GCACTGAATTCATAGATAAATGG + Intergenic
1010551975 6:77234831-77234853 AAACTGAATCTACATATTAGAGG - Intergenic
1011068805 6:83359468-83359490 AGGCTGAATTTATTGATTTGGGG + Intronic
1011774164 6:90709417-90709439 ACACTAATTTTAAAGAATAGTGG + Intergenic
1011810298 6:91124208-91124230 ACATAGAATTTATAGATTACAGG - Intergenic
1012333438 6:98023333-98023355 ACATTGAATTTACATATTTGTGG - Intergenic
1013323474 6:109019930-109019952 ACACTAAATTTATACATAAGTGG + Intronic
1013358693 6:109372662-109372684 ACACAGAATTCTTAGATTAGAGG + Intronic
1016420271 6:143875517-143875539 GGGCTGAATTTATAGATTTGGGG - Intronic
1016655032 6:146508872-146508894 ATGTTGAATTTATAGATGAGAGG - Intergenic
1016669911 6:146692224-146692246 ACAATGAAATTAAACATTAGGGG - Intronic
1017573778 6:155778840-155778862 AAACTAAATTTATAAAATAGAGG + Intergenic
1017593187 6:155999070-155999092 ACACTCAGTTTACAAATTAGAGG - Intergenic
1017600868 6:156079549-156079571 ACACTCAAATGGTAGATTAGAGG - Intergenic
1019094872 6:169571054-169571076 CTCCTGAATTTATAAATTAGCGG + Intronic
1019880676 7:3858011-3858033 TTACCGAATTTATAGATTTGGGG - Intronic
1020528641 7:9299122-9299144 TCTATGAATTTATAGATTAATGG - Intergenic
1022250551 7:28603228-28603250 ATACTGAATTTATAAATTTGGGG - Intronic
1022397729 7:30005605-30005627 AGACTGGTTTTATAGATTATGGG + Intergenic
1023926057 7:44670615-44670637 ACTCTGAAATTAGGGATTAGGGG + Intronic
1027558690 7:79699097-79699119 TCACTGAAAGTATAGATTATTGG - Intergenic
1031416090 7:121498019-121498041 ACAATCAATTTATACAATAGTGG + Intergenic
1031719518 7:125153789-125153811 ACACTTAATTTATTGAAAAGGGG - Intergenic
1031739027 7:125404449-125404471 GCACTGGTTTTATGGATTAGGGG + Intergenic
1032967544 7:137118273-137118295 TCACTGAATTAATAGATAACTGG - Intergenic
1033033964 7:137853438-137853460 ACACAGAAGTTATTAATTAGTGG - Intergenic
1033949867 7:146771930-146771952 ACACTTAATTTTTAGAGTAGTGG - Intronic
1035509633 8:167232-167254 ACACTGAAAGTATTGATGAGGGG - Intergenic
1036490300 8:9219020-9219042 ACACTGAAGTTAGAGAATACTGG + Intergenic
1038036752 8:23692616-23692638 ACATTGAATCAATAGATTAAGGG - Intergenic
1039630081 8:39101428-39101450 ACTCTGAATTTATATACTACTGG - Intronic
1042323855 8:67507646-67507668 ACAAGGAATTTATACACTAGTGG + Intronic
1046065357 8:109190103-109190125 AGACTGGATGTAAAGATTAGTGG - Intergenic
1047669335 8:127127457-127127479 ACATTTAATTTGTAAATTAGAGG + Intergenic
1051656824 9:19390240-19390262 ACACTAAATGCATATATTAGAGG + Intergenic
1058017713 9:100054543-100054565 ATTTTGAATTTTTAGATTAGGGG - Intronic
1058801460 9:108548387-108548409 ACACTGAAATATTATATTAGAGG + Intergenic
1059819722 9:117958474-117958496 ACACAGATTTTACAGATTAACGG + Intergenic
1186652723 X:11578214-11578236 ACACTGAACTTAGAGTATAGAGG - Intronic
1187114588 X:16336284-16336306 GAACTGAAATTAAAGATTAGTGG + Intergenic
1188485760 X:30680297-30680319 ACAATTAATTTATAAAATAGGGG - Intronic
1188899688 X:35714504-35714526 AAACTGAATTTAAAATTTAGTGG - Intergenic
1189596829 X:42575779-42575801 ACACTGTATTAATAGAATAAAGG - Intergenic
1189757714 X:44287738-44287760 AAATTGAATTTCTAGATTACTGG - Intronic
1193751728 X:85354176-85354198 ACATTAAAATTATAGATTAAGGG - Intronic
1195258361 X:103110039-103110061 ACAATGAATTTGTACAATAGTGG + Intergenic
1195306628 X:103589313-103589335 AAACTGAATATATAAATAAGTGG - Intergenic
1195859631 X:109369251-109369273 AAAGTGAATATATAGATTAATGG + Intergenic
1196087660 X:111702922-111702944 ACAATGAAGCTCTAGATTAGAGG - Intronic
1196513142 X:116537921-116537943 ACACTGCACTTATAGAATAAAGG - Intergenic
1197039185 X:121914862-121914884 ACAGTCAATTTATATATTATTGG + Intergenic
1197047949 X:122022919-122022941 ACATTGAATCTATAGATTTTTGG + Intergenic
1197472309 X:126878546-126878568 ATACTTAATTAAGAGATTAGAGG - Intergenic
1198323016 X:135538229-135538251 AAACTGAGTTTATACATCAGTGG - Intronic
1199879969 X:151966224-151966246 ACACTGAATTTCTAGAGTTTCGG - Intronic
1201585192 Y:15552509-15552531 CCACTGAGTTTATAGTTTTGGGG + Intergenic
1201860404 Y:18591590-18591612 ACAATCAATTTATACAGTAGTGG - Intergenic
1201872919 Y:18728791-18728813 ACAATCAATTTATACAGTAGTGG + Intergenic