ID: 1105567132

View in Genome Browser
Species Human (GRCh38)
Location 13:21560721-21560743
Sequence GGGTTACAAACTAGGTCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105567125_1105567132 19 Left 1105567125 13:21560679-21560701 CCCCATTGGGATTATTGCAATTA 0: 1
1: 0
2: 1
3: 22
4: 180
Right 1105567132 13:21560721-21560743 GGGTTACAAACTAGGTCAACAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1105567124_1105567132 23 Left 1105567124 13:21560675-21560697 CCTACCCCATTGGGATTATTGCA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1105567132 13:21560721-21560743 GGGTTACAAACTAGGTCAACAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1105567127_1105567132 17 Left 1105567127 13:21560681-21560703 CCATTGGGATTATTGCAATTACA 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1105567132 13:21560721-21560743 GGGTTACAAACTAGGTCAACAGG 0: 1
1: 0
2: 1
3: 4
4: 55
1105567126_1105567132 18 Left 1105567126 13:21560680-21560702 CCCATTGGGATTATTGCAATTAC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1105567132 13:21560721-21560743 GGGTTACAAACTAGGTCAACAGG 0: 1
1: 0
2: 1
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105567132 Original CRISPR GGGTTACAAACTAGGTCAAC AGG Intronic
907728912 1:57047064-57047086 GGATGATAAACTAGGTCACCTGG + Intronic
910456035 1:87398218-87398240 GGGCAACAAAATATGTCAACTGG - Intergenic
911675608 1:100655214-100655236 GGATTTCAAACTTGGGCAACAGG + Intergenic
912936020 1:114004264-114004286 GGGTTACAAACTAACTGACCAGG - Intergenic
916084674 1:161259577-161259599 TTGTTACAAACTAGGTCTTCCGG + Intronic
918152520 1:181810133-181810155 GGGTTACAAGCTAAGTAACCTGG - Intergenic
921262791 1:213398534-213398556 GGGTCACAACCTAGGTGAAAAGG - Intergenic
922682956 1:227616152-227616174 GGGTAAGAAAATAGGTAAACAGG - Intronic
1063300061 10:4843158-4843180 GGGTTACAGACTATGTCGTCAGG - Intronic
1077451872 11:2653293-2653315 AGGTTACAAAATAGCTAAACTGG - Intronic
1077647613 11:3939672-3939694 AGATTACACACTAGATCAACTGG + Intronic
1078596378 11:12690355-12690377 GGGTCCCAAACCAGATCAACAGG + Intronic
1082740168 11:56902077-56902099 GGGTTTGAAACTAGGACAGCTGG - Intergenic
1086337601 11:85814249-85814271 GGGCTACAAGTTAGGTCATCTGG - Intergenic
1091555467 12:1570118-1570140 GGAACACAAACTAGGACAACAGG - Intronic
1105567132 13:21560721-21560743 GGGTTACAAACTAGGTCAACAGG + Intronic
1107752585 13:43584894-43584916 GGGTAACAAACTGGGACAGCTGG - Intronic
1107801415 13:44111209-44111231 GGGTTATAAACTCAGGCAACTGG + Intergenic
1115696418 14:35904026-35904048 GGTTTTTAAACTAGGTTAACGGG + Intronic
1125582157 15:40793875-40793897 AGGTCACAAACTAGGTCATGGGG + Intronic
1134572224 16:15300843-15300865 GAGTCTCAAACTAGGCCAACAGG - Intergenic
1134730157 16:16455205-16455227 GAGTCTCAAACTAGGCCAACAGG + Intergenic
1134937274 16:18256694-18256716 GAGTCTCAAACTAGGCCAACAGG - Intergenic
1134937340 16:18257344-18257366 GAGTCTCAAACTAGGCCAACAGG - Intergenic
1135945009 16:26857881-26857903 GGGATAAAAACTAAGCCAACAGG + Intergenic
1156345335 18:36252202-36252224 GGATTACAAACTAGTTCCTCTGG - Intronic
1157431683 18:47633284-47633306 GGGTTATAAACTATACCAACTGG - Intergenic
1159467624 18:68804936-68804958 GAGGTACAAACTAGTTAAACAGG + Intronic
1159757681 18:72386113-72386135 GGCTTACAAACAAAGTTAACAGG - Intergenic
1160311201 18:77792027-77792049 GGGTTAAAAAGCAGGTAAACAGG + Intergenic
925316329 2:2928713-2928735 TTCTTACAAAGTAGGTCAACTGG + Intergenic
928296385 2:30087594-30087616 GAGACACAAACTAAGTCAACAGG + Intergenic
929511004 2:42566056-42566078 GGGTTACAAAATATGACTACTGG - Intronic
937323150 2:120972938-120972960 GGCTTACTTACCAGGTCAACAGG - Intronic
940634702 2:156284525-156284547 GGGCTACAATCTAGATCACCAGG - Intergenic
941428016 2:165373785-165373807 TGGCTAAAAAGTAGGTCAACTGG + Intronic
1171230094 20:23477295-23477317 GGATTAAAAACTAGGTCAGCAGG - Intergenic
1175071008 20:56333745-56333767 GGGTTTGAAACCAGGTCATCTGG - Intergenic
1181257163 22:21570231-21570253 AGATTCCAAACTGGGTCAACTGG - Intronic
949814886 3:8048119-8048141 GGATTACATACCAGGGCAACAGG - Intergenic
957783784 3:84853223-84853245 GGGCTATAAACTATGCCAACTGG + Intergenic
967894189 3:194383582-194383604 GGGTTACACATTAGGTCAACAGG + Intergenic
969381994 4:6807605-6807627 GGGCTATAAACTATGTAAACCGG - Intronic
976970131 4:91093826-91093848 GGGTTACAAAGGGGGGCAACTGG - Intronic
982599797 4:157433239-157433261 GTGTTAAAAACCATGTCAACAGG + Intergenic
996590880 5:125146811-125146833 GGGTTACGAACTAGGAGAGCTGG - Intergenic
999770652 5:154773232-154773254 GGGTTACAAACTATGGCTAGGGG + Intronic
1016055559 6:139574531-139574553 TGGGTGCAAACTAGCTCAACAGG - Intergenic
1033779557 7:144652248-144652270 GGGTAACAAACTAGGGCAAAGGG + Intronic
1034366934 7:150558856-150558878 GGGCCAAAAACTAGGTCAAAAGG + Intergenic
1041322455 8:56627596-56627618 TTGTTACAAACAAGGTCAAAAGG + Intergenic
1046492491 8:114970662-114970684 GGGTGACAAACTATGTTATCAGG + Intergenic
1047871842 8:129091633-129091655 GTGTTACAAAGTAGCTAAACGGG - Intergenic
1058945335 9:109850448-109850470 GGGTGATAAACTAGGTCAAAAGG - Intronic
1059063587 9:111059178-111059200 GGGTTTCAAAATAGGTCATCAGG - Intergenic
1061177392 9:129006013-129006035 GGGTAAAAAACTAAGACAACAGG - Intronic
1186218973 X:7328994-7329016 TGGTTTAAAACCAGGTCAACTGG - Intronic
1190272969 X:48880955-48880977 GGGTCACAAAGTAAGTCAAAAGG + Intergenic
1191088933 X:56599249-56599271 GGGTCACAAACTAGGGATACAGG + Intergenic
1191895953 X:65993782-65993804 GGGGTACAAAATAGATTAACTGG - Intergenic
1193848237 X:86501813-86501835 GGGTTACCAATTAGCACAACAGG - Intronic