ID: 1105573927

View in Genome Browser
Species Human (GRCh38)
Location 13:21631964-21631986
Sequence TTGAAGTTGTTTGTTTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 510}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105573925_1105573927 -9 Left 1105573925 13:21631950-21631972 CCTGGGGACCTAAGTTGAAGTTG 0: 1
1: 0
2: 0
3: 59
4: 234
Right 1105573927 13:21631964-21631986 TTGAAGTTGTTTGTTTCTGCTGG 0: 1
1: 0
2: 3
3: 46
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105573927 Original CRISPR TTGAAGTTGTTTGTTTCTGC TGG Intergenic
902318670 1:15643833-15643855 TCAAAGTTATGTGTTTCTGCTGG + Intronic
903584340 1:24399146-24399168 TTGTACTTCTTTGTTTATGCTGG - Intronic
905186059 1:36197621-36197643 CTGGAGTTGTTCGTTCCTGCCGG - Intergenic
905187278 1:36205526-36205548 TTAAAGTTGTTGGCATCTGCCGG - Intergenic
905375780 1:37519210-37519232 CTGGAGTTGTTTGTTTCTCCCGG - Intergenic
905693295 1:39957924-39957946 CTGAAGTTTTTTGTTCCTTCTGG - Intronic
906778957 1:48555488-48555510 TTGAAGATGTTTGTCACGGCTGG + Intronic
907122638 1:52020945-52020967 TTCAAGATGTTTCTTTCTGAAGG + Exonic
909119911 1:71589280-71589302 CTGAATTTGCTTGCTTCTGCAGG + Intronic
909359599 1:74745104-74745126 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
909516743 1:76517842-76517864 TTGTCGTTCTTTGTTTTTGCAGG + Intronic
909768960 1:79396083-79396105 CTCAAGTTGTTTTTTTCTGCTGG + Intergenic
909784518 1:79594120-79594142 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
910037548 1:82806072-82806094 TTGAAGTAGTTTATTTCTGAGGG + Intergenic
910288629 1:85579886-85579908 TTGTACTTGTTTGTTTTTGGAGG - Intergenic
910396786 1:86801813-86801835 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
910622514 1:89272678-89272700 CTGGAGTTGTTTGTTCCTCCTGG + Intronic
911982230 1:104581896-104581918 GGGAAGCTGTTTGTTTCTTCTGG + Intergenic
912074284 1:105852476-105852498 TTTTAGTTGTTTATTGCTGCAGG - Intergenic
912312712 1:108640118-108640140 CTGGAGTTGTTTGTTTCTTTTGG + Intronic
912316079 1:108668474-108668496 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
913160896 1:116145796-116145818 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
913967251 1:143386604-143386626 TTGAAGTTATTTTTATCAGCTGG + Intergenic
914061630 1:144212211-144212233 TTGAAGTTATTTTTATCAGCTGG + Intergenic
914117520 1:144754158-144754180 TTGAAGTTATTTTTATCAGCTGG - Intergenic
914321004 1:146560012-146560034 TTGCTGTTTATTGTTTCTGCTGG + Intergenic
916119685 1:161517997-161518019 TTCAAGTTGTCTCTTTCTGATGG - Exonic
916220033 1:162434201-162434223 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
916295473 1:163214412-163214434 GTGAAGGTGTTCGTTTCTGAAGG - Intronic
917008272 1:170440316-170440338 TCTAAATTGTTTGTTTCTTCTGG + Intergenic
917093851 1:171381064-171381086 CTGAAGTTGCTTGTTTCTCCCGG + Intergenic
917227456 1:172800090-172800112 TTGGGTTTGTTTGTTTCTCCCGG - Intergenic
917281599 1:173382198-173382220 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
917673986 1:177301930-177301952 TTGGGGTTGTTTGTTACAGCAGG + Intergenic
917811975 1:178667906-178667928 TTGAAGTTTTTAGTTTCTGGTGG + Intergenic
917860570 1:179139276-179139298 TTGGAGTTGTTCGTTCCTCCCGG - Intronic
918965562 1:191343420-191343442 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
921254709 1:213329044-213329066 GTGAAGACGTTTTTTTCTGCTGG + Intergenic
922997249 1:229973942-229973964 TTGAATTTGTTTGCTTCTTTGGG - Intergenic
923157084 1:231288853-231288875 CTGGAGTTGTTTGTTTCTCAGGG + Intergenic
923172455 1:231430150-231430172 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
923265912 1:232314076-232314098 CCGGAGTTGTTTGTTTCTCCGGG + Intergenic
1063148800 10:3319218-3319240 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1064694299 10:17950219-17950241 CTGGAGTTGTTTGTTCCTTCTGG + Intergenic
1064757653 10:18586487-18586509 CTGCAGTTGTTTGTTCCTCCGGG + Intronic
1064860901 10:19824188-19824210 TTGAACTTGTTTGTGTCTTCTGG + Intronic
1065590522 10:27257680-27257702 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1065981414 10:30901951-30901973 CTGGAGTTGTTAGTTTCTCCTGG + Intronic
1066097012 10:32082139-32082161 TTGAAGTTAATTGTATCTTCTGG - Intergenic
1066598351 10:37076987-37077009 TTGGAGTTGTTCGTTCCTCCCGG - Intergenic
1067154004 10:43759722-43759744 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1068462363 10:57344116-57344138 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1068754405 10:60634792-60634814 CCGGAGTTGTTTGTTTCTCCCGG - Intronic
1068863355 10:61868877-61868899 CTGGAGTTGTTTGTTTCTCCCGG - Intergenic
1069682264 10:70293663-70293685 TTGGGGTTATTTTTTTCTGCCGG - Intergenic
1070267668 10:74920030-74920052 CTGTAGTTTCTTGTTTCTGCTGG + Intronic
1070938032 10:80316379-80316401 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1071332336 10:84572340-84572362 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1071335688 10:84598696-84598718 TTGAAATTGTTTGTATCTGCGGG - Intergenic
1071681559 10:87711101-87711123 TTAAAGTATTTTGTTTCTTCTGG - Intronic
1071963623 10:90831391-90831413 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1072706343 10:97683896-97683918 TTGATGCTGTTTGTTTCTGAGGG + Intronic
1073417984 10:103400445-103400467 TTCAACTTTTTTGTTTTTGCTGG - Exonic
1073646215 10:105306996-105307018 TTGAACTTATTTGTTTTTGTTGG + Intergenic
1074317314 10:112371333-112371355 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1074571763 10:114631181-114631203 TTGAAATGATTTGTTTCTCCGGG - Intronic
1074973707 10:118564541-118564563 GAGAATTTGTTTGTCTCTGCTGG + Intergenic
1077764749 11:5145371-5145393 CTGGAGTTGTTCGTTTCTCCCGG - Intergenic
1079555278 11:21752664-21752686 CTGGAGTTGTTTGTTCCTTCCGG + Intergenic
1079980028 11:27141140-27141162 TTGTTGTTGTTTGTTTCTTATGG - Intergenic
1080068932 11:28055437-28055459 TTGAGGTTGTTTGCTTATGCTGG + Intronic
1080332007 11:31149689-31149711 CTGGAGTTGTTTGTTCCTCCTGG - Intronic
1080760494 11:35244457-35244479 TTGATATTGTTTGTTACTGCAGG + Intergenic
1081187452 11:40061863-40061885 TTCCAGTTCTTTGTTTCTTCAGG - Intergenic
1083074142 11:60019611-60019633 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1085245766 11:75099255-75099277 CTGGAGTTGTTCGTTTCTCCCGG - Intergenic
1086273482 11:85096390-85096412 CTGGAGTTGTTTGTTCCTCCCGG - Intronic
1086869842 11:92024334-92024356 TTGGATTTGTTTGTTTTTGGAGG - Intergenic
1087486209 11:98762608-98762630 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1087613237 11:100458757-100458779 TTGATGGTTTTTGTTTCTGTGGG + Intergenic
1088214975 11:107497821-107497843 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1088530955 11:110808601-110808623 TTTAAGTTCTTTATTTCTCCCGG + Intergenic
1088537664 11:110878629-110878651 TTGAAGTTTTTTTTTTTTCCTGG + Intergenic
1088937997 11:114423649-114423671 ATGAAGGTGTTTTTTTCTGGTGG + Intronic
1088980526 11:114858979-114859001 TTCTACTTGTTTGTTTCAGCTGG + Intergenic
1089111953 11:116064217-116064239 TTGTTGTTATTTGTTTCTGTTGG + Intergenic
1090328635 11:125911262-125911284 TTGGAGTTGTTTGCATCTGAAGG + Intronic
1090549228 11:127801374-127801396 TTCTAGTTGTTTATTTCAGCAGG + Intergenic
1091201373 11:133783402-133783424 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1091323827 11:134669587-134669609 TTGGAGCTATTTGTCTCTGCAGG + Intergenic
1091726507 12:2850036-2850058 TTGCTGTTGTTGGTTTATGCAGG + Intronic
1092021726 12:5208364-5208386 TTGGAGTTATTTGTTACTGCAGG + Intergenic
1092558771 12:9587056-9587078 TTGATTTTGTTTGTTCGTGCTGG - Intergenic
1092616964 12:10224742-10224764 CTGGAGTTGTTCGTTTCTCCCGG + Intergenic
1093172487 12:15875543-15875565 CTGGAGTTGTTTGTTCCTCCCGG - Intronic
1093189565 12:16058375-16058397 CTGGAGTTGTTCGTTTCTCCCGG - Intergenic
1094292418 12:28866876-28866898 ACAAAGCTGTTTGTTTCTGCTGG - Intergenic
1094718038 12:33033294-33033316 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1095108107 12:38259773-38259795 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1095497381 12:42799189-42799211 TTGAAGTTTTTTTGTTCTACAGG - Intergenic
1097081029 12:56430968-56430990 TTGGACCTTTTTGTTTCTGCAGG - Exonic
1097396926 12:59086487-59086509 TTGAAATTGATTGAATCTGCAGG - Intergenic
1097714520 12:62952524-62952546 GTGAAGGTGTTTTTCTCTGCTGG + Intergenic
1097716244 12:62969837-62969859 TTTATGTTGATTGCTTCTGCTGG - Intergenic
1097792752 12:63832224-63832246 GTGATGATGTTTGTTTTTGCAGG - Intergenic
1098842280 12:75490563-75490585 TTGTTGTTGTTTTTTTTTGCGGG - Intronic
1099107748 12:78518163-78518185 TTAAAGTTTTTAATTTCTGCTGG - Intergenic
1099412123 12:82344045-82344067 TTAAAGTTGTCTGCTTCTGAAGG + Intronic
1099690582 12:85946783-85946805 CTGGAGTTGTTTATTTCTCCCGG - Intergenic
1099699622 12:86066830-86066852 TTGAAGTTCTTTGTTGATTCTGG - Intronic
1100180478 12:92080104-92080126 ATAAAGAAGTTTGTTTCTGCTGG - Intronic
1100400913 12:94228651-94228673 TTGAATTTGTCTATTTGTGCTGG + Intronic
1100584906 12:95970521-95970543 CTGAAGTTGTTCGTTCCTCCCGG - Intergenic
1100600812 12:96110080-96110102 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1101584763 12:106075872-106075894 TTGATGTTGGTTGCTGCTGCAGG - Intronic
1102727214 12:115076304-115076326 TTGAAGTTGTTTCTTGTTTCAGG - Intergenic
1103439057 12:120949668-120949690 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1104513703 12:129404530-129404552 TTTAATCGGTTTGTTTCTGCAGG + Intronic
1105573927 13:21631964-21631986 TTGAAGTTGTTTGTTTCTGCTGG + Intergenic
1106062920 13:26312464-26312486 CTGGAGTTGTTTGTTCCTCCTGG - Intronic
1106162369 13:27212868-27212890 TTGGGGTTGTTTGTTCCTTCCGG - Intergenic
1106470266 13:30048053-30048075 TTGAAGTTGATTGTTCCTAAAGG - Intergenic
1106811120 13:33359281-33359303 CTGGAGTTGTTCGTTTCTCCCGG - Intergenic
1106899105 13:34336110-34336132 TGGAACTTGTTTGTTGCTGATGG - Intergenic
1107161949 13:37240379-37240401 TGGTAATTGTTTGCTTCTGCTGG + Intergenic
1107590268 13:41897663-41897685 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1107854002 13:44597079-44597101 TTGAGATTGTATGTTTCAGCTGG + Intergenic
1108118875 13:47161252-47161274 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1108334461 13:49425243-49425265 TTGAAATTGTCTTTTTCTTCAGG - Intronic
1108858778 13:54828622-54828644 CTGAAGTTGTTTGCTCCTCCTGG + Intergenic
1108961948 13:56245211-56245233 GTGAAGTTGGTTGTCTCTGATGG + Intergenic
1109151557 13:58854706-58854728 TTGAAGTTCCCTGTTTCTGATGG - Intergenic
1109202046 13:59441321-59441343 CTGAAGTTGTTTGTTCCTCCCGG - Intergenic
1109910030 13:68897567-68897589 TTGAAGTTGTTTACTTCAGGTGG + Intergenic
1110079217 13:71289885-71289907 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1110107970 13:71703511-71703533 TTGGTATTGTTTGTTGCTGCAGG + Intronic
1110563398 13:76933923-76933945 TTAAAGTTCTTTTTTTCTTCCGG + Intergenic
1110940114 13:81340016-81340038 CTGGAGTTGTTTGTTCCTCCAGG + Intergenic
1111138626 13:84085632-84085654 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1111462150 13:88559077-88559099 TTGAATTTGTTTATTCCTGAAGG + Intergenic
1112282543 13:98075684-98075706 CTGGAGTTGTTTGTTGCTCCTGG + Intergenic
1113592481 13:111510907-111510929 TTGAATGTGCTTGTTTCTTCTGG + Intergenic
1115012392 14:28565138-28565160 TGGAAGTTGGATGTTTCTGCTGG + Intergenic
1115340065 14:32284102-32284124 TTGAAATGCTTTGTTTCTGATGG + Intergenic
1116083204 14:40203075-40203097 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1116305304 14:43246280-43246302 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1116332360 14:43612583-43612605 TTGAAGCTGTTTCTTTGTACTGG - Intergenic
1116690392 14:48099021-48099043 TTGAAGTTTTTTGTATATTCTGG + Intergenic
1117595903 14:57326930-57326952 TTCATTTTGTTTGTTTCAGCAGG - Intergenic
1117894080 14:60461381-60461403 TGGAATTTGATTGTTTCTGTGGG + Exonic
1119574826 14:75710377-75710399 ATAAATTTTTTTGTTTCTGCTGG - Intronic
1119632729 14:76248019-76248041 TTGTAGTTGTGTTTTTCTGCTGG + Intronic
1120368675 14:83604596-83604618 ATGAAGTTTTTGGTTGCTGCTGG + Intergenic
1123784766 15:23659566-23659588 TTTTGTTTGTTTGTTTCTGCCGG - Intergenic
1124382938 15:29182852-29182874 TTGAAGATGTCTATTTCTGAGGG - Intronic
1125480138 15:40074176-40074198 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1126089169 15:45036018-45036040 CTGCAGTTGTTTGTTCCTCCCGG - Intronic
1126115519 15:45203911-45203933 TTGGATTTGTTAATTTCTGCAGG + Intergenic
1126132487 15:45355547-45355569 TTTAAGCAGTTTGTTTCTTCTGG + Intergenic
1126527425 15:49672203-49672225 TTAATTTTGTTTGTTTCTCCTGG - Intergenic
1127132499 15:55882155-55882177 TTTAAATTTTGTGTTTCTGCAGG - Intronic
1127341106 15:58045016-58045038 TTGAAGTTGTTTGTAGATTCTGG - Intronic
1128951208 15:71884375-71884397 TTGAACTTGTATCTTTCTCCAGG + Intronic
1129280198 15:74479309-74479331 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1129480068 15:75816868-75816890 TTCCCTTTGTTTGTTTCTGCTGG + Intergenic
1129859313 15:78847825-78847847 CTGGAGTTGTTTGTTCCTCCCGG - Intronic
1130162452 15:81414836-81414858 CTGGAGTTGTTTGTTCCTTCCGG - Intergenic
1131198389 15:90375573-90375595 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1131250405 15:90826572-90826594 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1131845947 15:96491192-96491214 CTGCAGTTGTTTGTTCCTCCCGG + Intergenic
1132098724 15:99007601-99007623 TTGGAGTTATTCGTTTCTCCCGG + Intronic
1132219077 15:100091498-100091520 TTGAAGTTCCTTCTTACTGCTGG - Intronic
1133352018 16:5107931-5107953 CTGGAGTTGTTTGTTCCTTCTGG + Intergenic
1133362503 16:5185726-5185748 CTGGAGTTGTTCGTTTCTCCCGG + Intergenic
1133984540 16:10658401-10658423 TAGAAGTTGTTTTTTACCGCTGG - Intronic
1134111946 16:11521023-11521045 TTGTGGTTGTTTTTATCTGCAGG - Intronic
1135794303 16:25426469-25426491 TTAAACTTGTTTCTTTGTGCTGG - Intergenic
1136090758 16:27918276-27918298 TGGTTGTTGTTTTTTTCTGCTGG - Intronic
1136157694 16:28395390-28395412 TTCATTTTGTTTTTTTCTGCTGG - Intronic
1136205393 16:28719894-28719916 TTCATTTTGTTTTTTTCTGCTGG + Intronic
1137897521 16:52229967-52229989 TTGGAGTTGTTTGTTACTGTGGG - Intergenic
1138228447 16:55320094-55320116 TTGAAGATTTTTTTTTCGGCAGG + Intergenic
1139003109 16:62538492-62538514 TTGAAGTTGAATATTTCTGTTGG - Intergenic
1139147900 16:64344969-64344991 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1139459662 16:67111402-67111424 TTGGTGCTGTTTGTTTGTGCAGG + Intronic
1140012527 16:71150095-71150117 TTGCTGTTTATTGTTTCTGCTGG - Intronic
1140335546 16:74101588-74101610 TTGACAGTGATTGTTTCTGCAGG - Intergenic
1140462660 16:75153224-75153246 TCAAAGTTGGTTGTTTCTGGGGG - Intronic
1141437263 16:84007330-84007352 TTGTTGTTGTTTGTTTTTGATGG - Intergenic
1142947519 17:3444747-3444769 CTAAAGTTGTTTTTTTCTGGGGG + Intronic
1143283539 17:5772383-5772405 CTGAAGTTGTTTGTTCCTCCTGG - Intronic
1145358338 17:22184570-22184592 GTGAATTTGTTTGTTTCTTGGGG - Intergenic
1146311479 17:31771764-31771786 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1148095548 17:45050683-45050705 TTAAACGTGTTTGTTTTTGCAGG - Intronic
1148366024 17:47056649-47056671 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1148893486 17:50825140-50825162 TTGAAGTTGTTTGTAGTTTCTGG + Intergenic
1149719503 17:58828767-58828789 TTTTAGTTCTTTGTTTCTTCTGG + Intronic
1149962957 17:61132233-61132255 AGGAATTTGTTTTTTTCTGCTGG - Intronic
1150792382 17:68208774-68208796 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1153169561 18:2300417-2300439 TTGATGCTGTTTGTTCGTGCAGG - Intergenic
1155185639 18:23384349-23384371 TTGGAGTTTTTTTTTTCTTCTGG - Intronic
1155271784 18:24148756-24148778 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1155294875 18:24375940-24375962 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1155494778 18:26432181-26432203 TTGATGTTGATTGTTTTTACAGG + Intergenic
1155515367 18:26619437-26619459 TGTAATTTGTTTGTTTGTGCAGG + Intronic
1155824303 18:30419769-30419791 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1158109086 18:53920017-53920039 ATGTAGTTGTTAGGTTCTGCTGG + Intergenic
1158875907 18:61734412-61734434 TTGATCTTGTATTTTTCTGCTGG - Intergenic
1159714200 18:71801012-71801034 ATGAAATTGTTTTTTTCTGGGGG + Intergenic
1160254742 18:77238960-77238982 TGGCAGATGTGTGTTTCTGCAGG + Intergenic
1161131636 19:2593140-2593162 TTGAAGTTTTTAGTCTGTGCTGG - Intronic
1161960782 19:7522078-7522100 TTGAAGATGCTTGTGGCTGCTGG + Intergenic
1162814557 19:13185954-13185976 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1164270351 19:23667185-23667207 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1164411342 19:28008377-28008399 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1164498914 19:28795495-28795517 TTGAATTTGTATGTTGCTGTAGG + Intergenic
1164862783 19:31575802-31575824 TTGCAGTTGGTGCTTTCTGCCGG - Intergenic
1164993284 19:32699959-32699981 CTGGAGTTGTTTGTTCCTCCTGG + Intronic
1165267720 19:34675773-34675795 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1165909833 19:39218691-39218713 TTGAGGTCATTTGTTACTGCAGG - Intergenic
1167711769 19:51116012-51116034 TTGTTGTTGTTTGTTTGTGACGG + Intergenic
1168128952 19:54305161-54305183 TTGAGGTATTTTGTTCCTGCTGG - Intergenic
1202701037 1_KI270712v1_random:164099-164121 TTGAAGTTATTTTTATCAGCTGG + Intergenic
925098823 2:1228965-1228987 CTGGAGTTGTTTGTTCCTCCTGG + Intronic
926447848 2:12966186-12966208 TTGAATTTGTTTGTTAATTCAGG - Intergenic
926472780 2:13281980-13282002 TTGTATTTGGATGTTTCTGCTGG - Intergenic
927714884 2:25345176-25345198 TTGGAGTTGTTTGTTACTGCAGG - Intergenic
928553322 2:32396509-32396531 TTCAAGTTGTATCTATCTGCAGG + Intronic
928747473 2:34432629-34432651 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
929699687 2:44151225-44151247 TTAATGTTGTTTTTTTCTGATGG + Intergenic
930605313 2:53487243-53487265 CTGGAGTTGTTTGTTCCTTCTGG - Intergenic
930973966 2:57431767-57431789 ATGAGATTGTTTGTTTCTGGAGG + Intergenic
932082510 2:68727765-68727787 TTGTAGCTGTTGTTTTCTGCAGG - Intronic
932426714 2:71642300-71642322 GTGCAGTTGTGTGTTTCTGTGGG + Intronic
933343467 2:81051835-81051857 TTGTTGTTGTTTGTTTTTGTGGG + Intergenic
933487092 2:82937724-82937746 CTGGAGTTGTTCGTTTCTCCCGG + Intergenic
933784752 2:85829616-85829638 AGGCAGTTCTTTGTTTCTGCAGG + Intergenic
934171965 2:89547575-89547597 TTGAAGTTATTTTTATCAGCTGG + Intergenic
934282273 2:91621893-91621915 TTGAAGTTATTTTTATCAGCTGG + Intergenic
936347060 2:111683008-111683030 CTGGAGTTGTTCGTTCCTGCTGG - Intergenic
936747731 2:115599785-115599807 TTGAAGGTGTTTATTTTGGCAGG + Intronic
937168200 2:119840946-119840968 TTTAAGTTCTTTGTAGCTGCTGG + Intronic
937746775 2:125423525-125423547 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
938401178 2:130992444-130992466 CTGGAGTTGTTTGTTCCTCCCGG - Intronic
938508143 2:131908870-131908892 TAGAAGTTGTATGTGTCGGCCGG + Intergenic
938806515 2:134811223-134811245 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
939132559 2:138254384-138254406 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
939275042 2:139990051-139990073 CTGGAGTTGTTCGTTTCTCCCGG + Intergenic
939740450 2:145900011-145900033 TTCTAGTTGTTTCTTTATGCAGG + Intergenic
939972401 2:148677810-148677832 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
939972667 2:148679597-148679619 TTGATGTTGTTTGTTGTTGTAGG + Intronic
940145489 2:150541514-150541536 CTGGAGTTGTTCGTTTCTCCCGG + Intergenic
940417619 2:153440819-153440841 TTTAAGTTTTTTGTATCTTCTGG + Intergenic
940895313 2:159076126-159076148 TTGTACTTGTTTTTTTCTGTTGG + Intronic
941537875 2:166743888-166743910 TTGGAGTTGTTTGTTCCTCCTGG + Intergenic
941539863 2:166768768-166768790 TTAAATTTGTTTGTTTCTTATGG + Intergenic
941570647 2:167165506-167165528 TTGATGTTGTCTGTTGCTGGAGG + Intronic
942101721 2:172590519-172590541 CTGGAGTTGTTTGTTCCTCCTGG + Intronic
942299441 2:174547833-174547855 CTGGAGTTGTTCGTTTCTCCCGG + Intergenic
943744596 2:191448450-191448472 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
944511694 2:200472020-200472042 TTGAAAGTGGTGGTTTCTGCTGG - Intronic
944857766 2:203784865-203784887 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
945591445 2:211737136-211737158 TTGACATTGGTTGTTACTGCTGG - Intronic
946521625 2:220470812-220470834 TTTCACTTGTTTGTTTCTGATGG + Intergenic
946982004 2:225228774-225228796 CTGGAGTTGTTTGTTCCTTCTGG + Intergenic
1169437352 20:5604494-5604516 TTGAAGTTGTTTCTTGATGGTGG - Intronic
1169571274 20:6908768-6908790 TTGAAGTGGTTTGTTTCTTTTGG - Intergenic
1169720961 20:8675901-8675923 TTGATGATGTTTGTTTCCTCTGG + Intronic
1170230743 20:14044242-14044264 GTGGAGTTGTTTGTTCCTCCTGG + Intronic
1170902433 20:20478361-20478383 TTGAATTTGTTTGATTCTTTTGG - Intronic
1171082700 20:22204085-22204107 TTGCTGTTGTTTGTTTCTGAGGG + Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172379539 20:34476610-34476632 TTGAAGTTTTTTGTTACATCTGG + Intronic
1172676336 20:36675375-36675397 TTTAAGTTGTTTTTTTTTGGGGG + Intronic
1173407757 20:42781349-42781371 TTGAAGATGTGGGTGTCTGCTGG - Intronic
1173961558 20:47076555-47076577 TTAAGGATGTTTGTTTCTGATGG + Intronic
1175055467 20:56193662-56193684 TTGAAGGTGGTTGGTTTTGCAGG - Intergenic
1175211116 20:57356424-57356446 TTGAATTTTTTTGTTACTACAGG + Exonic
1175622380 20:60459261-60459283 TTGAAATTGTTTGGTTATGGTGG - Intergenic
1176318801 21:5285818-5285840 TTGAAGTTCTTTGCTTCCTCTGG - Intergenic
1177147106 21:17418571-17418593 TTGAAATTATTTGTTTTGGCTGG - Intergenic
1177318868 21:19494565-19494587 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1177591288 21:23171641-23171663 ATCTAGTTGTTTGTTTCTGAGGG + Intergenic
1177642141 21:23857283-23857305 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1178575911 21:33790860-33790882 TTGAATTTTTTTCTTTCTGAAGG + Intronic
1180753308 22:18141467-18141489 TGGGAGTTGTTTGTTCCTCCGGG - Intronic
1181375057 22:22450951-22450973 TTGAAGATGCTTCTTTCTGGAGG - Intergenic
1184757838 22:46526834-46526856 CTGAAGTTGATTGTGTGTGCAGG - Intronic
1184898501 22:47426869-47426891 CTGAAGCCGGTTGTTTCTGCGGG - Intergenic
949606397 3:5658884-5658906 CTGGAGTTGTTTGTTCCTTCTGG + Intergenic
949764425 3:7510525-7510547 TTGAATTTGTTTGTATCTAAAGG - Intronic
949779374 3:7668833-7668855 TTGAACTTGTTTCTTGCTCCAGG + Intronic
949835448 3:8264666-8264688 ATGAGGTTGTTTGTTGCAGCAGG - Intergenic
950205232 3:11074935-11074957 TGGGAGTTGTTTGTTCCTCCCGG + Intergenic
951240025 3:20276183-20276205 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
951292415 3:20889392-20889414 TTGCAGTTGATTGAATCTGCTGG + Intergenic
951734937 3:25852769-25852791 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
952345480 3:32480208-32480230 TTGAATTTGTTTGTTTGTTTTGG - Intronic
952452674 3:33446778-33446800 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
952453865 3:33454742-33454764 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
952631118 3:35468738-35468760 CTGGAGTTGTTTGTTCCTTCCGG + Intergenic
952679314 3:36073483-36073505 TTGTAGTTGTTGCTTTCTGTTGG + Intergenic
953714793 3:45307928-45307950 TTGAAGTTTTTTCCTTCTGGTGG - Intergenic
953954857 3:47223940-47223962 GTGAATTTGTGTGTTTATGCTGG + Intergenic
954482564 3:50814750-50814772 TTTTAGTTTTTTGTTTCTGCTGG + Intronic
954598600 3:51850362-51850384 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
954836418 3:53473147-53473169 TTGATGCTGTTTCTTTCTGTTGG + Intergenic
955145664 3:56316179-56316201 TTGCAGGCCTTTGTTTCTGCTGG - Intronic
955449629 3:59051816-59051838 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
955557362 3:60152411-60152433 ATTGAGTTGTTTGTTTCTCCAGG + Intronic
956036008 3:65092706-65092728 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
956615162 3:71163783-71163805 TTGAAACTGTTTGTTTTGGCTGG - Intronic
957510441 3:81181140-81181162 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
957782293 3:84834980-84835002 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
958926626 3:100164844-100164866 TTGAGGTTGTTTGTGTCTGTAGG + Intronic
959011634 3:101084428-101084450 CTGAAGTTTTTTATTTTTGCAGG - Intergenic
959322366 3:104892981-104893003 TTGCACTTGTTTGTATCTTCAGG - Intergenic
960295624 3:115940078-115940100 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
960685650 3:120290814-120290836 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
960868420 3:122226320-122226342 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
961026466 3:123562312-123562334 TTTTAGTTGATTGTTTCTGGAGG + Intronic
962363711 3:134762838-134762860 TTGTTGTTTTTTGTTTCTGTGGG - Intronic
963409526 3:144909531-144909553 CTGGAGTTGTTTGTTCCTCCGGG + Intergenic
963692810 3:148525839-148525861 CTGGAGTTGTTTGTTCCTTCCGG - Intergenic
963692822 3:148525942-148525964 CTGGAGTTGTTTGTTCCTTCCGG - Intergenic
963742769 3:149097080-149097102 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
964037703 3:152218429-152218451 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
964451972 3:156821878-156821900 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
964907795 3:161739326-161739348 TTGTAGGAGTTTGTATCTGCAGG + Intergenic
964963845 3:162464451-162464473 TTAAATTTGTTTGTTTCTTATGG + Intergenic
965837519 3:172867737-172867759 CTGGAGTTGTTCGTTCCTGCCGG - Intergenic
966839624 3:184077990-184078012 TTCACGTTGTTTTTCTCTGCAGG + Intergenic
966976643 3:185090226-185090248 TTGAAGATGTTTCTTTCTCTTGG + Intronic
968998829 4:3964091-3964113 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
969018691 4:4123819-4123841 CTGTTGTTGTTTGTTTCTGTTGG - Intergenic
969755169 4:9144542-9144564 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
969794510 4:9516355-9516377 CTGTTGTTGTTTGTTTCTGTTGG + Intergenic
970254777 4:14155895-14155917 TTGGACTTGTTTCTTTCAGCAGG - Intergenic
971564063 4:28116600-28116622 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
972128554 4:35801359-35801381 TCGGAGTTGTTTGTTCCTCCCGG + Intergenic
972822069 4:42713334-42713356 TGGAAGTTATTTGTTTCAGGAGG - Intergenic
973794849 4:54414723-54414745 TTTTATTTGTTTTTTTCTGCTGG + Intergenic
973999709 4:56499495-56499517 TTGAAGTTCTTTGTTGATTCTGG - Intronic
974127866 4:57717796-57717818 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
974630028 4:64477442-64477464 TTGAAATAGATTGTTTCTGTAGG + Intergenic
975033830 4:69657391-69657413 TTGGAGTTGTTAGTTCCTTCCGG + Intergenic
975047659 4:69825046-69825068 CTGGAGTTGTTTGTTCCTCCTGG - Intronic
975047672 4:69825149-69825171 CTGGAGTTGTTTGTTCCTCCTGG - Intronic
975290390 4:72671287-72671309 ATGGAGTTAGTTGTTTCTGCAGG - Intergenic
975298956 4:72766806-72766828 CTGGAGTTGTTCGTTTCTTCTGG - Intergenic
976565666 4:86548194-86548216 CTGGAGTTGTTTGTTCCTCCCGG - Intronic
976908418 4:90268581-90268603 GTGAAGTTGATTTTCTCTGCTGG - Intronic
976920425 4:90434490-90434512 TTGAAGTTCTTCAGTTCTGCTGG - Intronic
977408616 4:96632739-96632761 CTGGAGCTGTTTGTTTCTCCCGG - Intergenic
977411941 4:96677472-96677494 CTAAAGCTGTTAGTTTCTGCTGG + Intergenic
977655856 4:99519877-99519899 TTGAATTTGTTTCCCTCTGCTGG - Intronic
977906637 4:102484409-102484431 CTGAAGTTGTTTGTTCCTCCCGG - Intergenic
977995022 4:103491099-103491121 TTGTTGTTGTTACTTTCTGCAGG - Intergenic
978917822 4:114147795-114147817 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
979312664 4:119221971-119221993 TTGAAAGTGTTTGCTTCTTCAGG - Intronic
980398448 4:132247215-132247237 TTAAAGTTGTTTTTTCCTACGGG + Intergenic
980947000 4:139331227-139331249 CTGAAGTTGCTTGATTCTGGAGG - Intronic
981877847 4:149569787-149569809 ATGAAGTTTTCTGTTTCTGGAGG - Intergenic
982773769 4:159421521-159421543 CTGGAGTTGTTTGTTCCTTCTGG - Intergenic
983736912 4:171073127-171073149 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
983753001 4:171299278-171299300 CTGCAGTTGTTTGTTCCTCCCGG - Intergenic
983881975 4:172943018-172943040 TTGTACTTGTTTGTTTTGGCTGG - Intronic
985855603 5:2422645-2422667 TTTAAGTTATCTGTTTCTTCTGG + Intergenic
985907754 5:2854219-2854241 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
986121312 5:4838697-4838719 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
986799126 5:11241463-11241485 TTGGAGTTGATTGTGTCTCCAGG + Intronic
988081123 5:26416581-26416603 ATGAAGTAGTTTCTTTCTACAGG + Intergenic
988201610 5:28076862-28076884 CTGGAGTTGTTCGTTTCTTCCGG + Intergenic
989812739 5:45696623-45696645 TTTAAGATGTTTGTTTCTTTTGG - Intergenic
990368209 5:55090919-55090941 TTGGAGTTGTTTGTTCCTTCTGG + Intergenic
990388209 5:55289703-55289725 ATGAAGATGTTTGTTTTTCCAGG - Intronic
990942655 5:61218830-61218852 TTTGTGTTGTTTGTTTCTGCTGG + Intergenic
990970376 5:61499640-61499662 TTCAAGTTGTTTCTTTTTTCTGG - Intronic
991609225 5:68433783-68433805 TTCAAGTTGTTTGCCTCTGTTGG + Intergenic
991960236 5:72036972-72036994 TTCCAGTTGTTTGTCTCTGTAGG - Intergenic
992201354 5:74387518-74387540 TTGGAATTGTTTGTTTGTCCAGG - Intergenic
993421874 5:87713017-87713039 TTGAAATTATATGTATCTGCTGG - Intergenic
993605464 5:89985588-89985610 TTTAAGTTTTTTGGTTCTACAGG - Intergenic
994079544 5:95691876-95691898 TTGGTTTTGTTTGTTTCTGCTGG + Intronic
994183686 5:96795851-96795873 TTGTGGTTCGTTGTTTCTGCTGG - Intronic
994227185 5:97266219-97266241 ATGAATTTGTTTGTTTTTGCTGG + Intergenic
994327796 5:98469188-98469210 CTGGAGTTGTTTGTTTCTCCTGG + Intergenic
994441450 5:99810570-99810592 TAGAAGTTGTTTGTCTCTCTTGG + Intergenic
995326253 5:110893268-110893290 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
997060073 5:130490519-130490541 GTGAAGGTGTTTTTTTCTGGTGG - Intergenic
997086789 5:130809480-130809502 TTGATTTTGTTTGTTTCATCTGG + Intergenic
997573959 5:134958544-134958566 AAGAAGTTGTTCATTTCTGCTGG + Intronic
997908555 5:137845053-137845075 TTGAAGTTGTTTGTTGCTTCTGG + Intergenic
999281856 5:150371378-150371400 TTGAGGTTGTGTGTTTATGGAGG - Intronic
999467061 5:151817520-151817542 TTAAAGTTATTTATTTCTACAGG + Intergenic
999513630 5:152278490-152278512 ATGAAGTTGTGTGTTTCTCACGG - Intergenic
1000186945 5:158868095-158868117 TTTATGTTGTTTGTTTCTTGGGG - Intronic
1000550837 5:162661859-162661881 ATAAACTTGTTTGTTTCTGTTGG - Intergenic
1000551203 5:162666967-162666989 ATAAACTTGTTTGTTTCTGTTGG - Intergenic
1000903410 5:166935585-166935607 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1002757705 6:177878-177900 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1003060923 6:2861584-2861606 TTGGAGTTTTTTTTTTCTGGTGG - Intergenic
1003185195 6:3824336-3824358 TTGTTGTTGTTTTTTTCTGGAGG - Intergenic
1003312370 6:4980791-4980813 TCGAAGCTGTTTTCTTCTGCTGG + Intergenic
1003346666 6:5275102-5275124 TTTAAGTTATTTGTTTTTGCTGG + Intronic
1003770003 6:9289842-9289864 CTGGAGTTGTTCGTTTCTCCTGG + Intergenic
1003947439 6:11088332-11088354 CTGGAGTTGTTTGTTTCTCCCGG - Intergenic
1004607176 6:17205748-17205770 TTGGAGTTGTTCGTCTCTTCCGG + Intergenic
1004694507 6:18021084-18021106 CTGAAGTTTTTTCTTTCTGGCGG - Intergenic
1004719339 6:18252876-18252898 TTTGCCTTGTTTGTTTCTGCTGG - Intronic
1004919446 6:20362446-20362468 TTTCAGTTGTTTGTTACTGGAGG - Intergenic
1006033799 6:31196577-31196599 CTGGAGTTGTTTGTTTCTCCCGG - Intergenic
1006128099 6:31852999-31853021 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1006759688 6:36448943-36448965 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1008257131 6:49316936-49316958 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1009792730 6:68423712-68423734 TTGAATTTTCTTGTCTCTGCTGG + Intergenic
1010063632 6:71654419-71654441 TTGAAGTTGTGTGTTTTTAAGGG - Intergenic
1010147037 6:72682336-72682358 TTAAAGGTGTTTGTTTCTGAAGG + Intronic
1010207638 6:73337284-73337306 TTTAAGTTGTTGATTTCTGATGG + Intergenic
1011226523 6:85114144-85114166 TTGAAATGCTTTGTTTCTCCTGG - Intergenic
1011560108 6:88605626-88605648 TGGAAGTTGTTTGTGTCTGGAGG + Intergenic
1013960236 6:115890055-115890077 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1014143118 6:117966337-117966359 CTGGAGTTGTTAGTTCCTGCCGG - Intronic
1014478456 6:121904689-121904711 TTGAAGTGATTTATTTCTGATGG + Intergenic
1015008266 6:128311017-128311039 TTTAAGTTTGTTCTTTCTGCTGG - Intronic
1015198837 6:130555118-130555140 TTGAAGATGTTTTTCTCAGCTGG + Intergenic
1015538257 6:134288654-134288676 ATGAATTGTTTTGTTTCTGCTGG - Intronic
1016059974 6:139620107-139620129 TTGAAAGTTGTTGTTTCTGCCGG + Intergenic
1016817504 6:148317063-148317085 TTGAAGTTGTTTTGTGCTGTTGG - Intronic
1019944095 7:4313180-4313202 TTGGAGTTGTTCGTTTTTCCCGG + Intergenic
1019965583 7:4496170-4496192 TTGGAGTTGTTCGTTTTTCCCGG + Intergenic
1020064843 7:5179910-5179932 TTGTTGTTGCTTGTTGCTGCTGG + Intergenic
1020686336 7:11300146-11300168 CTGAAGTTCTTTGTTTCAGTGGG + Intergenic
1021347851 7:19549412-19549434 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1021761186 7:23904482-23904504 CTGAAGTTGTTTGTTCCTCCGGG + Intergenic
1021761198 7:23904584-23904606 CTGAAGTTGTTTGTTCCTCCGGG + Intergenic
1021918694 7:25461882-25461904 TGGAAATTGTTTGTTCCTTCTGG + Intergenic
1022148400 7:27571606-27571628 TTGAATATTTTTGTTTCTGTTGG + Intronic
1022510275 7:30930935-30930957 CTGATGTTGTTTTTTCCTGCTGG + Intergenic
1023098033 7:36682894-36682916 TTGATTTTGTTTTTTTCTTCTGG - Intronic
1023505717 7:40898273-40898295 CTGGAGTTGTTTGTTCCTTCTGG - Intergenic
1024335446 7:48201994-48202016 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1024595689 7:50934698-50934720 TAAAAGCTGTTTATTTCTGCTGG + Intergenic
1025067434 7:55869483-55869505 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1025114281 7:56244500-56244522 TTGAAGCTTTTTGTTGTTGCAGG - Intergenic
1026172810 7:67969327-67969349 CTGGAGTTGTTTGTTTCTCCTGG - Intergenic
1026383415 7:69821669-69821691 CTGGAGTTGTTTGTTTTTCCCGG - Intronic
1026887615 7:73962512-73962534 TTGAAGTTTTTTGTTTGTTTTGG + Intergenic
1027590599 7:80114065-80114087 TCGGAGTTGTTTGTTCCTCCCGG - Intergenic
1027677183 7:81174625-81174647 TTGGAGTTGTTTGGTTGTCCTGG + Intergenic
1027926177 7:84466743-84466765 TAGAAGTCGGTTGTTTCTACTGG + Intronic
1030420870 7:109304672-109304694 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1030943564 7:115686778-115686800 TTTAAGTTGATTGTGTCTTCAGG - Intergenic
1030957229 7:115869070-115869092 TTGAAATTTTCTGTTTCTGAGGG + Intergenic
1031115401 7:117662505-117662527 TACAAGATGTTTGGTTCTGCTGG + Intronic
1031514495 7:122685356-122685378 TTGATTTTCTTTGTTTTTGCAGG - Intronic
1032058060 7:128699275-128699297 ATGAAGTTGGTTGTTTTTGGTGG - Intergenic
1032511438 7:132475612-132475634 TTGAATCTGATTGTTTCTGAGGG - Intronic
1032561454 7:132898046-132898068 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1033065237 7:138147191-138147213 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1034288065 7:149903882-149903904 TTGTTGTTGTTTGTTGTTGCTGG + Intergenic
1034628906 7:152515418-152515440 TGGGAGTTGTTCGTTTCTCCCGG + Intergenic
1035039162 7:155914870-155914892 TTGAAGTAGATTATTTTTGCTGG + Intergenic
1035436336 7:158862917-158862939 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1035742552 8:1939164-1939186 TTGAAATTGTGTGATTCTGAAGG - Intronic
1036055166 8:5244101-5244123 TTTAAATTGTTTGTTACTGTTGG + Intergenic
1036155096 8:6334258-6334280 TTGAATCTTTTTTTTTCTGCTGG - Intergenic
1036378404 8:8219858-8219880 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1036851168 8:12202784-12202806 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1036872532 8:12445058-12445080 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1037198389 8:16220369-16220391 CTGAAGTTGTCTGTTTTTCCTGG + Intronic
1037268349 8:17095184-17095206 GTTCTGTTGTTTGTTTCTGCTGG + Intronic
1037461972 8:19120340-19120362 ATGAATTTGTTTCTTACTGCAGG - Intergenic
1037642511 8:20760206-20760228 CTGAAATTGTTTCCTTCTGCTGG + Intergenic
1039129657 8:34248570-34248592 CTGGAGGTGTTTGTTTCTCCTGG - Intergenic
1039197978 8:35053636-35053658 ATGGAGTTGTTTGTTCCTCCTGG - Intergenic
1039285025 8:36030065-36030087 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1039692230 8:39876113-39876135 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1041002878 8:53468939-53468961 CTGGAGTTGTTTGTTCCTCCTGG - Intergenic
1041176851 8:55206022-55206044 CTGGAGTTGTTTGTTCCTACCGG + Intronic
1042235440 8:66607748-66607770 TTTAAAATGTTTGTTTCAGCAGG - Intronic
1043351942 8:79372269-79372291 TTTAAGTTGTTTGTAGCTTCTGG - Intergenic
1043549997 8:81360642-81360664 TTTTAGTTATTTGTTTCTTCTGG - Intergenic
1044065965 8:87700571-87700593 TTGACATTGTTTGTTTCGGTGGG - Intergenic
1045771360 8:105743907-105743929 TTCAAATTGTATTTTTCTGCAGG + Intronic
1046948559 8:119998490-119998512 TTCAAGTTTTTTGCTTCTGGGGG + Intronic
1047144152 8:122178023-122178045 TTGAATTTGTTTGTTTTTGTGGG - Intergenic
1047365640 8:124208871-124208893 TTGTTGTAGTTTGTTTCTGATGG + Intergenic
1049086519 8:140482606-140482628 TTGTAGATTTTGGTTTCTGCCGG + Intergenic
1049827043 8:144675634-144675656 CTGGAGTTGTTCGTTCCTGCCGG + Intergenic
1051211114 9:14745489-14745511 TTGAAGTTGTTTGTATTTTCTGG + Intronic
1051558844 9:18416797-18416819 ATGAATTTGTTTATTTCTCCTGG - Intergenic
1051665965 9:19467170-19467192 TTAAACTTGTTTTTTTCGGCCGG + Intergenic
1052290135 9:26830711-26830733 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1053232769 9:36424978-36425000 TTGAAGGCTTGTGTTTCTGCAGG - Intronic
1053278698 9:36802424-36802446 TTGTTTTTGTTTGTTTCAGCTGG + Intergenic
1053548048 9:39043767-39043789 TGGAAGTTGTCTGCTTCTGGAGG + Intergenic
1053812169 9:41863804-41863826 TGGAAGTTGTCTGCTTCTGGAGG + Intergenic
1054568949 9:66789315-66789337 TTAAAGCTGTTTCTTTCGGCTGG - Intergenic
1054618426 9:67323635-67323657 TGGAAGTTGTCTGCTTCTGGAGG - Intergenic
1055763160 9:79631941-79631963 TTCAAGTTGTGTGTTACTGGAGG - Intronic
1056666633 9:88586461-88586483 GTGGAGCTTTTTGTTTCTGCTGG + Intergenic
1057907014 9:98991032-98991054 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1058216015 9:102234384-102234406 TTCTAGTTGTTTGTTTATGGTGG + Intergenic
1058307230 9:103459126-103459148 TTAAAGTTGCTTCTTTCTGGAGG - Intergenic
1058541798 9:106019401-106019423 TTCAATTTTTTTTTTTCTGCAGG - Intergenic
1058580481 9:106450982-106451004 TTGGAGTTGTTTGTTATTGCAGG + Intergenic
1059612608 9:115915556-115915578 TTAAAGTTATTTTTTTCTGCTGG + Intergenic
1059632070 9:116135485-116135507 TTTATTATGTTTGTTTCTGCTGG - Intergenic
1059891310 9:118808635-118808657 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1060613120 9:124986635-124986657 TTGGAGTTTTTTGTTACTGCTGG - Intronic
1061998863 9:134205759-134205781 TTCAATTTGTGTGTTACTGCAGG + Intergenic
1186958599 X:14710216-14710238 GGTGAGTTGTTTGTTTCTGCAGG - Intronic
1187005691 X:15230976-15230998 CTGGAGTTGTTCGTTCCTGCCGG + Intergenic
1187413059 X:19067758-19067780 TTGAAGTTCTTTGTGTATTCTGG - Intronic
1188205415 X:27350530-27350552 CTGAAGGGGTTTGTTTCTTCTGG + Intergenic
1188231578 X:27670465-27670487 ATGAAGTGGGTTGTTGCTGCAGG + Intronic
1188775990 X:34219252-34219274 TTTAATTTGTATGTTTCTGTTGG + Intergenic
1188974750 X:36659758-36659780 TTGAAATTTCATGTTTCTGCGGG - Intergenic
1189036591 X:37499977-37499999 TTTTATTTGTTTGTTTTTGCAGG + Intronic
1190725190 X:53185550-53185572 TTGCAGTGATTTATTTCTGCAGG + Intergenic
1190832271 X:54069878-54069900 TTGCAGTTTTTTATTTCTGCTGG - Exonic
1190932770 X:54963566-54963588 TTGAAGATGGTTGTTTCTACAGG - Intronic
1192737464 X:73862963-73862985 TTCAAGTTGTTTCTTTCTATTGG - Intergenic
1192869509 X:75172762-75172784 TTGGAGTTGTTTTTTCCTCCCGG + Intergenic
1192870416 X:75178679-75178701 TTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1193062389 X:77220372-77220394 CTGGAGTTATTGGTTTCTGCAGG - Intergenic
1193431189 X:81407990-81408012 TTAAAGTTGTTTGTTTATCCTGG + Intergenic
1193689779 X:84626953-84626975 TTGAATTTCTTTTTTTCTGCTGG + Intergenic
1193870818 X:86795848-86795870 CTGGAGTTGTTTGTTCCTCCCGG + Intronic
1194121061 X:89964846-89964868 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1195579934 X:106490028-106490050 CTGGAGTTGTTTGTTCCTCCTGG + Intergenic
1195850549 X:109277735-109277757 CTGGAGTTGTTTGTTCCTCCCGG + Intergenic
1196146236 X:112320327-112320349 TTGAAGCTGTTTATTTCTGAAGG + Intergenic
1197319638 X:125011485-125011507 ATGGGGTTGTTTGTTTCTTCTGG - Intergenic
1197487398 X:127070467-127070489 TTGAAATTGATTTTTTCTGTTGG + Intergenic
1197540225 X:127750352-127750374 TAGAAATTGTTTATTTCTGAGGG + Intergenic
1199082539 X:143592753-143592775 TTGGAGTTATTTGTTACTGTAGG - Intergenic
1199175722 X:144784898-144784920 CTGGAGTTGTTTGTTCCTCCCGG - Intergenic
1199674514 X:150175717-150175739 TTCAAGTTATTTATTTCTTCAGG + Intergenic
1200258376 X:154598109-154598131 TTGAACTTTATTGTCTCTGCAGG - Intergenic
1200702522 Y:6414375-6414397 CTGAAGCTGTGTGGTTCTGCAGG + Intergenic
1200702817 Y:6416711-6416733 CTGAGGTTGTGTGGTTCTGCAGG + Intergenic
1200707876 Y:6458245-6458267 CTGAAGCTGTGTGGTTCTGCAGG + Intergenic
1200876990 Y:8167162-8167184 TTGTTGTTGTTTGTTTCTTAAGG + Intergenic
1200935695 Y:8736433-8736455 CTGAAGCTGTGTGGTTCTGCAGG + Intergenic
1200937883 Y:8754258-8754280 CTGAGGCTGCTTGTTTCTGCAGG + Intergenic
1200981275 Y:9265336-9265358 CTGAGGCTGTATGTTTCTGCAGG + Intergenic
1201026236 Y:9706463-9706485 CTGAAGCTGTGTGGTTCTGCAGG - Intergenic
1201031293 Y:9747986-9748008 CTGAGGTTGTGTGGTTCTGCAGG - Intergenic
1201031589 Y:9750323-9750345 CTGAAGCTGTGTGGTTCTGCAGG - Intergenic
1201056682 Y:10000512-10000534 TTGTTGTTGTTTGTTTCTTAAGG - Intergenic
1201480090 Y:14429212-14429234 CTGGAGTTGTTCGTTTCTCCCGG - Intergenic
1201496765 Y:14597161-14597183 CTGGAGTTGTTCGTTTCTCCCGG + Intronic
1202049338 Y:20764420-20764442 TTGCATTTGTTTGTTTCTAAGGG + Intronic
1202126153 Y:21570542-21570564 CTGAAGCTGTGTGGTTCTGCAGG - Intergenic
1202180690 Y:22137366-22137388 CTGAAGCTGTGTGATTCTGCAGG + Intergenic
1202181923 Y:22147175-22147197 CTGAAGCTGTGTGGTTCTGCAGG + Intergenic
1202209437 Y:22439227-22439249 CTGAAGCTGTGTGGTTCTGCAGG - Intergenic
1202210670 Y:22449034-22449056 CTGAAGCTGTGTGATTCTGCAGG - Intergenic