ID: 1105584788

View in Genome Browser
Species Human (GRCh38)
Location 13:21733909-21733931
Sequence GAGGGGTATTCCCCAGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105584781_1105584788 -1 Left 1105584781 13:21733887-21733909 CCTAGGTAGAGACTGGATGGGGG 0: 1
1: 0
2: 3
3: 18
4: 215
Right 1105584788 13:21733909-21733931 GAGGGGTATTCCCCAGGGATAGG 0: 1
1: 0
2: 1
3: 11
4: 103
1105584779_1105584788 0 Left 1105584779 13:21733886-21733908 CCCTAGGTAGAGACTGGATGGGG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1105584788 13:21733909-21733931 GAGGGGTATTCCCCAGGGATAGG 0: 1
1: 0
2: 1
3: 11
4: 103
1105584775_1105584788 11 Left 1105584775 13:21733875-21733897 CCTGTTGAGAGCCCTAGGTAGAG 0: 1
1: 0
2: 2
3: 3
4: 97
Right 1105584788 13:21733909-21733931 GAGGGGTATTCCCCAGGGATAGG 0: 1
1: 0
2: 1
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105584788 Original CRISPR GAGGGGTATTCCCCAGGGAT AGG Intergenic
900939566 1:5789720-5789742 GAGAGGTATGCCCCAGGGAGGGG - Intergenic
901735234 1:11308209-11308231 GAGGGGTGTGCCACAGGGATGGG - Intergenic
902414471 1:16230765-16230787 GAGGGGAAGTCCCCAGGGAAAGG - Intergenic
902568598 1:17332147-17332169 GAGGGGGATTCCACAGAGAAGGG - Intronic
903293128 1:22327093-22327115 GAGGGTTTGTCCCCAGGGAGAGG - Intergenic
905272352 1:36795300-36795322 GAGGGGTGTTGCCAAGGGAAGGG + Intergenic
905452442 1:38065326-38065348 GAGGGGTTTTGCCCAGGGTGGGG - Intergenic
906519741 1:46459984-46460006 GAGGATTAATCCCCAGGGAAGGG - Intergenic
906532169 1:46530200-46530222 GAGGGGTACTCCCCAGGGCCTGG - Intergenic
911271288 1:95804361-95804383 GAAGGGTGGTCACCAGGGATCGG - Intergenic
911993756 1:104736510-104736532 GAGTGTTATTCTCCAGGGAAAGG - Intergenic
924843059 1:247734986-247735008 GTGGGGTCTTCTCCAGGGTTGGG - Intergenic
1076837549 10:133028693-133028715 GGGGGCTATTCCCTTGGGATAGG + Intergenic
1077329830 11:1979377-1979399 GAGGGGTGCTGCCCAGGGCTCGG - Intronic
1081876995 11:46415126-46415148 GAGCTGTATCACCCAGGGATAGG + Intronic
1082175661 11:49055986-49056008 GAGAGATATTCCCTAAGGATGGG - Intronic
1083619101 11:64040270-64040292 GAGGGGGACTTCCCAGGGAAGGG + Intronic
1084302909 11:68262970-68262992 CAGGGGGATTGCTCAGGGATCGG + Intronic
1085518765 11:77126200-77126222 GAGGAATATTCCCCAGGCCTGGG + Intergenic
1086951603 11:92896543-92896565 GAGGTGTATTCCACAGGGCATGG + Intergenic
1088401034 11:109422849-109422871 CAGGGGTATCCCCCTGGGAATGG + Intronic
1090132745 11:124161779-124161801 GAGGAGTATTTTCCAGGGAGAGG + Intergenic
1202812808 11_KI270721v1_random:34556-34578 GAGGGGTGCTGCCCAGGGCTCGG - Intergenic
1095198582 12:39355051-39355073 GAAGGCTACTCCCCAGGGGTGGG + Intronic
1101442761 12:104715777-104715799 GAGCGATATCCCCCAGGGGTGGG - Intronic
1102454615 12:113063842-113063864 GAGGTGTTTTCCCCGGTGATGGG - Intronic
1104042565 12:125139997-125140019 GAGGGGTCTTGCCCAAGGAAGGG + Intronic
1104760428 12:131294935-131294957 GAGGGGGCTTCCCCACGGGTAGG - Intergenic
1104819351 12:131665850-131665872 GAGGGGGCTTCCCCACGGGTAGG + Intergenic
1105576242 13:21654991-21655013 GAGGGGTATACCCAAGGGACAGG + Intergenic
1105584788 13:21733909-21733931 GAGGGGTATTCCCCAGGGATAGG + Intergenic
1109873576 13:68367859-68367881 GAAGAGTATTTACCAGGGATAGG + Intergenic
1112313941 13:98344434-98344456 GCATGGTCTTCCCCAGGGATGGG - Intronic
1112378486 13:98865870-98865892 GATGAGGATTCCCCAGGGAGGGG + Intronic
1113370809 13:109723788-109723810 GTGGGGTATTACCTAGGGAGAGG - Intergenic
1116472034 14:45296499-45296521 GAGCAGTTTTGCCCAGGGATAGG + Intergenic
1120147973 14:81000562-81000584 GAGGAGTATACCCCAGTGGTAGG - Intronic
1123113288 14:105882740-105882762 GAGGGGTCCTCCCCAGGGCAGGG + Intergenic
1126102144 15:45125197-45125219 GACGCCTATTCCTCAGGGATGGG - Intronic
1126172679 15:45707455-45707477 GAGGCAGATGCCCCAGGGATGGG - Intergenic
1131570916 15:93535259-93535281 GAGAGGTATGCCCCAGAGAGAGG - Intergenic
1134746886 16:16595414-16595436 GAGTGATATTCCCCAGAGAAAGG + Intergenic
1134998588 16:18758249-18758271 GAGTGATATTCCCCAGAGAAAGG - Intergenic
1138428394 16:56951571-56951593 GAGGGGTTGTCCCCAGGGAAGGG + Intergenic
1143121330 17:4608953-4608975 GAGCAGTATTCTCCATGGATTGG + Intergenic
1156770791 18:40721171-40721193 AATGGGTATTCACCAGGCATTGG - Intergenic
1161620415 19:5294115-5294137 GAGGCGTTTTTTCCAGGGATGGG - Intronic
1162328428 19:10012110-10012132 GAGGGTGTTTCCCCAGGGAGGGG + Intergenic
1163040676 19:14599824-14599846 TTGGGGAATTGCCCAGGGATGGG + Intronic
1163103108 19:15109307-15109329 CTGGGGTCTTCCTCAGGGATGGG - Exonic
1163718045 19:18883855-18883877 GAGGGAGATTCCGCTGGGATGGG - Intronic
1166366515 19:42280943-42280965 GGGGGATGGTCCCCAGGGATTGG - Intronic
1167720828 19:51179102-51179124 TATGGGTATTAACCAGGGATTGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
927963955 2:27257840-27257862 GAGGGGTCTTCCTCCAGGATGGG - Intronic
931184881 2:59940113-59940135 GAGGGGTTAGCCCAAGGGATGGG + Intergenic
932163331 2:69482612-69482634 CAGGGCTATTCCCCAGGGATTGG + Intronic
934767620 2:96888868-96888890 GGGGGGTGTGCTCCAGGGATTGG - Intronic
935413132 2:102786872-102786894 GAGGGGGATTGCACAGGGAATGG + Intronic
938729719 2:134137269-134137291 GAGGGGCATCCCCTAGGAATTGG + Intronic
946081931 2:217128037-217128059 GGGGGATATTCCCCGGGGGTAGG + Intergenic
946270978 2:218594242-218594264 CAGGGGGATACCCCGGGGATCGG - Exonic
948739120 2:240031301-240031323 GAAGGGAATTGCCCAGGGACAGG + Intergenic
948815399 2:240507745-240507767 GAGGGGAAGGCCCCAGGGCTGGG + Intronic
1169209668 20:3759067-3759089 TAGGGGTAGGCCCCAGGGATGGG - Intronic
1170352441 20:15456746-15456768 GAGGGGTAAGACCCAGGCATTGG - Intronic
1170535712 20:17338703-17338725 GAGGGGTCATTCCCAGGGAGAGG + Intronic
1175588019 20:60161302-60161324 AATGGGTATTCCCAAGGCATGGG + Intergenic
1178910826 21:36671873-36671895 GAGGGGGCTTCCCCAGCTATTGG + Intergenic
1183206486 22:36423005-36423027 CAGGGGCCTTCCCCAGGGGTGGG + Intergenic
1184519508 22:44984467-44984489 GTGGTGGATTCCCCAGGTATGGG + Intronic
1184620216 22:45671545-45671567 GAGGGGTCTCCCCCAGGGGAGGG - Intergenic
1185246704 22:49776643-49776665 GAGGGGGAGGCCCCAGGGTTTGG - Intronic
949642971 3:6060410-6060432 GAGGCGTATTCCCTAGAGATGGG + Intergenic
950126228 3:10511342-10511364 CTGGGGTACTCCCCAGGGACAGG + Intronic
961445465 3:126978973-126978995 GAGGGCCATTCCCCAGAGCTGGG + Intergenic
961457264 3:127030433-127030455 GAGGGGCATCCCCCAGGGCCAGG + Intronic
962373353 3:134839660-134839682 GAGGGGCAGTGCCCTGGGATAGG + Intronic
969539768 4:7780240-7780262 GAATGGGAATCCCCAGGGATGGG + Intronic
970197130 4:13562241-13562263 GAGGGGTGTACCCCTGGTATTGG - Intergenic
970340196 4:15098184-15098206 GAAGGGTAATCTCCAGGGTTTGG + Intergenic
973819754 4:54652536-54652558 TACGGGTATTCCCCAAGGAGAGG + Intergenic
975048244 4:69829255-69829277 GAGGGGTATTCCACAGTGACTGG + Intronic
978885443 4:113761833-113761855 GAGGGGGCTTCGCCAGGGAGGGG - Intronic
987125122 5:14804794-14804816 GATGGGGAATCCCCAGGCATAGG + Intronic
987574179 5:19704504-19704526 GAGGGGTATGTCCCTGGTATGGG + Intronic
992837296 5:80654149-80654171 GAGGTGTTTTCTCCAGGGCTGGG + Intronic
994385824 5:99130304-99130326 AAGGGGAATTTCCCAGTGATTGG - Intergenic
997618987 5:135272624-135272646 GAGGGCCACTCCCCAGGGAAAGG + Intronic
998186033 5:139980833-139980855 GAGGGAGATTCCCCAGGGAAAGG - Intronic
1000120755 5:158195591-158195613 GAGGGGTATTATCTGGGGATTGG + Intergenic
1002080221 5:176733224-176733246 GAGGGGGATTGTCCTGGGATGGG + Intergenic
1003723167 6:8728828-8728850 AAGGGTTAGTCCCCAGAGATTGG + Intergenic
1007819601 6:44551496-44551518 GAGGTGAATGCCCCAAGGATGGG - Intergenic
1008734313 6:54524066-54524088 GAAAGCTATTCCGCAGGGATTGG - Intergenic
1015295231 6:131583776-131583798 CTGGTGTCTTCCCCAGGGATGGG - Exonic
1016466045 6:144326829-144326851 GAGTGGGATTCCTCAGGGATAGG - Intronic
1018702442 6:166437545-166437567 GAAGGGCATTCTCCAGGGGTTGG + Intronic
1022214033 7:28240482-28240504 GAAGTCTATTGCCCAGGGATTGG + Intergenic
1023516377 7:41005833-41005855 GAGGGCTAGTCACCAAGGATGGG - Intergenic
1032153915 7:129453038-129453060 GAGAGGTAGTCTCCAGGGTTAGG - Intronic
1032504717 7:132426303-132426325 GAGGGGTGTTCCTGAGGGAGAGG - Intronic
1038166159 8:25086931-25086953 GAGGGGTTTCACCCAGGGCTGGG + Intergenic
1042830578 8:73023510-73023532 GAGGGTTATACCCCAGGTACAGG - Intronic
1047728035 8:127701602-127701624 GATGAGAAATCCCCAGGGATAGG + Intergenic
1048843376 8:138584166-138584188 GTGGGGCATTCTCCAGGGAGTGG + Intergenic
1050019319 9:1267469-1267491 GAGGGGAAATCCTCAGGGAGGGG + Intergenic
1051659671 9:19414155-19414177 GAGGGGGCTTCCCAAGGCATGGG - Intronic
1053146470 9:35715433-35715455 GTGTGGTATTCCCCAAGGAGGGG - Intronic
1056179296 9:84066140-84066162 GATGGGAAGTTCCCAGGGATGGG + Intergenic
1060733375 9:126051545-126051567 GAGGGGAACTCCCCTGGGCTGGG - Intergenic
1061389362 9:130308916-130308938 GAGTGGTGTTCGCCAGGGACTGG + Intronic
1062115576 9:134806387-134806409 CAGGGGTATTTCCTTGGGATTGG + Intronic
1190277675 X:48909796-48909818 GAGGGGTACGAACCAGGGATGGG - Exonic
1192169822 X:68847212-68847234 TAGGGGCATTGCCCAGGGAAGGG + Intergenic
1198653739 X:138891465-138891487 GAGGGGTGAGCCCCAGTGATGGG - Intronic