ID: 1105573023

View in Genome Browser
Species Human (GRCh38)
Location 13:21622201-21622223
Sequence CTCAGTCAACTCTTCATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 255}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105573023_1105573034 29 Left 1105573023 13:21622201-21622223 CCAAAAATGAAGAGTTGACTGAG 0: 1
1: 0
2: 2
3: 13
4: 255
Right 1105573034 13:21622253-21622275 AGCCCGGAGGCATAAGGTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1105573023_1105573031 13 Left 1105573023 13:21622201-21622223 CCAAAAATGAAGAGTTGACTGAG 0: 1
1: 0
2: 2
3: 13
4: 255
Right 1105573031 13:21622237-21622259 GATGTGGTGAATGGGGAGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 280
1105573023_1105573032 16 Left 1105573023 13:21622201-21622223 CCAAAAATGAAGAGTTGACTGAG 0: 1
1: 0
2: 2
3: 13
4: 255
Right 1105573032 13:21622240-21622262 GTGGTGAATGGGGAGCCCGGAGG 0: 1
1: 0
2: 1
3: 29
4: 282
1105573023_1105573030 6 Left 1105573023 13:21622201-21622223 CCAAAAATGAAGAGTTGACTGAG 0: 1
1: 0
2: 2
3: 13
4: 255
Right 1105573030 13:21622230-21622252 AGCAGAGGATGTGGTGAATGGGG 0: 1
1: 0
2: 4
3: 36
4: 741
1105573023_1105573029 5 Left 1105573023 13:21622201-21622223 CCAAAAATGAAGAGTTGACTGAG 0: 1
1: 0
2: 2
3: 13
4: 255
Right 1105573029 13:21622229-21622251 GAGCAGAGGATGTGGTGAATGGG 0: 1
1: 0
2: 0
3: 22
4: 301
1105573023_1105573028 4 Left 1105573023 13:21622201-21622223 CCAAAAATGAAGAGTTGACTGAG 0: 1
1: 0
2: 2
3: 13
4: 255
Right 1105573028 13:21622228-21622250 GGAGCAGAGGATGTGGTGAATGG 0: 1
1: 1
2: 3
3: 46
4: 607
1105573023_1105573027 -3 Left 1105573023 13:21622201-21622223 CCAAAAATGAAGAGTTGACTGAG 0: 1
1: 0
2: 2
3: 13
4: 255
Right 1105573027 13:21622221-21622243 GAGGACAGGAGCAGAGGATGTGG 0: 1
1: 0
2: 10
3: 128
4: 969
1105573023_1105573026 -9 Left 1105573023 13:21622201-21622223 CCAAAAATGAAGAGTTGACTGAG 0: 1
1: 0
2: 2
3: 13
4: 255
Right 1105573026 13:21622215-21622237 TTGACTGAGGACAGGAGCAGAGG 0: 1
1: 0
2: 2
3: 62
4: 654
1105573023_1105573033 23 Left 1105573023 13:21622201-21622223 CCAAAAATGAAGAGTTGACTGAG 0: 1
1: 0
2: 2
3: 13
4: 255
Right 1105573033 13:21622247-21622269 ATGGGGAGCCCGGAGGCATAAGG 0: 1
1: 0
2: 1
3: 7
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105573023 Original CRISPR CTCAGTCAACTCTTCATTTT TGG (reversed) Intergenic
900074194 1:799263-799285 CTCAGTCACTCATTCATTTTAGG + Intergenic
903911775 1:26732224-26732246 CTCAGTCATCTCTTTTCTTTGGG - Intronic
906779927 1:48564247-48564269 CACAGTCAGCTCTGCATCTTAGG - Intronic
907728310 1:57041223-57041245 CTCATTCACTTCTTCATTCTTGG + Intronic
910652280 1:89582486-89582508 CTTAATCAGCTCTTCCTTTTAGG + Intronic
911134222 1:94422089-94422111 CTCAGTCAACACTTTGTCTTAGG + Intronic
913050599 1:115113907-115113929 CTCTGTCAACTCCTCCATTTAGG - Intergenic
913703157 1:121394067-121394089 TTCAGTAAACACTTCATTTCAGG - Intergenic
913939741 1:125089864-125089886 TTCAGTAAACACTTCATTTCAGG + Intergenic
913979329 1:143495231-143495253 TTCAGTAAACACTTCATTTCAGG - Intergenic
914043720 1:144074565-144074587 TTCAGTAAACACTTCATTTCAGG - Intergenic
914134366 1:144885926-144885948 TTCAGTAAACACTTCATTTCAGG + Intergenic
916156009 1:161849209-161849231 CTCACTCAATGCTTCATTTTAGG + Intronic
916712824 1:167427036-167427058 CACAGGCAACTTTACATTTTGGG + Exonic
918372291 1:183873051-183873073 CTAAGTCAAGTCTGCATTTTAGG + Intronic
919368939 1:196701204-196701226 CTCAGGGAACTCTTCTTGTTTGG + Intronic
920248614 1:204607037-204607059 CTCATTAAAATCTGCATTTTGGG + Intergenic
921404807 1:214766945-214766967 CTCTTTCCAATCTTCATTTTAGG + Intergenic
922270043 1:224024167-224024189 CTCAGTCACTCATTCATTTTAGG + Intergenic
923152352 1:231244806-231244828 CTCAGTCTTCTTTTCATTCTAGG - Intronic
924046648 1:240038837-240038859 CTCATTCATTTCTTTATTTTAGG - Intronic
924619042 1:245644466-245644488 TTCAGTTATCTCTTCATTATGGG + Intronic
1063359441 10:5439375-5439397 CTCTTTCAACTCTTCATCTAGGG - Intronic
1064698541 10:17992693-17992715 CTGAATAAACTCTACATTTTTGG - Intronic
1064783397 10:18867480-18867502 CTCATTAAATTCTTAATTTTGGG + Intergenic
1065178613 10:23102903-23102925 CTCAGTTAACACATGATTTTTGG - Intronic
1066240640 10:33531292-33531314 CTCACTGAAGTCTTCAGTTTGGG - Intergenic
1066780392 10:38939923-38939945 TTCAGTAAACACTTCATTTCAGG - Intergenic
1070268368 10:74926890-74926912 CTGTGTCAATCCTTCATTTTCGG + Intronic
1071536406 10:86435521-86435543 CTCAGAGAACTCTGCATTTTAGG - Exonic
1073748287 10:106494714-106494736 CCCAGACAAGTCTTTATTTTGGG - Intergenic
1074368900 10:112882926-112882948 CTCACTCATCTCTTCATTCTTGG + Intergenic
1075158086 10:119997329-119997351 CTGAGATAAATCTTCATTTTTGG + Intergenic
1075577630 10:123589989-123590011 CTAAGTTTTCTCTTCATTTTGGG + Intergenic
1080628723 11:34053011-34053033 CGCAGGGACCTCTTCATTTTGGG - Intronic
1081629235 11:44677272-44677294 CACATTCAAATCTTTATTTTAGG + Intergenic
1083486420 11:62985330-62985352 CCCAGTCAAATTTGCATTTTAGG + Intergenic
1085364768 11:75929560-75929582 CTCAGTCATATTTTTATTTTGGG + Intronic
1085642605 11:78202065-78202087 TTCAGTTATCTCTTCCTTTTTGG - Intronic
1085810632 11:79677834-79677856 CTGAGTCGACTCCTCACTTTGGG + Intergenic
1087174868 11:95087555-95087577 CTCAGTCATCTCATCCTTGTAGG - Intergenic
1087820400 11:102705192-102705214 TTCAGTTAACTTTTTATTTTTGG - Intronic
1090088183 11:123669871-123669893 CTCAGCCAGCTCTTCTTTTGTGG - Intergenic
1091062074 11:132473107-132473129 ATCAGTCAACTCTTCCATTAAGG + Intronic
1092847069 12:12593535-12593557 TTCAGTCAAAAGTTCATTTTGGG + Intergenic
1092863422 12:12739653-12739675 CCTAGTGAACTTTTCATTTTAGG + Intronic
1093573186 12:20693179-20693201 CTCTCTCAAATCTTCATTTCTGG - Intergenic
1093930983 12:24954977-24954999 CTCAGATAACTCTTTATTGTGGG - Intergenic
1095459939 12:42432811-42432833 CTTAGTGATCTCTTCATTTCTGG + Intronic
1097762474 12:63483633-63483655 CTCAGTCAACTCTTGCTCTAAGG + Intergenic
1100809978 12:98327994-98328016 TACAGTCAACTCTCTATTTTGGG - Intergenic
1101433498 12:104645793-104645815 CTCTGTCAACTCATCTTATTTGG - Intronic
1101984452 12:109434682-109434704 CCCTGCCAACTCTTGATTTTTGG - Intronic
1105573023 13:21622201-21622223 CTCAGTCAACTCTTCATTTTTGG - Intergenic
1107771406 13:43790687-43790709 CAAAGTCAACTCCTCATTCTAGG + Intergenic
1110047024 13:70843565-70843587 TTCAGTGAGCTTTTCATTTTCGG - Intergenic
1110064080 13:71080138-71080160 CTCAGTCTCCTCTTCAGTTCGGG - Intergenic
1111741855 13:92215101-92215123 CTCAGTTAAATCTCCCTTTTAGG - Intronic
1112247747 13:97749933-97749955 CCCAGCCAACTCTAAATTTTAGG - Intergenic
1112539553 13:100294539-100294561 CGGTGTCAAGTCTTCATTTTGGG - Intronic
1113903934 13:113810897-113810919 CTCACCCAACTCTTCATATTTGG - Intronic
1115014594 14:28594579-28594601 GACAGGCAAGTCTTCATTTTAGG - Intergenic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1120268837 14:82284715-82284737 TTCATTAAACTCTGCATTTTAGG - Intergenic
1120380332 14:83769852-83769874 CTCAGGCAACTCTTCCTACTAGG + Intergenic
1120417220 14:84234690-84234712 CTCAATCAAATCTGCATATTTGG + Intergenic
1120779236 14:88471295-88471317 CACATTCAATTCTTTATTTTGGG - Intronic
1122391761 14:101394024-101394046 CTCAGTATACTCTTCTTTGTAGG + Intergenic
1202936856 14_KI270725v1_random:96180-96202 TTCAGTAAACACTTCATTTCAGG + Intergenic
1123393021 15:19897018-19897040 TTCAGTAAACACTTCATTTCAGG - Intergenic
1123396343 15:19941578-19941600 TTCAGTAAACACTTCATTTCAGG - Intergenic
1125101914 15:35923967-35923989 CTCATTTTACTCTTCATATTTGG - Intergenic
1130092911 15:80836208-80836230 CACACTTAACTCTTCAGTTTGGG - Intronic
1130624309 15:85497878-85497900 CTCCTTCTACTCTTTATTTTGGG - Intronic
1131658630 15:94489242-94489264 CTCAGTGAACTAGTCATTTAAGG + Intergenic
1132268682 15:100503639-100503661 CTCATTCCACTGATCATTTTGGG - Intronic
1134330070 16:13242569-13242591 GTCAGTCTTCTCTTCATTATAGG - Intergenic
1135890328 16:26351266-26351288 ATCACACAACTCTTCCTTTTAGG + Intergenic
1136188727 16:28602883-28602905 CTCACACAACTCTTCATAATGGG - Intergenic
1136698818 16:32113731-32113753 TTCAGTAAACACTTCATTTCAGG - Intergenic
1136738008 16:32480597-32480619 TTCAGTAAACACTTCATTTCAGG + Intergenic
1136768787 16:32814096-32814118 TTCAGTAAACACTTCATTTCAGG + Intergenic
1136799323 16:33057030-33057052 TTCAGTAAACACTTCATTTCAGG - Intergenic
1136901809 16:34048249-34048271 TTCAGTAAACACTTCATTTTGGG - Intergenic
1136957000 16:34799977-34799999 TTCAGTAAACACTTCATTTCAGG - Intergenic
1137734154 16:50711787-50711809 CTCAGACACCTCTTCAATTGTGG + Exonic
1138069073 16:53972711-53972733 TTCAATCAGCTCTACATTTTAGG + Intronic
1203015064 16_KI270728v1_random:348980-349002 TTCAGTAAACACTTCATTTCAGG - Intergenic
1203033399 16_KI270728v1_random:622138-622160 TTCAGTAAACACTTCATTTCAGG - Intergenic
1203071205 16_KI270728v1_random:1076204-1076226 TTCAGTAAACACTTCATTTCAGG + Intergenic
1143937590 17:10503156-10503178 CTCAGTCACCTCTTTGATTTTGG + Exonic
1143939943 17:10529982-10530004 CTCAGTCACCTCTTTGATTTTGG + Exonic
1145692969 17:26763982-26764004 TTCAGTAAACACTTCATTTCAGG - Intergenic
1145709707 17:26960599-26960621 TTCAGTAAACACTTCATTTCAGG - Intergenic
1149621121 17:58045871-58045893 CTAAGTCACCTCTTCCTCTTGGG + Intergenic
1151897499 17:76990192-76990214 CTCAGGAAACTATTCAATTTAGG + Intergenic
1153115206 18:1646520-1646542 CTCAGGCAACTCTTCCTCTGAGG + Intergenic
1156643765 18:39134965-39134987 CTAAGTCAAATTTTAATTTTGGG + Intergenic
1163050816 19:14682400-14682422 CACACTCAACTTTTCATCTTGGG + Intronic
1165103554 19:33455311-33455333 ATCAGTAAACTTTTTATTTTAGG - Intronic
1202682962 1_KI270712v1_random:26898-26920 TTCAGTAAACACTTCATTTCAGG - Intergenic
925623134 2:5814091-5814113 CTCAGCCAACTCTGCCTTCTGGG + Intergenic
926455291 2:13059980-13060002 CTCACTCACCCCTTCATTTGGGG + Intergenic
926836826 2:17032300-17032322 CAAAGTCACCTCTACATTTTCGG + Intergenic
927817241 2:26229642-26229664 TTCAGTCAAGTCATTATTTTTGG - Intronic
930516588 2:52415154-52415176 CTCTGAAAACTCTTCCTTTTAGG - Intergenic
931027520 2:58129171-58129193 ATAAGTAAACACTTCATTTTAGG + Intronic
933347352 2:81105904-81105926 CTCAGTTAAATCTTGCTTTTTGG + Intergenic
934248833 2:90328276-90328298 TTCAGTAAACACTTCATTTCAGG + Intergenic
934260746 2:91475205-91475227 TTCAGTAAACACTTCATTTCAGG - Intergenic
934304065 2:91807149-91807171 TTCAGTAAACACTTCATTTCAGG - Intergenic
934329190 2:92045601-92045623 TTCAGTAAACACTTCATTTCAGG + Intergenic
934467407 2:94275523-94275545 TTCAGTAAACACTTCATTTCAGG + Intergenic
935562873 2:104576711-104576733 CTCTGTCAACTCTTCCATGTGGG + Intergenic
935621779 2:105136306-105136328 CACAGTCCAGTTTTCATTTTCGG - Intergenic
937943202 2:127306027-127306049 CATAGGTAACTCTTCATTTTAGG - Exonic
938518551 2:132040636-132040658 TTCAGTAAACACTTCATTTCAGG + Intergenic
939071146 2:137545038-137545060 CTCAGTCACCTCTTCTTTTGAGG + Intronic
940015229 2:149097477-149097499 CTCAGTCAAATCTGAATTTCAGG - Intronic
941009220 2:160279608-160279630 TTCAATGAACTCTTTATTTTTGG + Intronic
944148592 2:196532886-196532908 CTCAGTGAACTCTTCTGTCTAGG + Intronic
947484548 2:230536208-230536230 TTCAGTTAACTTTTGATTTTTGG + Intronic
1173712800 20:45175444-45175466 CTCACTCATTTCTACATTTTTGG - Intronic
1174650816 20:52123856-52123878 CTTAGTAAACTTTTCTTTTTTGG + Intronic
1174784026 20:53416044-53416066 CGCAGTCAGCTCTGCAATTTAGG + Intronic
1175963112 20:62647008-62647030 CTCAGACAATCCTTCATTGTCGG + Intronic
1176340700 21:5692659-5692681 CTCAGCCATCTCGTCATATTGGG - Intergenic
1176472954 21:7124812-7124834 CTCAGCCATCTCGTCATATTGGG - Intergenic
1176504127 21:7631797-7631819 CTCAGCCATCTCGTCATATTGGG + Intergenic
1176586458 21:8592797-8592819 TTCAGTAAACACTTCATTTCAGG - Intergenic
1176743161 21:10625515-10625537 TTCAGTGAACACTTCATTTCAGG - Intergenic
1177210194 21:18061080-18061102 GTCAGTCATTTCTTCATTTTGGG + Intronic
1177768943 21:25493089-25493111 CTCAGTGAATTCTACACTTTAGG + Intergenic
1178220079 21:30646159-30646181 CTCACTCATCTGTTTATTTTAGG - Intergenic
1178249792 21:30991567-30991589 CTCACTCATTTCTCCATTTTTGG + Intergenic
1178297031 21:31418681-31418703 CTCAGTCTCCTTTTCATTTGAGG - Intronic
1180269266 22:10569700-10569722 TTCAGTAAACACTTCATTTCAGG - Intergenic
1184963981 22:47953478-47953500 CTCACTCAACTCTACCATTTGGG + Intergenic
1203239964 22_KI270733v1_random:7117-7139 CTCAGCCATCTCGTCATATTGGG - Intergenic
949922213 3:9011794-9011816 CTCAGCCAAGTCTCCTTTTTTGG + Intronic
951447555 3:22800452-22800474 CTCAGTCAACTCTGTCCTTTTGG - Intergenic
953066505 3:39477014-39477036 CCCAGTCAAGTCTTGGTTTTAGG + Intronic
955055982 3:55456574-55456596 CACAGTCAAGTCTTCATTCCTGG + Intergenic
957714744 3:83912111-83912133 CTGAGTGAATTCTTCTTTTTTGG + Intergenic
959316931 3:104821170-104821192 CAAAGTCACCTCTACATTTTTGG - Intergenic
959353253 3:105295299-105295321 CTCAGTCAAGTCTTGGTCTTAGG - Intergenic
959832429 3:110880595-110880617 CACAGTAAGCTCTACATTTTTGG - Intergenic
960765104 3:121118611-121118633 CTCAATCAAATCTATATTTTAGG + Intronic
961367835 3:126412624-126412646 TTCAACCAACTCTGCATTTTTGG + Intronic
962667532 3:137670135-137670157 CTCAGTCAACACTTCTCTCTTGG - Intergenic
964434618 3:156638561-156638583 CACAGACAACTCTTGAGTTTCGG - Intergenic
965119951 3:164541436-164541458 CTCAGTAAAATCTTCCTTTTTGG - Intergenic
966110854 3:176399585-176399607 TTCTGTGAACTCTTCATATTGGG + Intergenic
966820926 3:183923745-183923767 CTCAGTCAACACTTAGTTTAAGG + Intronic
969984161 4:11189859-11189881 CTCACTCATCTCTTCATTAATGG + Intergenic
970948334 4:21722214-21722236 CTAAGCCAGCTCTGCATTTTGGG + Intronic
974450438 4:62048897-62048919 CTCAGTAAACATTTCATTTTTGG - Intronic
975043715 4:69775609-69775631 CTCTGTTAACTCTTCACCTTTGG + Intronic
975525147 4:75340724-75340746 CTCAGTCAACTGTTCACTCCTGG + Intergenic
975939210 4:79621146-79621168 TTCATTCAACTCCTCATATTTGG - Intergenic
976312423 4:83625189-83625211 CTTATAAAACTCTTCATTTTAGG - Intergenic
976463774 4:85344209-85344231 CTCAGTCAAATCTTCCTTTTTGG - Intergenic
977376718 4:96214407-96214429 CTCAGCCAACACTTCATATATGG + Intergenic
977408167 4:96627280-96627302 CTCATTCAACTCAATATTTTTGG - Intergenic
977938608 4:102833953-102833975 CTCAGTCAATTCTTCCTATTCGG - Intronic
978171679 4:105679049-105679071 CTCAGTCAAAACTCCATTTGTGG + Exonic
979075512 4:116264906-116264928 CTCAGTCTCCTCTTCTTTCTGGG - Intergenic
981897527 4:149820762-149820784 TCCAGTCAGCTTTTCATTTTCGG - Intergenic
982137954 4:152290331-152290353 CAGAGTCAACTCTTGATTATTGG - Intergenic
982548634 4:156767498-156767520 CTCAGAAAACACTTTATTTTTGG + Intronic
982991341 4:162279668-162279690 CTTCTTCAACTCTACATTTTAGG - Intergenic
983041371 4:162931539-162931561 CTCTTCCAACTCTTCATTTCTGG + Intergenic
983297790 4:165888500-165888522 CTCATTCTACTCTTCCTGTTGGG + Intronic
983618582 4:169735233-169735255 CTCACCCAACTCTTTATTGTAGG - Intronic
983979043 4:173972366-173972388 AGCAGTCACCTCTTCCTTTTGGG + Intergenic
984342703 4:178478709-178478731 CACAGTCAGCTTTTCCTTTTTGG - Intergenic
984396617 4:179210053-179210075 CTCAGTCAACTCCACATTTCGGG + Intergenic
984812815 4:183809711-183809733 TTAAGTCAACTCTCCACTTTTGG + Intergenic
985017710 4:185654134-185654156 ATGAGTCAGCTCTTCATTCTCGG + Intronic
986930304 5:12810407-12810429 CTCAGCCAGCACTACATTTTAGG + Intergenic
987123527 5:14790344-14790366 CTCTTTTAATTCTTCATTTTTGG - Intronic
987535566 5:19183638-19183660 CTCATGCAACTCTTCCATTTGGG - Intergenic
991570010 5:68043861-68043883 CCTAATCAACTCTTCATTTAAGG - Intergenic
991619107 5:68526564-68526586 CTCAGTCAAATCTTGATAGTAGG - Intergenic
992621702 5:78600321-78600343 ATCAGTAAGCTCTTCAGTTTGGG + Intronic
992981075 5:82173135-82173157 CTCTCTCTAGTCTTCATTTTAGG + Intronic
993462583 5:88202164-88202186 CTCACTAAAATCTTCATTTGAGG - Intronic
993690459 5:90994020-90994042 ATTAGTGAAATCTTCATTTTGGG + Intronic
993910370 5:93675529-93675551 CTCACTCAGCCCCTCATTTTTGG + Intronic
995639910 5:114243957-114243979 CTCAGTGAATCCTTCCTTTTGGG - Intergenic
997046563 5:130326108-130326130 TTCTGTCAAATCTACATTTTAGG - Intergenic
1001891668 5:175344467-175344489 CTCAGCCAAGTCTTGATGTTCGG + Intergenic
1003000637 6:2329184-2329206 CTCAGTGACCTCTCCATTGTGGG - Intergenic
1007172664 6:39875137-39875159 TTCAGTCATCTCTTGATTATCGG - Intronic
1008501671 6:52189488-52189510 CTCAGTCAAACCTTCCTTCTTGG - Exonic
1009610215 6:65931262-65931284 CTCAGTCCCCTCTAGATTTTGGG - Intergenic
1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG + Intergenic
1010445425 6:75943816-75943838 CTCAGTGCCCTCTTCATTATGGG + Intronic
1010876189 6:81109369-81109391 CTAAGTAAACTATACATTTTGGG - Intergenic
1011047714 6:83104390-83104412 TTCAATCAACCCTTCATTTCTGG + Intronic
1012489797 6:99769610-99769632 CACATTCAACTCATCTTTTTGGG + Intergenic
1015608014 6:134980801-134980823 TTCAGTCAAGTCTTTCTTTTGGG + Intronic
1016796441 6:148122897-148122919 ATTAGTCAACTTTTCCTTTTAGG - Intergenic
1017266083 6:152448410-152448432 CCCAGTGATCTCTTCATTCTAGG + Intronic
1017866722 6:158450452-158450474 CTCATTCATTTATTCATTTTAGG + Intronic
1018446199 6:163861096-163861118 CTCTGTAAAATCTTCATTTCTGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1018972984 6:168541368-168541390 ATCAGTCAACCCTTCTTTCTCGG + Intronic
1019886583 7:3911052-3911074 CTGGGTCAGCTCTCCATTTTGGG + Intronic
1020578181 7:9960859-9960881 CTCATTCCACTCCTTATTTTAGG + Intergenic
1020837315 7:13169223-13169245 CTCAGTCACTTCCACATTTTTGG + Intergenic
1021234435 7:18124847-18124869 ATCAGTCATCTGTTCCTTTTGGG - Intronic
1021328726 7:19307853-19307875 AGCAGTCAACTCTAGATTTTAGG + Intergenic
1022154773 7:27648829-27648851 ATAACTCAACTCTTCATTATAGG + Intronic
1022851114 7:34263309-34263331 CTCAGTAGACTTTTCATTTGTGG - Intergenic
1023394924 7:39743817-39743839 CTCAGGAATGTCTTCATTTTGGG - Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1023485600 7:40682858-40682880 CTCATTCCATTCTACATTTTTGG + Intronic
1024531259 7:50394345-50394367 CTCACTCACCTTTTAATTTTAGG - Intronic
1024804635 7:53123457-53123479 TTCAGTAAACACTTCATTTCAGG + Intergenic
1024844714 7:53628966-53628988 CTGAGTCAACACTTAATTATAGG + Intergenic
1024959016 7:54955980-54956002 CTCTGCCTATTCTTCATTTTGGG + Intergenic
1025134205 7:56397052-56397074 CTCAAGCAATCCTTCATTTTTGG - Intergenic
1025481509 7:60989908-60989930 TTCAGTAAACACTTCATTTCAGG - Intergenic
1025838541 7:65121189-65121211 TTCAGTAAACACTTCATTTCAGG - Intergenic
1025878736 7:65511905-65511927 TTCAGTAAACACTTCATTTCAGG + Intergenic
1025884531 7:65574793-65574815 TTCAGTAAACACTTCATTTCAGG + Intergenic
1027573966 7:79908213-79908235 TTAAGTCCACTCTTAATTTTTGG - Intergenic
1028024378 7:85819300-85819322 TTCAGTCAACTCTTCATTCTTGG - Intergenic
1028074981 7:86501842-86501864 ATCAGTCAAGACCTCATTTTGGG - Intergenic
1030032865 7:105385591-105385613 CTCAGGCCACTCTTACTTTTGGG + Intronic
1031837127 7:126691410-126691432 CTCAGGCATCTCTGCACTTTTGG - Intronic
1032292972 7:130606612-130606634 CTGGGTCACATCTTCATTTTTGG - Intronic
1032312946 7:130805469-130805491 CTCATTTAACTCTACTTTTTTGG - Intergenic
1034903720 7:154925210-154925232 CTCAACCATCTCTTCATTCTTGG + Intergenic
1035541444 8:442215-442237 CTCAGTCACTCATTCATTTTAGG - Intronic
1037540781 8:19868497-19868519 TTCAATCAGCCCTTCATTTTTGG - Intergenic
1040510048 8:48085216-48085238 CTCACTCTACCCTTCATATTAGG - Intergenic
1041953087 8:63526070-63526092 CTCAGGAAACCCTTCAGTTTTGG - Intergenic
1042044572 8:64634805-64634827 CAGTGTCTACTCTTCATTTTTGG - Intronic
1042064037 8:64854118-64854140 ATCAGTCAAATCTGCATTTAAGG + Intergenic
1043082644 8:75785011-75785033 CCCAGTCAACTCTGCACTCTCGG - Intergenic
1044252705 8:90022693-90022715 CTCTGTCAGCTCCTCATTTTTGG + Intronic
1044518817 8:93173959-93173981 CAAAGTCAACTCCACATTTTTGG + Intergenic
1046395327 8:113633001-113633023 CTCAGCCACCTCTGGATTTTGGG - Intergenic
1047333783 8:123917215-123917237 ATCAGTCAACACTTCCTGTTTGG - Intronic
1048285687 8:133139630-133139652 CTCATTCACCTCTTGACTTTTGG - Intergenic
1048722662 8:137344433-137344455 CTCAGGCACCTCTTCCTTCTAGG - Intergenic
1051553058 9:18351716-18351738 CTCAGTCAAATCTTCTAATTAGG + Intergenic
1053943835 9:43283805-43283827 TTCAGTGAACACTTCATTTCAGG + Intergenic
1054407909 9:64777142-64777164 TTCAGTAAACACTTCATTTCAGG + Intergenic
1055928689 9:81537651-81537673 CTCAGTCAAGTTTTAACTTTTGG + Intergenic
1058637807 9:107053608-107053630 CTCAGCCAGTTCTACATTTTAGG + Intergenic
1059091969 9:111369120-111369142 TTCATTCTCCTCTTCATTTTTGG + Exonic
1061093760 9:128442266-128442288 CTCAGGAAACTCTGCAGTTTGGG - Intergenic
1203422367 Un_GL000195v1:5334-5356 CTCAGCCATCTCGTCATATTGGG + Intergenic
1203582334 Un_KI270746v1:21220-21242 TTCAGTAAACACTTCATTTCAGG - Intergenic
1203586970 Un_KI270747v1:12382-12404 TTCAGTGAACACTTCATTTCAGG + Intergenic
1186875672 X:13815266-13815288 CTAAGTAAAATCATCATTTTAGG + Intronic
1187577321 X:20571444-20571466 CTCAGTCACATTTTCAATTTGGG - Intergenic
1188383037 X:29521073-29521095 CTTAGATAACACTTCATTTTGGG - Intronic
1189765391 X:44367066-44367088 CTCAGTATCCTCTACATTTTTGG - Intergenic
1193791321 X:85818707-85818729 CTCTCTCAAGTCCTCATTTTTGG - Intergenic
1194204372 X:90994821-90994843 ATCAATCATTTCTTCATTTTAGG + Intergenic
1194317091 X:92391955-92391977 ATCATTCTCCTCTTCATTTTAGG - Intronic
1196697916 X:118634066-118634088 TTTAGTCAACTCTTTAATTTTGG + Intronic
1197950854 X:131894789-131894811 GTCAGTAAACTATACATTTTTGG + Intergenic
1200550212 Y:4570261-4570283 ATCAATCATTTCTTCATTTTAGG + Intergenic
1200625266 Y:5505272-5505294 ATCATTCTCCTCTTCATTTTAGG - Intronic
1201194953 Y:11483527-11483549 TTCAGTAAACACTTCATTTCAGG + Intergenic