ID: 1105567135

View in Genome Browser
Species Human (GRCh38)
Location 13:21560749-21560771
Sequence TTATGCTTGTAGAAATGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105567135 Original CRISPR TTATGCTTGTAGAAATGTCT AGG Intronic
904918539 1:33987688-33987710 TGCTCCTGGTAGAAATGTCTAGG - Intronic
907591490 1:55676486-55676508 TTTTGCTTGTTGAATTGTTTAGG + Intergenic
909844834 1:80379845-80379867 GTATGCTAGTAGAAATGCTTCGG - Intergenic
910586739 1:88889104-88889126 TTATGCTTTAACAAATGTATAGG - Intronic
911993185 1:104728945-104728967 TTTTATTTGTAGAAATGTATGGG + Intergenic
915785209 1:158603343-158603365 TTTTGTTTGTACAAATGTATAGG - Intergenic
916841116 1:168601965-168601987 TTTTGCTTTTGAAAATGTCTGGG - Intergenic
918403500 1:184188914-184188936 TTATGCATGTTAAAATTTCTAGG + Intergenic
920221445 1:204405509-204405531 TTTTTCTTGTAAAAATGACTTGG - Exonic
922113518 1:222586784-222586806 TTATGCTGGTAGATATCTTTTGG - Intronic
922633492 1:227139331-227139353 TTATGTTTATAAAAATGTGTGGG - Intronic
923059660 1:230459313-230459335 TTACACTTGTAGCAGTGTCTGGG - Intergenic
1066958719 10:42199840-42199862 TTATGCCAGTAGAAATATATTGG - Intergenic
1067195962 10:44118060-44118082 TTTTGCTAGTATAACTGTCTAGG - Intergenic
1068406960 10:56602749-56602771 TTATGGTTGTATAGATGTGTAGG + Intergenic
1068448021 10:57147947-57147969 GCATTCTTGTAGACATGTCTGGG - Intergenic
1072460722 10:95616367-95616389 GTCTGCTTGTAGTAGTGTCTTGG + Intronic
1073569354 10:104563423-104563445 TTAGGCTTTTAGAAAAGGCTGGG - Intergenic
1073624618 10:105084364-105084386 TTAAACTTGTGGAAATGTTTGGG - Intronic
1073718157 10:106132937-106132959 TAATCCTTGTAGAAAGGTTTTGG - Intergenic
1075826390 10:125360173-125360195 TTATGTAGGTAGAAATGTTTTGG - Intergenic
1078488335 11:11744728-11744750 CTTTTCTTGTATAAATGTCTAGG - Intergenic
1081316154 11:41632883-41632905 TTATGAATGTAGAAATGTATGGG + Intergenic
1081359953 11:42163326-42163348 TTATGCTTGTAAAAATTCATGGG - Intergenic
1082680659 11:56164567-56164589 AGATGCTTGCAGAAATGTCAAGG - Intergenic
1083018958 11:59486575-59486597 GGATGCTTATAGAAATGTCATGG + Intergenic
1084454508 11:69260282-69260304 ATATACTTGGAGAAATGACTGGG + Intergenic
1086036660 11:82424155-82424177 TTCTGGTTCTAGAAATGTCAAGG + Intergenic
1086720031 11:90108641-90108663 TTATGCCAGTAGAAATATATTGG + Intergenic
1086932925 11:92712717-92712739 TTATGCCTTTGGAAATATCTGGG - Intronic
1087393914 11:97572514-97572536 TTAGGCTTGTAGAATTCTTTGGG - Intergenic
1087725381 11:101709628-101709650 TATTGCTAGTAGAAATCTCTAGG - Intronic
1088375825 11:109140754-109140776 TTTTGTATCTAGAAATGTCTGGG + Intergenic
1090516287 11:127431273-127431295 TTTTGCTTGTTGAATTGTGTAGG + Intergenic
1090632595 11:128663106-128663128 ATGTGCTTGTAAAAAGGTCTGGG - Intergenic
1091926279 12:4353256-4353278 TTATGATTGCAGAATGGTCTGGG + Exonic
1092642224 12:10526444-10526466 TCATGCTTGTTGTAATCTCTTGG - Intergenic
1092864532 12:12748503-12748525 TAATGCTTGTGGATATTTCTGGG + Intronic
1093556426 12:20480554-20480576 TTATTATTGAAGAAATGCCTAGG + Intronic
1098125633 12:67289970-67289992 TTATGCTTGAAAAAATGCATTGG + Intronic
1098775424 12:74608187-74608209 TTCTACTTTAAGAAATGTCTTGG - Intergenic
1100699817 12:97135392-97135414 TTATGCTTGAAAAAATAACTAGG - Intergenic
1101745720 12:107539960-107539982 TGATGCTTTTAAAAATTTCTTGG + Intronic
1105567135 13:21560749-21560771 TTATGCTTGTAGAAATGTCTAGG + Intronic
1105802493 13:23920253-23920275 TTTTGCTTGTTGAATTGTTTAGG - Intergenic
1106851101 13:33793490-33793512 TAATGCTTAGACAAATGTCTAGG + Intergenic
1106889470 13:34227772-34227794 TAATGCTTGAACAAATATCTGGG - Intergenic
1107296795 13:38917576-38917598 TTTTGCTTGTTGAATTGTTTAGG + Intergenic
1110433969 13:75458696-75458718 TTATACTTGTAGAAATGTTTAGG - Intronic
1110960414 13:81615445-81615467 TTAGTCTTTTAGAAATTTCTGGG - Intergenic
1111369646 13:87300185-87300207 TAATGCTTGAGCAAATGTCTGGG + Intergenic
1112203013 13:97296267-97296289 ATATTGTTGTACAAATGTCTTGG - Intronic
1116371400 14:44137765-44137787 TAATGTTTGATGAAATGTCTGGG + Intergenic
1116529355 14:45948692-45948714 TGATCCTTGAAGAAATGTATGGG - Intergenic
1117234120 14:53753292-53753314 TGATGCTTGTAGATATTTGTCGG - Intergenic
1118752156 14:68815332-68815354 TTATTTTAGTAGAAATGTCAGGG - Intergenic
1119304100 14:73593028-73593050 TGATGCCTGTAGAAATCTGTAGG - Intronic
1119379827 14:74221507-74221529 TTATGTTTGTAGAAGGGCCTGGG + Intergenic
1119453796 14:74736647-74736669 TTATAATTGTATAAATGTATGGG - Exonic
1120045132 14:79797275-79797297 TTATGCATGTAGTCATATCTTGG + Intronic
1120259417 14:82162910-82162932 TTATCCTTTTAGAAATGGATTGG + Intergenic
1120651921 14:87144629-87144651 TTATGTTTATAGAAATGAATCGG - Intergenic
1123126483 14:105950163-105950185 TGATGCTTATAGTGATGTCTGGG - Intergenic
1123406997 15:20026268-20026290 TGATGCTTATAGTGATGTCTGGG - Intergenic
1123516328 15:21032924-21032946 TGATGCTTATAGTGATGTCTGGG - Intergenic
1123635244 15:22300284-22300306 CTATGCATGTAGAGATGCCTGGG + Intergenic
1125116956 15:36105493-36105515 TTATTCTTTTAGGCATGTCTTGG - Intergenic
1126597953 15:50400515-50400537 TTATACTTTTAGTAATGTTTGGG + Intergenic
1128444837 15:67749865-67749887 TTTTGCTTGAGGAAGTGTCTGGG + Intronic
1131307734 15:91260113-91260135 TTATCCTTGTAAGAATGGCTGGG + Intronic
1131701485 15:94941638-94941660 TAATGCTTGATCAAATGTCTGGG + Intergenic
1133403549 16:5505871-5505893 GTTTGCTGGTAGAAATGTCATGG - Intergenic
1133739855 16:8643009-8643031 ATATTCTAGTGGAAATGTCTGGG - Intronic
1133985298 16:10663766-10663788 TTTTGGTTGTTGAAATGGCTGGG - Intronic
1136100317 16:27990034-27990056 TTAGGCTAGTAGAAACGTCCAGG + Intronic
1137741552 16:50780947-50780969 TAATGCTTGTAGAAATGGTGCGG + Intronic
1139185071 16:64796570-64796592 TTTTACTTGTAGAAATGTATGGG - Intergenic
1139256837 16:65550693-65550715 TTATGCTTTTTGAAATGCATTGG - Intergenic
1139928145 16:70503355-70503377 TTATGTTTGTAAAGATGTCTTGG - Intronic
1141765698 16:86058532-86058554 TTTCTCTTGAAGAAATGTCTAGG - Intergenic
1142435747 16:90055907-90055929 TTCTGCTTGTAGGAAGGCCTTGG - Intergenic
1148573930 17:48694616-48694638 TTATGCATGTAGAGATTTTTTGG + Intergenic
1152011254 17:77719675-77719697 TTACACTGGAAGAAATGTCTTGG + Intergenic
1153142727 18:1993378-1993400 TTATTCTTGGATAAATATCTAGG - Intergenic
1155605548 18:27601639-27601661 TAATGCTTGACCAAATGTCTGGG - Intergenic
1156686643 18:39656909-39656931 TTATGTGTGTATAAATATCTTGG + Intergenic
1156984270 18:43330461-43330483 TTATGCTTGTAGATGTGCGTGGG + Intergenic
1159853716 18:73558958-73558980 TTATGCTAGTAAAAATATATTGG + Intergenic
1161832108 19:6613917-6613939 TTATGTATGTAGAAAATTCTAGG + Intergenic
1163201784 19:15774885-15774907 TCATGCTTGAAGAGAAGTCTTGG - Intergenic
1165205226 19:34178684-34178706 TTGTTCTTGTAGAAGTATCTTGG + Intronic
1167947464 19:53000443-53000465 TGTTGCTTCTAGAAATGTCAAGG + Intergenic
925567892 2:5276410-5276432 TAATGTTTGTTTAAATGTCTGGG + Intergenic
926321243 2:11749571-11749593 TTCTGCCTGTAGAAAGCTCTGGG + Intronic
926479542 2:13374617-13374639 CTATGCATGTAGAGATGCCTGGG + Intergenic
927282684 2:21324133-21324155 ATATGCTTGTTAAAATTTCTAGG - Intergenic
929442589 2:41976436-41976458 TAATGTTTGGACAAATGTCTGGG - Intergenic
929872057 2:45767415-45767437 TTATGCTTATCCAAAAGTCTTGG + Intronic
931157827 2:59655374-59655396 TTATGCATGGAGAGATGCCTCGG - Intergenic
932312208 2:70752741-70752763 ACATGCATGTAGAAATGTCAGGG + Intronic
932423760 2:71616163-71616185 TTAGGTTTCTAGAAATGTTTTGG + Intronic
933802284 2:85971544-85971566 TTATGCTTTTTGAAATGTATTGG + Intergenic
934464534 2:94247907-94247929 TTATGCCAGTAGAAATATATTGG + Intergenic
934639154 2:96016369-96016391 TTTTTATTTTAGAAATGTCTTGG + Intergenic
934685288 2:96316762-96316784 TTATTTTTGTAGAGATGTCAGGG + Intergenic
934794491 2:97089042-97089064 TTTTTATTTTAGAAATGTCTTGG - Intronic
934854779 2:97722878-97722900 ATCTGCTTGCAGAAATGTTTAGG - Intronic
936907601 2:117555233-117555255 TAATGATTGTAAATATGTCTGGG - Intergenic
939257258 2:139759893-139759915 GTGTGCATCTAGAAATGTCTGGG + Intergenic
940496778 2:154439588-154439610 TTATTCTTGTAGAAAATTTTAGG - Intronic
940797213 2:158092835-158092857 GTATGCTTGTTGAAATGTAAGGG + Intronic
943509678 2:188809042-188809064 ATATGCTTCCAGAACTGTCTTGG - Intergenic
944732485 2:202531426-202531448 TAATGCTTGTAAAAATGACTTGG - Intronic
946620923 2:221561722-221561744 TTTTGGTTGTAAAAATGTCAAGG + Intronic
948082053 2:235214522-235214544 CAATGCTTGTTGAAATGTCATGG - Intergenic
1169857542 20:10119487-10119509 TAATGCTTGAACAAATGTCTGGG - Intergenic
1169945624 20:10984953-10984975 TTACTCTTGCATAAATGTCTGGG - Intergenic
1175044171 20:56088529-56088551 TTATGCTTTAAGTTATGTCTCGG + Intergenic
1175089470 20:56489922-56489944 GTTTGCCTGTAGAAATGTGTGGG + Intronic
1177338718 21:19768846-19768868 TTATGCTTGTAAAAAGGGCCAGG + Intergenic
1179191309 21:39124416-39124438 TGTTGCTTGAAGAGATGTCTGGG - Intergenic
1180585690 22:16887031-16887053 TTATGCCAGTAGAAATATATTGG + Intergenic
1183030626 22:35101583-35101605 TTTTACTTGTACAAATGTATGGG + Intergenic
1183097689 22:35563138-35563160 TTATGCTTATTGAAATTTCCTGG - Intergenic
1184925025 22:47630688-47630710 TTCTTTTTGTAGAAAAGTCTGGG - Intergenic
949111289 3:264016-264038 TTAGACTTGCAGAAATGCCTTGG + Intronic
949498334 3:4654817-4654839 TTATCCTTCTAGTTATGTCTTGG + Intronic
949637553 3:5999950-5999972 ATATGCATGCAGAAATGTTTAGG + Intergenic
952383608 3:32822697-32822719 TTATGCTTTTAAAAATATTTTGG - Intronic
952936628 3:38403657-38403679 TTCTGGTTGTAGGAAAGTCTAGG + Intronic
953562672 3:44005423-44005445 TTATGACGGTAGATATGTCTGGG + Intergenic
955461873 3:59192147-59192169 TTGTGCTGGGGGAAATGTCTGGG - Intergenic
957474037 3:80701281-80701303 TTCTTCTTGTAGAAATATTTTGG - Intergenic
957518086 3:81282142-81282164 TCAAACTTTTAGAAATGTCTGGG + Intergenic
957979636 3:87492232-87492254 TGTTGTTTTTAGAAATGTCTGGG - Intergenic
960638263 3:119804907-119804929 GTGTGCTTGTTGAAATGTCTAGG - Intronic
960991570 3:123314936-123314958 TTTTGCTTGTTGAACTGGCTAGG - Intronic
962139508 3:132773417-132773439 TAATGCTTGGCCAAATGTCTGGG + Intergenic
962618632 3:137153457-137153479 TTATTCTTTTAGGCATGTCTTGG + Intergenic
963210809 3:142687717-142687739 TTATCCATGAAGTAATGTCTAGG - Intronic
963952037 3:151213338-151213360 TTTTGATTCTGGAAATGTCTAGG + Exonic
964342794 3:155725989-155726011 GTATGCATGTTAAAATGTCTAGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967603278 3:191414646-191414668 TTATGTTTGCAGACATGTTTGGG + Intergenic
970384808 4:15545622-15545644 TTCTGCTTGTAGAACTGCCTTGG - Intronic
970887085 4:20998865-20998887 TAATACTTGTTGAATTGTCTTGG - Intronic
972114779 4:35617960-35617982 TTTCGCTTGTTGAATTGTCTAGG - Intergenic
972803261 4:42500062-42500084 AGATGCTTAAAGAAATGTCTTGG + Intronic
972893633 4:43591495-43591517 TTGTAATTGTAGAAATGTGTAGG - Intergenic
973852904 4:54978396-54978418 TGATGCTTGTAGATATTTGTTGG - Intergenic
974366118 4:60951695-60951717 TTATGTTTGACCAAATGTCTGGG - Intergenic
974699534 4:65422502-65422524 TTATGCTTGTAGAATTTTGATGG + Intronic
975495627 4:75033164-75033186 TTTTGTTTGTAGAAATATCTTGG - Intronic
977245819 4:94630200-94630222 TTGTGCTTGTATAAATAACTGGG - Intronic
978152127 4:105449371-105449393 ATATGATTGTAGAAATACCTCGG - Exonic
982043270 4:151416114-151416136 TTTGGCTTGTAGAAAGTTCTAGG + Intronic
982339899 4:154285643-154285665 TTATGCTTGTAGAAAAGCTGGGG + Intronic
982402854 4:154987417-154987439 TTATGCTTGCAAAAATATGTAGG + Intergenic
982633079 4:157857052-157857074 GTAGGCTCGTAGAAATGTGTAGG - Intergenic
984113448 4:175648370-175648392 TTAAGCTTGCAGAATTGTCAGGG + Intronic
985074024 4:186195105-186195127 TTTTACTTGTTGAAAGGTCTGGG + Intronic
986646737 5:9924117-9924139 TTATGTTTGAACAAATATCTGGG - Intergenic
987509135 5:18813823-18813845 TTTTTCTTGTAGAAACTTCTGGG + Intergenic
989423924 5:41273866-41273888 TCAAGATTGTAGAAATGTTTAGG + Intergenic
990516476 5:56535258-56535280 TTAAGTTTGAAGAAAAGTCTAGG + Intronic
990836647 5:60029093-60029115 TTTTACTTGTATAAATGTATGGG + Intronic
991418197 5:66413315-66413337 TTATGTTTGAAGAAATGTCTAGG + Intergenic
992141139 5:73798419-73798441 TGATGGTTGGAGAAATGTCTTGG + Intronic
993938509 5:94031466-94031488 ATATGGTTGAAGAAATGTCTAGG + Intronic
995871418 5:116747488-116747510 TTATGCCTGTAGAAAGGTATTGG - Intergenic
995903125 5:117093175-117093197 TTATGATTATAGAAATTTCCAGG + Intergenic
997966386 5:138359912-138359934 TAATAATTGTAGCAATGTCTAGG + Intronic
1000004036 5:157166504-157166526 TTCTGCTTTTATAAATATCTGGG + Intronic
1000503096 5:162077485-162077507 TTATTCTTGATGAAATGTCTAGG + Intronic
1002334271 5:178467275-178467297 CTCTCCTTGTAGAAATGTGTGGG + Intronic
1004136875 6:12975974-12975996 ATATGCTTTTAGAAATATATGGG + Intronic
1004312710 6:14559686-14559708 TTATGGTTTTAGATCTGTCTTGG - Intergenic
1008195243 6:48511056-48511078 TTATGATTGTGCAAATGTATTGG + Intergenic
1010167033 6:72927459-72927481 TGTTGTTTGTAGAAATCTCTAGG - Intronic
1010526645 6:76907773-76907795 TTATGGTTGAAGAGATATCTGGG + Intergenic
1011176621 6:84568618-84568640 TTATAATTGTATAAATGTATGGG - Intergenic
1011697949 6:89930045-89930067 TTATGGTTGTTGGAATTTCTTGG - Exonic
1012450292 6:99347962-99347984 TTAGGTTTGGAGAAATGTATTGG - Intronic
1012454014 6:99384331-99384353 TTACAATTTTAGAAATGTCTGGG - Intronic
1012792712 6:103718247-103718269 TTATGCTTTTATAAAGTTCTTGG + Intergenic
1012960736 6:105619219-105619241 TTCTGCTTGTAGAATTCACTTGG - Intergenic
1013406203 6:109846249-109846271 TAATGCTTGAGAAAATGTCTGGG + Intergenic
1014326901 6:120009052-120009074 TTTTGCTTGTTGAATTGTTTAGG - Intergenic
1014460839 6:121693695-121693717 TCATGCTGGTAGGAAGGTCTAGG + Intergenic
1014689009 6:124538326-124538348 TTAGCTTGGTAGAAATGTCTTGG + Intronic
1015115232 6:129641232-129641254 TTTTCTTTCTAGAAATGTCTTGG + Intronic
1016310964 6:142733115-142733137 TAATGTTTGAAGAAATATCTGGG + Intergenic
1019853227 7:3580090-3580112 TTCTCCTTGTAGAGATCTCTTGG - Intronic
1020721781 7:11754309-11754331 TTATGATTGTACAAAGTTCTTGG + Intronic
1021043086 7:15887962-15887984 TTATGTTTGTATTAATGTCTCGG + Intergenic
1021304783 7:19019315-19019337 TAATGTTTGTCCAAATGTCTGGG + Intergenic
1022588474 7:31638459-31638481 TTATGTTTGTAGACTTTTCTAGG + Intronic
1025746788 7:64249536-64249558 TTTTCCTTTTAGAAATGTATGGG + Intronic
1029155289 7:98513105-98513127 TGATGCTTGACCAAATGTCTAGG - Intergenic
1035010169 7:155708570-155708592 GAATGCTTTTAGAAATGTCATGG + Intronic
1035966223 8:4195276-4195298 TTATGATTGTGGAACTGCCTGGG - Intronic
1036037638 8:5037148-5037170 GTATTCTTGTTGACATGTCTTGG + Intergenic
1036533538 8:9621114-9621136 TTATGTTTTAAGAAATGTATAGG - Intronic
1037047250 8:14322529-14322551 TTATGCTCTCAGAAATGTCCTGG + Intronic
1037074673 8:14699753-14699775 TTTTGCTTGTTGAAATTTTTAGG - Intronic
1037254962 8:16942718-16942740 TGATGCTTGTAGATATTTGTCGG - Intergenic
1037414432 8:18634121-18634143 TTTTGCTTGTTGAATTGTTTAGG + Intronic
1038553389 8:28489070-28489092 TAAAACTTGTAGAAATGTTTGGG + Intronic
1039659058 8:39443803-39443825 TTATATTTGTACAAATGTATAGG - Intergenic
1040380359 8:46865853-46865875 TTCTCCTAGAAGAAATGTCTAGG + Intergenic
1040653704 8:49479429-49479451 AAATGCATGAAGAAATGTCTGGG + Intergenic
1042497993 8:69477087-69477109 TTACGCTTTTAGATCTGTCTTGG + Intronic
1043700248 8:83278053-83278075 TTTTGCTTATTGAATTGTCTTGG + Intergenic
1044894423 8:96875555-96875577 CTATTCTTGTTGAACTGTCTGGG + Intronic
1045580456 8:103473686-103473708 TTCTGCTTATATAAAAGTCTAGG + Intergenic
1045823334 8:106367901-106367923 GTATGCTTGGGGAACTGTCTAGG + Intronic
1046335219 8:112777518-112777540 TTATCTTTGTATAAATATCTTGG - Intronic
1047363219 8:124188538-124188560 TTTTGCTTGTTGAATTGTTTAGG + Intergenic
1047827037 8:128587986-128588008 TTTTATTTGTAGAAATGTATGGG + Intergenic
1048058434 8:130892178-130892200 GTAGGCTTATAGAAATGTCTAGG - Intronic
1048545118 8:135379523-135379545 TTATTCTTGTAGACATGTAAGGG + Intergenic
1050279934 9:4039740-4039762 TTAGGGTCATAGAAATGTCTGGG + Intronic
1051280765 9:15441126-15441148 TAATGATTGTACAAATTTCTGGG + Intronic
1051507527 9:17842843-17842865 TTATCATAGTAGAAAAGTCTCGG + Intergenic
1051671520 9:19515389-19515411 TTTGGCTTGTAGGAATGTTTTGG + Exonic
1053694618 9:40624672-40624694 TTATGCCAGTAGAAATATATTGG + Intergenic
1053941605 9:43255041-43255063 TTATGCCAGTAGAAATATATTGG + Intergenic
1054270218 9:63015447-63015469 TTATGCCAGTAGAAATATATTGG - Intergenic
1054305863 9:63423895-63423917 TTATGCCAGTAGAAATATATTGG + Intergenic
1054404609 9:64747877-64747899 TTATGCCAGTAGAAATATATTGG + Intergenic
1054438232 9:65233369-65233391 TTATGCCAGTAGAAATATATTGG + Intergenic
1054492172 9:65788579-65788601 TTATGCCAGTAGAAATATATTGG - Intergenic
1054845679 9:69794982-69795004 TAATGCTTTTAAAAATGTCAAGG + Intergenic
1056230942 9:84542880-84542902 TTATGCTCATTGAAATGTGTTGG + Intergenic
1060011501 9:120046759-120046781 TAATATTTGTAGAAATGTATGGG + Intergenic
1060225497 9:121787550-121787572 TTATACTTGTATAAATGTAAGGG + Intergenic
1185745116 X:2566458-2566480 ATTTGCTTCTAGAAATTTCTGGG + Intergenic
1188606223 X:32033760-32033782 TTATGATTGTATAATTGTCAAGG + Intronic
1188919234 X:35951041-35951063 TTCTGTTTGTCGAAATGTGTGGG + Intronic
1190525244 X:51322963-51322985 TTATGTTTGCTCAAATGTCTGGG - Intergenic
1190902767 X:54694707-54694729 TTATGCATGTAGTAATTTGTGGG - Intergenic
1192023289 X:67419630-67419652 TTATATTTGTATAAATGTATGGG - Intergenic
1193383579 X:80844848-80844870 CTATGCCTGTAGAAATATCCTGG - Intergenic
1194430507 X:93798145-93798167 CTATCCATGTAGAATTGTCTTGG - Intergenic
1195724197 X:107897193-107897215 TTATACTTCTAGAAATGGCTTGG + Intronic
1195938512 X:110147317-110147339 TTATGCTTTTATATATGTGTAGG + Intronic
1195957794 X:110351471-110351493 TTTTCCTCGTGGAAATGTCTGGG - Intronic
1196069803 X:111508262-111508284 TTATGATTGAAGATATGTTTAGG - Intergenic
1196588709 X:117460535-117460557 GTATGTTTCTAGAAATGTCCAGG - Intergenic
1198676080 X:139132354-139132376 TTTTGCTTTTTAAAATGTCTAGG + Intronic
1199740479 X:150731276-150731298 TTAGATTTTTAGAAATGTCTAGG + Intronic
1200905989 Y:8483795-8483817 TTCTCCTGGAAGAAATGTCTAGG - Intergenic
1201931734 Y:19357607-19357629 TTGAGCTAGTAGAAAAGTCTTGG + Intergenic