ID: 1105582167

View in Genome Browser
Species Human (GRCh38)
Location 13:21708558-21708580
Sequence TGCCATCTGGAGATAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105582164_1105582167 -9 Left 1105582164 13:21708544-21708566 CCTAGCATCTGAAGTGCCATCTG 0: 1
1: 0
2: 3
3: 15
4: 150
Right 1105582167 13:21708558-21708580 TGCCATCTGGAGATAGATGAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
1105582163_1105582167 -2 Left 1105582163 13:21708537-21708559 CCATTCACCTAGCATCTGAAGTG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1105582167 13:21708558-21708580 TGCCATCTGGAGATAGATGAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
1105582161_1105582167 20 Left 1105582161 13:21708515-21708537 CCTAAACATTTCCACGATGCTGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1105582167 13:21708558-21708580 TGCCATCTGGAGATAGATGAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
1105582162_1105582167 9 Left 1105582162 13:21708526-21708548 CCACGATGCTGCCATTCACCTAG 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1105582167 13:21708558-21708580 TGCCATCTGGAGATAGATGAGGG 0: 1
1: 0
2: 1
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105582167 Original CRISPR TGCCATCTGGAGATAGATGA GGG Intergenic
901342544 1:8508374-8508396 AGAGTTCTGGAGATAGATGACGG + Intronic
908322732 1:62993756-62993778 TGCGTTCTGGAGATGGATGGTGG + Intergenic
908484701 1:64579023-64579045 TTCCATCTGGGGATAAATTAGGG + Intronic
910025292 1:82643060-82643082 GGCAGGCTGGAGATAGATGATGG - Intergenic
910289532 1:85587139-85587161 TGCCATGTGGAGAAAGAGAAAGG + Intergenic
912421517 1:109545320-109545342 TGCCATGAGGAGAGAGATCAGGG - Exonic
918521497 1:185420076-185420098 TGCCTTCTGGAGTTTGATCAAGG - Intergenic
919263636 1:195232947-195232969 TGATATCTGGAATTAGATGATGG + Intergenic
919301267 1:195769721-195769743 TGCTTTCTGGAGAGGGATGAGGG + Intergenic
921639731 1:217538525-217538547 TCCCATTTGCAGATACATGAAGG + Intronic
923491431 1:234487517-234487539 TGCCATCCTGAGAAAAATGAGGG - Intergenic
1063108282 10:3012836-3012858 TTGCAGCTGGAGGTAGATGAGGG - Intergenic
1064609284 10:17080500-17080522 TGCCTTCTGGAGAAAGAGAAGGG - Intronic
1064800263 10:19062789-19062811 TGGCTTCTGGGGATAGACGATGG + Intronic
1067131993 10:43573836-43573858 AGCCCTGTGGAGAGAGATGAAGG - Intronic
1067460098 10:46451854-46451876 TGCCATGTGAAGATACATCAGGG - Intergenic
1067627092 10:47932759-47932781 TGCCATGTGAAGATACATCAGGG + Intergenic
1067908610 10:50320761-50320783 TGCCAAGTGGAGATAGAGGGAGG - Intronic
1068781132 10:60920401-60920423 TGCCATCTGGAGAATGAGAAGGG + Intronic
1069726147 10:70580737-70580759 TGGATTTTGGAGATAGATGATGG + Intergenic
1070367155 10:75748605-75748627 TACCATCTCGAGCTAGATGATGG - Intronic
1070818518 10:79340714-79340736 TGCCATCTCTAGAGAGTTGAGGG - Intergenic
1071249865 10:83806701-83806723 TGGCATCCTGAGATGGATGAGGG - Intergenic
1071313821 10:84371755-84371777 TGTGATCTGGTTATAGATGAAGG - Exonic
1071565039 10:86667385-86667407 TGTGGTCTGGAGATAGATCAAGG - Intergenic
1073007249 10:100334062-100334084 AGCCATGTGCAGATAGTTGAAGG + Intergenic
1074424539 10:113339239-113339261 CCCCATCTGGAGAAAGGTGAAGG - Intergenic
1076109961 10:127852596-127852618 TGGCTTCTGGAGATGGAGGATGG - Intergenic
1078607451 11:12789616-12789638 AGCCATCTGGAGGGAGATGTCGG - Intronic
1078795144 11:14584827-14584849 TGCCAGCTGGAGACAGAACAGGG - Intronic
1079468724 11:20758000-20758022 TGCCATGTGAAGATAGAGCAAGG - Intronic
1080692377 11:34569244-34569266 TAAAATCTGGAGATAGATGGTGG - Intergenic
1080698561 11:34624342-34624364 TGCCATCTGAAGACAGAGGCAGG + Intronic
1081515927 11:43829563-43829585 TTCCAACTGGAAATAGAAGAGGG + Intronic
1081617400 11:44598978-44599000 TGCCATCTGGGCAAAGATGCAGG - Intronic
1083721332 11:64605055-64605077 TGGCCTCTGGAGATAGCTGGAGG + Intergenic
1084539974 11:69780137-69780159 AACCATCTGGAGATGGATGGTGG - Intergenic
1085596592 11:77816762-77816784 TCCTAACTGGAGGTAGATGATGG - Intronic
1085646540 11:78227233-78227255 TGCCATTTGGAGATGGGGGACGG - Intronic
1088705042 11:112454396-112454418 TGCCACCTGGAGGGAGATGGGGG + Intergenic
1090727074 11:129537889-129537911 TGTCTTCTGGAGAGGGATGAAGG - Intergenic
1091181237 11:133606344-133606366 TTCCGCCTGGAGACAGATGACGG - Intergenic
1092476750 12:8825769-8825791 TTCTATATGGAGAGAGATGAGGG + Intronic
1092854525 12:12660200-12660222 TGTGCTCTGGAGAGAGATGAGGG + Intergenic
1098815833 12:75160624-75160646 TCCCATCTGTAAAAAGATGAAGG + Intronic
1099691041 12:85952026-85952048 TGCCATCTGGAGGTAAAAGTAGG + Intergenic
1100453431 12:94729488-94729510 TGCAATCTGGAGACATCTGAAGG + Intergenic
1101489407 12:105197545-105197567 TCCCATATGGAGATAAGTGAGGG - Intronic
1101886189 12:108664981-108665003 TGCCATCTGGAGATTGAAGGTGG - Intronic
1102204160 12:111078827-111078849 AGCCATCTGGTGAGTGATGATGG + Intronic
1102239685 12:111316810-111316832 TGTGAACTGGAGAGAGATGATGG - Intronic
1103952024 12:124556495-124556517 TGCCACCTTCTGATAGATGATGG - Intronic
1104039917 12:125122983-125123005 TGCACCCTGGAGATAGATGGGGG + Intronic
1105582167 13:21708558-21708580 TGCCATCTGGAGATAGATGAGGG + Intergenic
1106934570 13:34704049-34704071 TGTCATCTGGAGGTAACTGAGGG - Intergenic
1107525943 13:41231357-41231379 TGCCTTCTGCAGATTGAGGAAGG - Intronic
1108039473 13:46326051-46326073 TGCCAGCAGTAGATCGATGATGG + Intergenic
1108543916 13:51471922-51471944 CACCATGTGGAGATAGAAGACGG + Intergenic
1113591375 13:111503588-111503610 TGGCTTCTGGCCATAGATGATGG + Intergenic
1117214282 14:53534516-53534538 TGTCATCTGTAAATATATGAAGG + Intergenic
1118622818 14:67629585-67629607 TGAGTTCTGGAGATGGATGATGG + Intronic
1119990823 14:79195262-79195284 TGACATGGAGAGATAGATGATGG - Intronic
1120052425 14:79882657-79882679 TGCAATGTGGAGATCGCTGAGGG - Intergenic
1120977269 14:90260018-90260040 TACCACCTGAAAATAGATGATGG + Intronic
1121268793 14:92623862-92623884 TGGCATCTGGAGATGGAGGCTGG + Intronic
1121691102 14:95877373-95877395 TGCCTTCTGGAGAAAGATGTGGG + Intergenic
1122767781 14:104083729-104083751 GGACATCTGGAGATACATCAGGG + Intergenic
1125535609 15:40440134-40440156 TGTCAGCTGGAAATGGATGAGGG + Intronic
1126717455 15:51534523-51534545 TGTCATCTGGCCATCGATGAGGG - Intronic
1127864766 15:63023357-63023379 TGTCATGTGGAGATTGATTAGGG - Intergenic
1128696332 15:69765993-69766015 AGAGTTCTGGAGATAGATGATGG - Intergenic
1133597452 16:7306443-7306465 TTCCATATGAAGATAGATGGAGG + Intronic
1134411871 16:14010008-14010030 ATCCATCTGGAGATAAATAAAGG + Intergenic
1136366874 16:29813038-29813060 TGCCATCTTGAGATGGGAGAGGG - Exonic
1139263782 16:65621215-65621237 TCCGACCTGGAGATTGATGATGG - Intergenic
1139284433 16:65797953-65797975 TGCCAGCTGGCCATCGATGATGG + Intergenic
1142756813 17:2021351-2021373 TGCCCTTTGCAGAAAGATGAGGG + Intronic
1148447005 17:47743966-47743988 TGACATCTGGAGGTAGAAGAGGG + Intronic
1149688759 17:58555662-58555684 TCCAAACTGGAGGTAGATGAAGG + Intergenic
1149748967 17:59127162-59127184 AACCTTCTGGAGATTGATGATGG + Intronic
1150157235 17:62864278-62864300 TCCCTTCTGGAAATAGAAGAAGG - Intergenic
1150410333 17:64936611-64936633 TGCCATCTGCAGGTTGATGAGGG + Intergenic
1150544947 17:66146604-66146626 TGAAATCTGGAGACAGATGGTGG - Intronic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1151619510 17:75237366-75237388 TGCCATCTGGTGAGAGGAGAGGG + Exonic
1152993492 18:384440-384462 TGTTACCTGCAGATAGATGAAGG + Intronic
1155172980 18:23280868-23280890 TGGAAGCTGGAGATAGGTGAGGG - Intronic
1155526754 18:26723747-26723769 GCCCATCTGGTGGTAGATGATGG + Intergenic
1156301354 18:35839091-35839113 TGGCATCTGGAGATGGAGGCTGG - Intergenic
1160226218 18:77013367-77013389 TACCATTTGGAGACACATGAAGG - Exonic
1164830750 19:31318413-31318435 TGCCATCTGTTGATAAAGGATGG + Intronic
1165881180 19:39045112-39045134 TGCCAGCTGGAAATATTTGATGG - Intergenic
1168340383 19:55619817-55619839 TGCCATATGGAGAATGAAGAGGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
928407186 2:31023743-31023765 TGGCATCTGGAGGCAGAGGAGGG - Intronic
935508980 2:103947412-103947434 GGGAATGTGGAGATAGATGAAGG - Intergenic
937245074 2:120487237-120487259 TGCCCTCAGGAGCCAGATGATGG + Intergenic
937958457 2:127437211-127437233 GGCCTTCTGGAGGCAGATGAGGG + Intronic
939399507 2:141672385-141672407 GGTCATCAGGAGATAGATGGAGG + Intronic
939996261 2:148923006-148923028 TGCCATCTGGACAGAGCTGGGGG + Intronic
941185406 2:162316292-162316314 AGCCAGCTGGAGATGGAAGATGG - Intronic
944512840 2:200481592-200481614 TACCATCTGTAGACACATGAGGG - Exonic
945978478 2:216288970-216288992 TGTCATCTGGAGGCTGATGAGGG - Intronic
1169990367 20:11496606-11496628 TGCCATCAGCAGACAGATGCTGG - Intergenic
1170512881 20:17097163-17097185 TGTCTTCTGTAGATAGAAGAAGG - Intergenic
1171299430 20:24047170-24047192 TTCCATCTTGAGATAGATGAAGG - Intergenic
1176387613 21:6146653-6146675 TGCCACCTGGAGACGGAGGAGGG + Intergenic
1177582784 21:23049155-23049177 TGCCATGTAGATATATATGAAGG - Intergenic
1179735859 21:43391595-43391617 TGCCACCTGGAGACGGAGGAGGG - Intergenic
1180031391 21:45210881-45210903 TGCTAACTGGATGTAGATGAAGG - Intronic
1182086031 22:27561775-27561797 TGCAAGCTGGAGATGGAGGAGGG - Intergenic
1184379237 22:44134697-44134719 TTCCATCTGGGGTTAGATAAGGG - Intronic
1184520421 22:44990730-44990752 GGACATCTGGAGATGGATGGTGG + Intronic
949316853 3:2766210-2766232 TGCGATCAGGAGAAAGGTGAAGG - Intronic
949890001 3:8726605-8726627 TGCCCTTTGGAGATGGAAGAAGG + Intronic
949899694 3:8800330-8800352 TGACCTCTGGAGAAGGATGAGGG + Intronic
950882658 3:16335810-16335832 TGCCCTCTTGAGATATTTGATGG - Intronic
950917937 3:16664619-16664641 TGCCATCTTAAGCTAGATAAAGG - Intronic
951283718 3:20783437-20783459 TGCATCCTAGAGATAGATGAAGG - Intergenic
956283632 3:67585534-67585556 TGGCAGCTGGAGACAGATGATGG - Intronic
959671868 3:108987573-108987595 TGGCACCTGGAGAGAGAGGATGG + Intronic
960390757 3:117075142-117075164 TGGCAGCTGGAGATAGAGTAAGG - Intronic
962313877 3:134345867-134345889 TGCTATCTGGACACAGATGAGGG - Intergenic
962377456 3:134870393-134870415 TGCTATCTGGGGCTAGAGGATGG - Intronic
963178007 3:142322145-142322167 TGCAGTCTGGGGATAGCTGAGGG + Intronic
966628127 3:182041762-182041784 CGCCATCTGGAGAAAGCTGCTGG + Intergenic
966894308 3:184431412-184431434 TGCCTTCTGCACATAGATGAAGG - Intronic
971197189 4:24480789-24480811 TGCCATTTGAAGACAGATGATGG + Intergenic
971210209 4:24609010-24609032 TGCAAGCTAGATATAGATGATGG + Intergenic
972104282 4:35462472-35462494 TGCCATCTGGAGGTGGGGGAGGG + Intergenic
973814033 4:54602252-54602274 GGACATGTGGAGTTAGATGATGG - Intergenic
974097258 4:57376961-57376983 TGCCATGTGAAGATAGATGTAGG - Intergenic
978405416 4:108373402-108373424 AGCCAACTGTAGAGAGATGATGG - Intergenic
979836098 4:125369704-125369726 AACATTCTGGAGATAGATGACGG - Intronic
982177872 4:152723466-152723488 AGAGATCTGGAGATAGATGGTGG + Intronic
986579449 5:9249724-9249746 AGGGATCTGGAGATGGATGAAGG + Intronic
987108416 5:14663284-14663306 GGCCATTTGGAGATAGAAGCAGG - Intergenic
988141571 5:27249142-27249164 TGCCATTTGGAGATAAATGTAGG - Intergenic
989863347 5:46412798-46412820 TGCCATTTGGAGCGATATGAGGG + Intergenic
992163616 5:74026536-74026558 TTCCATCTTGAGATAGGAGATGG - Intergenic
993423814 5:87737052-87737074 TGCCATCTGAAGAAAGGGGATGG - Intergenic
995050355 5:107696481-107696503 TGAGATCTGGAGAGAGAAGAGGG + Intergenic
995719363 5:115113944-115113966 TGCTCTCAGGTGATAGATGATGG - Intergenic
996820423 5:127620334-127620356 TGACATCTGAAAATAGATCATGG + Intergenic
997288421 5:132701621-132701643 ATCCATCTGGAGATGAATGATGG + Intronic
999088338 5:148912856-148912878 TGCCATCTGCAGGTGGATGGAGG - Intergenic
1001163301 5:169340523-169340545 AGCCTCATGGAGATAGATGAGGG - Intergenic
1002880720 6:1249889-1249911 TGCCATCTGGACATAGGAAAGGG - Intergenic
1003478274 6:6505314-6505336 TGCCATCTGGAGACTGATTTGGG + Intergenic
1004230737 6:13830979-13831001 TACCATCTGCAAATAGATGATGG + Intergenic
1004369543 6:15040236-15040258 TGCCATCTGGAAACAAATGGAGG - Intergenic
1006277438 6:33016616-33016638 TGCCATGTGGAGGTAGCAGAGGG + Intergenic
1011060728 6:83263963-83263985 AGCCTTCTGTAGAAAGATGATGG + Intronic
1012714167 6:102648155-102648177 TGCCACCAGGGGATAGAAGAGGG - Intergenic
1015137058 6:129884440-129884462 TGCCCTCTGGAAACAGCTGAAGG - Intergenic
1015495894 6:133882996-133883018 CGCCGTCTGGAGAGAGATGCTGG + Intergenic
1017311724 6:152983416-152983438 TTCCATCTGGAGATCTTTGATGG + Intronic
1022904743 7:34844879-34844901 TCCCATCTGTAGATACAAGAGGG - Exonic
1023082408 7:36537832-36537854 TCACATCTGGAGATAGAAGAGGG - Intronic
1027712329 7:81620747-81620769 TGCCATCTTAATATATATGATGG - Intergenic
1029572728 7:101381259-101381281 TGCCCTTTGGAGATAGAGGAAGG - Intronic
1030078697 7:105758760-105758782 TGCCATCTGTAGATAGACCAGGG + Intronic
1032406915 7:131662984-131663006 TCCCATGTGGAGAATGATGAGGG + Intergenic
1036695604 8:10972767-10972789 AGACATCTGGAGATGGATGGTGG + Intronic
1038421862 8:27438728-27438750 TTCAAGCTGGAGATGGATGAAGG + Intronic
1039919150 8:41881103-41881125 TGCCATCTGGAGAAAGGAAATGG - Intronic
1041600292 8:59709371-59709393 TGGCATTTGAAGATAGCTGATGG - Intergenic
1041984141 8:63900273-63900295 TGCCTTGTGAAGAAAGATGATGG + Intergenic
1046607454 8:116387770-116387792 TGCCATGTGAAGAAGGATGAAGG + Intergenic
1048593008 8:135838900-135838922 TGTCACCTGGAGGTAGATGTTGG + Intergenic
1048862963 8:138737286-138737308 TTCCATCTGGAGGCAGATGGGGG - Intronic
1050026201 9:1336678-1336700 TGCCCACTGGAGATGGAAGAGGG - Intergenic
1050713101 9:8488109-8488131 TACCATGGGGATATAGATGAAGG + Intronic
1052456674 9:28707849-28707871 TTCCATGTGGTGATAGATGCAGG - Intergenic
1055447978 9:76402047-76402069 TGCCATCTCCAGCCAGATGAGGG + Intergenic
1055475853 9:76663321-76663343 AGCCAGCTGAAGAGAGATGAAGG + Intronic
1058237882 9:102515894-102515916 TGTGATCTGGTTATAGATGAAGG - Intergenic
1059721180 9:116961302-116961324 AGACTTCTGGAGATAGATGGTGG - Intronic
1060432037 9:123558743-123558765 TGGCATCTTGAGATGAATGAAGG - Intronic
1191646720 X:63489074-63489096 AGCCACCTGGAGCTGGATGAGGG - Intergenic
1193585016 X:83310954-83310976 TGCTGTCTGGAGTTAGAGGAGGG - Intergenic
1194006282 X:88498095-88498117 AGCCATCTTGAGATAAATGAAGG - Intergenic
1196827710 X:119753882-119753904 TACCATATGGAGACACATGAGGG - Intergenic
1197485076 X:127038885-127038907 TGCCCTTTGCAAATAGATGAGGG - Intergenic