ID: 1105567131

View in Genome Browser
Species Human (GRCh38)
Location 13:21560713-21560735
Sequence TAGATTAGGGGTTACAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105567124_1105567131 15 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567131 13:21560713-21560735 TAGATTAGGGGTTACAAACTAGG 0: 1
1: 0
2: 1
3: 14
4: 127
1105567127_1105567131 9 Left 1105567127 13:21560681-21560703 CCATTGGGATTATTGCAATTACA 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1105567131 13:21560713-21560735 TAGATTAGGGGTTACAAACTAGG 0: 1
1: 0
2: 1
3: 14
4: 127
1105567126_1105567131 10 Left 1105567126 13:21560680-21560702 CCCATTGGGATTATTGCAATTAC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1105567131 13:21560713-21560735 TAGATTAGGGGTTACAAACTAGG 0: 1
1: 0
2: 1
3: 14
4: 127
1105567125_1105567131 11 Left 1105567125 13:21560679-21560701 CCCCATTGGGATTATTGCAATTA 0: 1
1: 0
2: 1
3: 22
4: 180
Right 1105567131 13:21560713-21560735 TAGATTAGGGGTTACAAACTAGG 0: 1
1: 0
2: 1
3: 14
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105567131 Original CRISPR TAGATTAGGGGTTACAAACT AGG Intronic
905134223 1:35785962-35785984 TAGATTAGGGGTTACGCACATGG + Intergenic
906309753 1:44745237-44745259 TAGTTTAGGGGTTAGAAATGGGG + Intronic
907134631 1:52128200-52128222 TAGATTAGAGGACACAGACTTGG - Intergenic
909144694 1:71915612-71915634 TAGACTAAGGGTCTCAAACTTGG + Intronic
909162911 1:72176863-72176885 TATATTAGTGGCTACAAAATAGG + Intronic
909399118 1:75206658-75206680 CAGGTTAGGGGTTACGAAGTAGG + Exonic
911716332 1:101137747-101137769 TAGAATAGAGGTTAAAAACATGG - Intergenic
917988024 1:180341002-180341024 GAGATTAGTGGTTATAAACATGG + Intronic
923592775 1:235334595-235334617 TAGATTAGTGGTTAGGAACAGGG - Intronic
1063555685 10:7077205-7077227 TAGATCAAGAGTTATAAACTTGG - Intergenic
1065859467 10:29859384-29859406 TAGAGTAGTGGGTACAAACATGG + Intergenic
1068404417 10:56571066-56571088 TAGATTAGGTGTGACAGATTAGG - Intergenic
1070272580 10:74970941-74970963 TAGAGCAGGGATTACAAACCTGG + Intronic
1073203319 10:101753727-101753749 AAGCTTAGGGGTTAAAAACCTGG + Intergenic
1076417157 10:130300400-130300422 TAAATTAGGCGTTCCACACTTGG - Intergenic
1077903507 11:6510463-6510485 TAGAGCAGAAGTTACAAACTGGG - Intronic
1080095677 11:28403506-28403528 TAGAATAGGGGTTAATAACTTGG + Intergenic
1081094286 11:38913319-38913341 TAGAATAGGGGATAGAAACGTGG - Intergenic
1084727010 11:70948477-70948499 TAGATTAGGGCGTAGAAACCTGG - Intronic
1086775660 11:90829617-90829639 TAGTGTAGGGGTTACAAGCATGG + Intergenic
1089028908 11:115302362-115302384 TAGGTTTGGGGTTACAAACATGG - Intronic
1090167922 11:124570963-124570985 TAGATTAGGGGATTCAACATGGG - Exonic
1092719349 12:11425373-11425395 TAGAGTAGGGGCTATAAAGTAGG + Intronic
1094325259 12:29231101-29231123 CAGATTAAGAGTTCCAAACTGGG + Intronic
1099282313 12:80666386-80666408 TAGAATAGTGGTTAAAAGCTGGG + Intronic
1099829244 12:87818601-87818623 TTGAGTTGGGGTTAGAAACTAGG + Intergenic
1099851898 12:88109779-88109801 TAGATTAGAGAGTACCAACTGGG - Intronic
1101186216 12:102283430-102283452 TAGCATAGTGGTTAAAAACTTGG + Intergenic
1105567131 13:21560713-21560735 TAGATTAGGGGTTACAAACTAGG + Intronic
1107001352 13:35549186-35549208 TGAATTAAGGGTTACAAAATGGG + Intronic
1111626785 13:90798010-90798032 TAGAATTGGGATTACAAACCTGG + Intergenic
1112059165 13:95719690-95719712 TAGATTTGGTGTTATAAATTGGG + Intronic
1115509316 14:34124275-34124297 TAAATTAGGGGTAGTAAACTTGG - Intronic
1117053746 14:51889035-51889057 TAGATTAGTGGTTTCAGACTGGG + Intronic
1120349022 14:83329070-83329092 AAGAATAGGGGATACAACCTGGG + Intergenic
1120557411 14:85945746-85945768 TGGATTAGGGATTAGAAACATGG + Intergenic
1124464395 15:29923624-29923646 TAGATTAGTGGTTGCAGACTTGG + Intronic
1126556862 15:49998067-49998089 TAGATTAGGGCTAAAGAACTAGG - Intronic
1126655123 15:50968810-50968832 TAGAGATGGGGTTTCAAACTTGG + Intronic
1130977365 15:88787840-88787862 TAGATTTGGGGGACCAAACTTGG + Intergenic
1131567155 15:93496691-93496713 TAGATCAGGGGTTCTCAACTAGG + Intergenic
1132918230 16:2366659-2366681 GAGATTTGGGGTTAGAATCTGGG + Intergenic
1134420622 16:14084628-14084650 TAGAATATGACTTACAAACTTGG + Intronic
1134860019 16:17552767-17552789 TAGCTTTGTGGTTACAAACATGG - Intergenic
1135234627 16:20743609-20743631 TAGATCTGGGGTTAGAACCTAGG - Intronic
1138874357 16:60931106-60931128 TAGATTCAGTGTTACAAAGTGGG + Intergenic
1140187909 16:72790744-72790766 TAGATTATGAGTTCTAAACTTGG + Intronic
1140236445 16:73163371-73163393 CAGATTAGGGGCTACAAGCTGGG + Intergenic
1140633108 16:76878754-76878776 AAGATTAGTGGTTACAAGCAAGG + Intergenic
1141157689 16:81608773-81608795 TAGATGAGGGGTTTCAGACTCGG - Intronic
1155882393 18:31165589-31165611 TAGTTAAGGGGTTACATACTGGG + Intergenic
1156413336 18:36858552-36858574 TAGGTTAAGGGTTAAAAACCAGG - Intronic
1159306443 18:66649406-66649428 TAGGTTAGGGGTCACATACAAGG - Intergenic
1159664468 18:71141331-71141353 TAGCTTAGTGGTTAAGAACTTGG - Intergenic
1159935317 18:74361113-74361135 TGGTTTATGTGTTACAAACTGGG + Intergenic
1163782027 19:19255577-19255599 TAGATAAGATGTTACAAGCTTGG - Intergenic
1164636890 19:29797919-29797941 TTGATTAGGGTTTGCAAAATGGG - Intergenic
1165644779 19:37425983-37426005 TAGATTTGGGCATACATACTAGG + Intronic
1166550401 19:43662127-43662149 TAGATGAGGGGAAACCAACTTGG - Intronic
929659894 2:43773854-43773876 ATGATAAGGGGTTACAAACCTGG - Intergenic
932701002 2:73991569-73991591 TAGATCAGGGGTTCCACATTGGG + Intronic
932701195 2:73993046-73993068 TAGATCAGGGGTTCCACATTGGG + Intronic
939858836 2:147393498-147393520 TAGTGTAGGGGTTAGAAATTAGG + Intergenic
939989544 2:148864521-148864543 TAGGTTTGGGGCTGCAAACTTGG + Intergenic
940296860 2:152135528-152135550 TAAATTAGTTGTTACAAAATTGG + Exonic
940983400 2:160027454-160027476 TAGAATATGGGGTACAAGCTGGG - Intronic
943474346 2:188336111-188336133 TAGATTGGGGGGCACAGACTTGG + Intronic
943869179 2:192971905-192971927 TAGGTTAGGGGTTAGTGACTTGG + Intergenic
944934017 2:204548488-204548510 TAGATTTGGGTTTAGAAACCAGG + Intronic
1171539789 20:25939703-25939725 TAGATTTGGAGTTGCAAACACGG - Intergenic
1174857540 20:54060827-54060849 AAGATTAGGAGATACAAAATTGG - Intronic
1176947656 21:15003228-15003250 TAGTTAAGGGGCTGCAAACTAGG + Intronic
1177282469 21:19000004-19000026 TAGACTACGTGTTAAAAACTAGG + Intergenic
1177851628 21:26355636-26355658 TAGATTAGAGATTACAAATTGGG - Intergenic
1183823262 22:40364362-40364384 AACATGAGGGGTTACAAACCTGG - Exonic
949180874 3:1130109-1130131 TTGATTAGGGGTAATAAGCTTGG + Intronic
952155845 3:30642531-30642553 TAGATTGGTGGTTATCAACTTGG - Intronic
952625813 3:35402040-35402062 TAGATTGAGGGTTACTGACTAGG + Intergenic
958710779 3:97714576-97714598 TTGATTTGGGAATACAAACTAGG + Intronic
959768547 3:110064202-110064224 TAGATTAGGGGTAGTAAGCTGGG - Intergenic
964537027 3:157734052-157734074 TAGATTCGGACTTACAAAGTTGG + Intergenic
965134777 3:164749196-164749218 TTGATTTGGGTTTACAAAATAGG - Intergenic
965361710 3:167748691-167748713 TAGCTCAGGGATTACAAAATAGG + Intronic
967760554 3:193220405-193220427 TAGATTAGATGTTAAAACCTGGG + Intergenic
972703445 4:41516430-41516452 TAGATTTGGGATTATAAACTTGG - Intronic
976754880 4:88487498-88487520 TTGATTAGGTGTAACAGACTTGG + Intronic
978291519 4:107147163-107147185 TGATTTAGGGGTTAAAAACTTGG - Intronic
978424824 4:108571338-108571360 TAGGTTAGAGTTTTCAAACTTGG - Intergenic
980531279 4:134059118-134059140 TGGATTTGGGGTGACAAAATAGG - Intergenic
983260555 4:165451887-165451909 TGGCTTAGGGGAGACAAACTTGG - Intronic
984473313 4:180204638-180204660 GAGGTTCGGGGTTACAAAGTGGG - Intergenic
988730288 5:33965896-33965918 TAGGTCAGGGGTTCTAAACTAGG - Intronic
990007279 5:50958470-50958492 TAGCTTTGGAGTTATAAACTGGG - Intergenic
990829728 5:59942833-59942855 TAGAATAGTGGTTCCTAACTGGG + Intronic
992706170 5:79395482-79395504 TAGATTAGTGGTCATCAACTTGG - Intronic
993060805 5:83036563-83036585 GAGATTAAGGGTGAAAAACTAGG - Intergenic
993933124 5:93967564-93967586 TAGCTTAAGAGTTAAAAACTAGG + Intronic
994220030 5:97184592-97184614 TAGGTTAAAGGTTACAAACATGG - Intergenic
995206831 5:109489269-109489291 TAGATGAGGTGTAAGAAACTTGG - Intergenic
995332925 5:110965772-110965794 TTGATTTGTGGTTAAAAACTTGG - Intergenic
995558646 5:113357003-113357025 TAGAATAGTGGTTAAGAACTGGG + Intronic
995575996 5:113534922-113534944 TAGATTAAGTTTTATAAACTTGG + Intronic
995885943 5:116894142-116894164 TAGATTAGTGGTTAAAAAAGGGG - Intergenic
996508333 5:124291882-124291904 CAGAGTAGGGGTCACAAACCTGG - Intergenic
999040907 5:148410715-148410737 TAGATGAAGGGTTTCAAACTGGG - Exonic
999678883 5:154036734-154036756 TAGAGTAGTGGTCACAAACTGGG + Intronic
999854363 5:155577716-155577738 TAAATTAGTGGTTATCAACTGGG - Intergenic
1001654008 5:173335633-173335655 TAGATTAGGTGTTGCATCCTGGG + Intergenic
1004252644 6:14034668-14034690 TATATTAGGGGTTTTAAACAGGG + Intergenic
1005028691 6:21489424-21489446 TAGATTTGGAGTTCCAATCTGGG + Intergenic
1007875822 6:45099413-45099435 TGGAATAGAGGTTATAAACTTGG - Intronic
1008137884 6:47797814-47797836 AAGATGATGGGTAACAAACTGGG - Intronic
1010050953 6:71503826-71503848 TACATTAGTTGTTAAAAACTTGG + Intergenic
1012403827 6:98870258-98870280 TGGAATAGGGGTCACAAATTTGG + Exonic
1013185670 6:107755801-107755823 TAGGGTAGGGATTACACACTGGG + Intronic
1013846437 6:114458458-114458480 TAAAGTAGGGATCACAAACTAGG - Intergenic
1015684505 6:135844436-135844458 TAGATAAGAGGTTATAGACTTGG + Intergenic
1021940013 7:25669850-25669872 TAGAGCAGGGGTTATTAACTTGG + Intergenic
1022010455 7:26304118-26304140 CAGATTAGGGCTTGGAAACTTGG + Intronic
1022671923 7:32463739-32463761 TACAGTAGGGGTGAGAAACTGGG - Intergenic
1023990234 7:45124345-45124367 TAGGTCAGGGGTTCCAAACATGG - Intergenic
1029680365 7:102104555-102104577 TAGATTTGGGGTTACAACCTGGG - Intronic
1041247315 8:55901223-55901245 TAGAATAGCAGTTACAAAATGGG + Intronic
1041974313 8:63779542-63779564 TAGATTTGGGGTAACCACCTTGG - Intergenic
1050073677 9:1841867-1841889 TAGAGTCAGGGTTAGAAACTAGG - Intergenic
1050669099 9:7976296-7976318 TAGATGAGTGGTTTCAAACTGGG - Intergenic
1051357045 9:16249128-16249150 TAGATTAGCGGTTACAAGGAGGG + Intronic
1052157588 9:25213333-25213355 TATATAAGGAATTACAAACTTGG + Intergenic
1054165272 9:61719744-61719766 TAGATTTGGAGTTGCAAACATGG + Intergenic
1056370317 9:85947556-85947578 TAGATTAGTGGTTCTCAACTGGG + Intronic
1058089154 9:100784432-100784454 TTCATTAGGGTTTACAAAATGGG + Intergenic
1186185141 X:7013564-7013586 TAGATTAGAGCTTACATACCAGG - Intergenic
1187863330 X:23702123-23702145 TACATTAGTGTTCACAAACTTGG - Intergenic
1188036640 X:25325335-25325357 TAGAATAGGGATTACAAACCAGG - Intergenic
1189170484 X:38904960-38904982 TAGAGTAGGGGTTTTAACCTAGG - Intergenic
1192582854 X:72299319-72299341 GAGATTAGGGGTGGCAAGCTGGG + Intronic
1193087542 X:77460573-77460595 TAGACCAGAGGTTCCAAACTTGG + Intergenic
1195551835 X:106180303-106180325 TATAATAAGGGCTACAAACTGGG + Intronic
1198140760 X:133800372-133800394 GATATTAGAGATTACAAACTAGG + Intronic
1198628922 X:138613051-138613073 TAGGTGAGGGGTGACAGACTCGG + Intergenic
1200875719 Y:8152630-8152652 TTGAGTAGGGATTACAACCTTGG - Intergenic
1202102679 Y:21327106-21327128 TTGAGTAGGGATTACAACCTTGG - Intergenic
1202188969 Y:22221329-22221351 TTGAGTAGGGATTACAACCTTGG - Intergenic