ID: 1105585974

View in Genome Browser
Species Human (GRCh38)
Location 13:21743166-21743188
Sequence TCCTTTGATTGCATCTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105585967_1105585974 29 Left 1105585967 13:21743114-21743136 CCACTGCCTCTCCTAGTTCCTCC 0: 1
1: 0
2: 1
3: 63
4: 700
Right 1105585974 13:21743166-21743188 TCCTTTGATTGCATCTTCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 223
1105585970_1105585974 11 Left 1105585970 13:21743132-21743154 CCTCCTTGTCGTCTAAGTACTAC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1105585974 13:21743166-21743188 TCCTTTGATTGCATCTTCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 223
1105585968_1105585974 23 Left 1105585968 13:21743120-21743142 CCTCTCCTAGTTCCTCCTTGTCG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1105585974 13:21743166-21743188 TCCTTTGATTGCATCTTCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 223
1105585971_1105585974 8 Left 1105585971 13:21743135-21743157 CCTTGTCGTCTAAGTACTACCTC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1105585974 13:21743166-21743188 TCCTTTGATTGCATCTTCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 223
1105585969_1105585974 18 Left 1105585969 13:21743125-21743147 CCTAGTTCCTCCTTGTCGTCTAA 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1105585974 13:21743166-21743188 TCCTTTGATTGCATCTTCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105585974 Original CRISPR TCCTTTGATTGCATCTTCTG TGG Intergenic
900754210 1:4422515-4422537 TCTTTTGTTTCCGTCTTCTGAGG - Intergenic
902111492 1:14082505-14082527 ACCCTTGATTGCATCCTGTGGGG + Intergenic
902256292 1:15190910-15190932 GCCTATAATTCCATCTTCTGGGG - Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
904118948 1:28183157-28183179 TCCTGTGATAGCATCTTATTGGG + Intronic
910095913 1:83521072-83521094 TCATTTGATTGCTTCATCTCAGG - Intergenic
910682419 1:89881269-89881291 TCCTTCGATTGCATATTCTTTGG + Intronic
911034589 1:93527491-93527513 TCCCCTGTTTGCTTCTTCTGAGG + Intronic
913004932 1:114620214-114620236 TCCTTGGATTGAATCTTTTTAGG - Intronic
915928633 1:160043476-160043498 TCATCTGTTTGCATCATCTGGGG + Intronic
916944098 1:169707308-169707330 TCCTTTCTTTGCTTCTTCTTAGG - Intronic
917511613 1:175673848-175673870 TTCTTTGGGTGCATCTTTTGTGG - Intronic
1063251406 10:4279229-4279251 TCCCCAGAGTGCATCTTCTGAGG - Intergenic
1064201542 10:13288996-13289018 TCATTTGTTTGGTTCTTCTGGGG - Intronic
1065377174 10:25055085-25055107 TCTTTTAATTCCAACTTCTGTGG + Intronic
1067213659 10:44282196-44282218 ACATTTGAGTTCATCTTCTGAGG + Intergenic
1067986464 10:51152038-51152060 TTCTTTGCTTTCATCTTATGTGG + Intronic
1068650096 10:59513136-59513158 TCATTCCATTTCATCTTCTGAGG + Intergenic
1071024915 10:81100779-81100801 TCTTTTGTTTGAACCTTCTGTGG + Intergenic
1071137288 10:82467089-82467111 TCATTTGATTCTATCTGCTGGGG - Intronic
1073763222 10:106653402-106653424 AGCTTTGATTGCATCTTATTTGG - Intronic
1073881920 10:107991710-107991732 TTCTTTTATTGCATCTTGTCAGG + Intergenic
1074070907 10:110068296-110068318 TCCTTTCTCTGAATCTTCTGAGG + Intronic
1076395331 10:130134796-130134818 TCCTTTGCTTGCTTCTACCGTGG - Intergenic
1077662381 11:4081177-4081199 TGCTTTCAATGCATCTTCTCTGG + Intronic
1077955782 11:7019103-7019125 TCCTTTGTGTTCCTCTTCTGGGG + Intronic
1079806400 11:24935928-24935950 TCCTTTGAATACTTCTTCTTTGG + Intronic
1081099456 11:38984129-38984151 ACCTTTGTTTCCTTCTTCTGTGG - Intergenic
1083336424 11:61924331-61924353 TCTTTTGCCTGCATCTTTTGGGG - Intergenic
1084504128 11:69554466-69554488 CCTTTTTATTGCATCTTCTCGGG - Intergenic
1089286403 11:117410734-117410756 TCCTTTTATTGTTTATTCTGGGG + Intronic
1093078273 12:14779691-14779713 TCCTTTGATTCCATACTTTGGGG - Intergenic
1094064371 12:26347723-26347745 CCCCTTGATTTCTTCTTCTGGGG + Intronic
1094125184 12:27015684-27015706 TCCTTGGATTTCATCTACTGAGG - Intergenic
1094229439 12:28085945-28085967 TCCCTTCAGTGCTTCTTCTGTGG + Intergenic
1097000639 12:55873557-55873579 TCCTGGGATTGGATCTTCTCTGG + Intergenic
1099103934 12:78477745-78477767 TCCTTTTGTTTCATCTTCTCTGG - Intergenic
1099817077 12:87663345-87663367 TGCTTTTATTACATCTTCTATGG - Intergenic
1100910721 12:99358971-99358993 TAGTTTCATTTCATCTTCTGTGG - Intronic
1101094387 12:101321741-101321763 TCTTTTGATTGCATTTTCTTTGG + Intronic
1101198684 12:102412121-102412143 TCTTTTTATTGTATCTTTTGAGG - Intronic
1104397286 12:128445347-128445369 TCCTCTCATTGCCTCTCCTGTGG + Intronic
1105505347 13:21005053-21005075 TCCTAGAATTGCATCTTCTGTGG - Intronic
1105585974 13:21743166-21743188 TCCTTTGATTGCATCTTCTGTGG + Intergenic
1107554017 13:41501865-41501887 TCGTTTGACTGGATCTGCTGAGG - Intergenic
1108741611 13:53344521-53344543 TCCTGTGGTTGCATCTGCTAAGG + Intergenic
1109077537 13:57856657-57856679 TTCTCTAATTGCATTTTCTGAGG + Intergenic
1109878773 13:68443152-68443174 TCAATAGATTGCATCTTTTGAGG + Intergenic
1110080696 13:71306926-71306948 TCCTTTTAATGCATTTTCTCTGG + Intergenic
1112009999 13:95285814-95285836 ACCTTTGGTGGCATCTTCTTTGG - Intronic
1112068454 13:95820312-95820334 TGCTTTGTCTGCTTCTTCTGTGG - Intronic
1112302523 13:98242892-98242914 TCTTCAGATTGCATTTTCTGTGG + Intronic
1112424019 13:99280030-99280052 TCTTTTGATTTCATCTCCTTTGG + Intronic
1113137665 13:107111958-107111980 TCCTTTGGTTGAATCTGTTGGGG + Intergenic
1114440506 14:22742797-22742819 TCCTTTGCCAGCATCTTCTTTGG - Intergenic
1116296014 14:43111038-43111060 TCTTTTGATAGAATCTTCTCTGG - Intergenic
1117238908 14:53808311-53808333 TTCTATGCTTGCATCCTCTGGGG - Intergenic
1117557340 14:56899520-56899542 TCCTTAAATTGTATTTTCTGTGG - Intergenic
1117988656 14:61413011-61413033 TCCTTTGGCTGCTTCTCCTGTGG + Intronic
1119601122 14:75978121-75978143 TCCTTTGAATGCATGTTCACTGG + Intronic
1120522273 14:85537897-85537919 TTCTTTGATTCCTTCTACTGTGG + Intronic
1121043340 14:90768710-90768732 TCCTTTCATTTCACCTTGTGTGG - Intronic
1121669277 14:95695478-95695500 TCCCTGGAGCGCATCTTCTGTGG - Intergenic
1128370987 15:67039345-67039367 TCCTTTGGTTTCAACTGCTGGGG - Intergenic
1129643214 15:77404288-77404310 ATATTTTATTGCATCTTCTGGGG + Intronic
1130575338 15:85087559-85087581 TTCTTTTTTTTCATCTTCTGAGG + Intronic
1131039415 15:89249195-89249217 TACTCTGAGTTCATCTTCTGTGG - Intronic
1133313589 16:4867734-4867756 TCCTCTCACTGCATCCTCTGGGG - Intronic
1133988415 16:10685856-10685878 ACCTCTGGTTGCATCATCTGGGG + Intronic
1134511146 16:14848129-14848151 GCATTTGATTTCTTCTTCTGTGG - Intronic
1134698789 16:16246625-16246647 GCATTTGATTTCTTCTTCTGTGG - Intronic
1134973045 16:18548048-18548070 GCATTTGATTTCTTCTTCTGTGG + Intronic
1135863239 16:26076699-26076721 TCAATTGATAGCAGCTTCTGGGG + Intronic
1137582731 16:49643641-49643663 TTCTTTGATTGCATTTACTCTGG - Intronic
1138943378 16:61817396-61817418 GCCTTTGCTTGTACCTTCTGTGG - Intronic
1140523950 16:75606464-75606486 TTCTTGGATTGCCTGTTCTGTGG + Intronic
1142204175 16:88774908-88774930 TCCTTTGACTGGTTCCTCTGGGG - Intronic
1149786266 17:59437808-59437830 ACTCTTGATTTCATCTTCTGTGG + Intergenic
1151194573 17:72422560-72422582 TCCTTGGTTTTCATCTTCTAAGG - Intergenic
1156711206 18:39948152-39948174 TCCTCTTCTTCCATCTTCTGTGG - Intergenic
1157158382 18:45289407-45289429 TCCCTTAATTAAATCTTCTGGGG + Intronic
1158130123 18:54143325-54143347 TCCATTGATTGTATCTAGTGCGG + Intergenic
1158871858 18:61695963-61695985 TCCTTTGGGTGCATATTCTTAGG - Intergenic
1159836259 18:73339964-73339986 ACATTTTATTGCAACTTCTGAGG + Intergenic
1159932791 18:74331850-74331872 TTCTTTGATTACCTCTTATGTGG + Intronic
1160086207 18:75779702-75779724 TCCTTTGGTTGCCTCTTCCAGGG - Intergenic
1160408908 18:78661474-78661496 TCCTGTGACTGTATCTGCTGGGG - Intergenic
1160591755 18:79948863-79948885 TACTTTGAGTGCATGTTGTGGGG - Intronic
1164766710 19:30777898-30777920 TTCTCTGATGGTATCTTCTGAGG - Intergenic
1168460669 19:56554295-56554317 CCCTTTGATTGCATCGATTGTGG + Exonic
924966665 2:82829-82851 TCTTTGGATTGGATCTTCTCAGG + Intergenic
926137928 2:10350068-10350090 TCCTTTTAATTCCTCTTCTGAGG + Intronic
927870343 2:26619184-26619206 TCCTTTGATTTCATCCCCAGAGG - Intronic
928706483 2:33955163-33955185 TCCTCTGATTGTATCATCAGAGG - Intergenic
928796189 2:35022612-35022634 TGGTTTTATTGCATCTACTGAGG - Intergenic
928926840 2:36588448-36588470 TTCTTAGATTGCATCTTGGGAGG - Intronic
928943576 2:36752261-36752283 TCTTTTCATTGCACCTTCTCAGG - Intronic
929898321 2:45980430-45980452 TCCCTTCACTGCCTCTTCTGTGG + Intronic
931427215 2:62182206-62182228 TCCATTAATTGGATCTTCAGAGG + Intergenic
932361097 2:71106661-71106683 TCCTGTAATTGCAGCTTCTCGGG - Intergenic
933525319 2:83430919-83430941 TACTTTGACTGCATCTGCAGAGG + Intergenic
933979607 2:87539299-87539321 GCCTCTGACTGCATGTTCTGAGG + Intergenic
934155149 2:89192354-89192376 TGCTTTGATTGGAAATTCTGAGG - Intergenic
934191776 2:89804468-89804490 TCATTTGATTGCATTTGATGAGG - Intergenic
934212165 2:89990373-89990395 TGCTTTGATTGGAAATTCTGAGG + Intergenic
934592145 2:95563718-95563740 TCATTTAATAGCTTCTTCTGTGG + Intergenic
936314215 2:111411492-111411514 GCCTCTGACTGCATGTTCTGAGG - Intergenic
937943760 2:127312224-127312246 TCCATTAATTTCATCTTCAGTGG + Intronic
938036293 2:128037729-128037751 TCCTTTCATTTCATCCTCTCTGG - Intergenic
939176013 2:138747773-138747795 TCCTTGGAAAACATCTTCTGTGG - Intronic
939334836 2:140813129-140813151 TTCTTTGATTCAATCTTCTAGGG - Intronic
940346852 2:152637376-152637398 TCCTCGGATTGCCTCTGCTGAGG + Intronic
941339554 2:164289884-164289906 TTCTGTGAGTTCATCTTCTGTGG - Intergenic
943152836 2:184136194-184136216 TTCTTTTTTTGCATTTTCTGAGG + Intergenic
945486625 2:210404496-210404518 CCATTTGATTGCATTTGCTGAGG + Intergenic
946095450 2:217270553-217270575 CCATTTGCTTGCATCTCCTGTGG + Intergenic
947375052 2:229487520-229487542 TCTTTTGATTTCAACTTCTCAGG - Intronic
947459647 2:230292694-230292716 TCCTTTGATTTCAAATTCCGTGG - Exonic
948873218 2:240814031-240814053 TCCTTTGACTGCCTTTTCTAGGG - Intronic
1169023321 20:2347029-2347051 CGCCTTGATTACATCTTCTGAGG - Intergenic
1169159441 20:3364107-3364129 TCCTTTTTTTGTATCTTCTATGG + Intronic
1169527195 20:6442091-6442113 TCCTTTGATTTCATCTGATTAGG - Intergenic
1169924907 20:10772955-10772977 TCCTTTCCTTTTATCTTCTGAGG + Intergenic
1170029020 20:11924932-11924954 TCCTTTGTTTACATTATCTGTGG - Exonic
1171764341 20:29247734-29247756 TCCTTTTATTGTATCTGCAGAGG - Intergenic
1178773987 21:35531373-35531395 TCCTGTGATTGAAACTCCTGAGG + Intronic
1182984209 22:34701258-34701280 TCCTCTGATTGTTTCTTATGGGG - Intergenic
1183027492 22:35076684-35076706 TCCCCTGATTGCTTCTTCTCTGG - Intronic
950183649 3:10932065-10932087 GCGTTTGATTGCATCCTCTAAGG + Intronic
950574094 3:13820829-13820851 TCATTTGATTGCAGATACTGAGG - Intronic
951116095 3:18863818-18863840 TCCCCTGATTTCATCTCCTGTGG + Intergenic
951280309 3:20740337-20740359 TTCTTTGATGGCATTTTCTTTGG - Intergenic
951454679 3:22877081-22877103 TTCTTTTAAAGCATCTTCTGCGG - Intergenic
954269901 3:49499712-49499734 TCCTTTGGTTGCATCTTCCTGGG + Intronic
954724230 3:52593806-52593828 TCCTTCTTTTGCATTTTCTGAGG + Intronic
956345120 3:68269930-68269952 TCCTCTGAGTACATTTTCTGTGG + Intronic
956637728 3:71382880-71382902 TCCTTTGACGGCATCTCCTGGGG + Intronic
959149196 3:102588293-102588315 TCTGTTGATTGCAACTTCTCTGG + Intergenic
960272692 3:115691844-115691866 TCCCTAGATTGCAGTTTCTGAGG - Intronic
960609929 3:119546337-119546359 TCCTTTTTTTGCTTCCTCTGTGG + Intronic
960613621 3:119577648-119577670 TGCTTTGACTGCATCCTCAGAGG + Intergenic
961671861 3:128538231-128538253 CCCTTTGGTTGCATCCTCTTTGG - Intergenic
962850151 3:139302199-139302221 TCCTTTGATTGCCTGTGCTCTGG + Intronic
963698770 3:148597791-148597813 TCATTTGATTCCATTCTCTGAGG - Intergenic
963937658 3:151071086-151071108 TCCTTTATTTCCATCTTCTTAGG + Intergenic
964078009 3:152715422-152715444 TCCTCTCATTGCATCCTCTCAGG + Intergenic
964693451 3:159480325-159480347 ACCAGTGATGGCATCTTCTGAGG - Intronic
971561737 4:28085999-28086021 TCCTAAGACTGCACCTTCTGAGG + Intergenic
974925132 4:68288503-68288525 TTCTTTGACTGCCTCTTCTACGG - Intergenic
976419240 4:84820024-84820046 ACCACTGATTACATCTTCTGTGG - Intronic
976681261 4:87758745-87758767 TCTTTGGATAGCATCTTCTTTGG - Intergenic
977679279 4:99781124-99781146 CCCTTTAATGGCATATTCTGAGG - Intergenic
978078637 4:104565543-104565565 TCCTTTCTTTGCATTTGCTGAGG + Intergenic
978176853 4:105742502-105742524 TGCCTTGGTTGCATCATCTGCGG + Intronic
983916222 4:173294521-173294543 TCCTGTGATTGCATATTCATGGG + Intronic
987198936 5:15555227-15555249 TCCTTTAACTGGATGTTCTGTGG - Intronic
989094276 5:37766953-37766975 TCTTTCTATTCCATCTTCTGAGG + Intergenic
989216792 5:38913107-38913129 TCTTTTGATAGTATCTTTTGTGG - Intronic
991005673 5:61825701-61825723 TCCTTGGATTGCTTATCCTGGGG - Intergenic
991492101 5:67193775-67193797 TCCTTTGGCTGCCTGTTCTGGGG - Intronic
991620175 5:68536600-68536622 TGCTCTGATTGCATCTTATCAGG + Intergenic
992646253 5:78814112-78814134 TCCTCTGTTTGACTCTTCTGTGG + Intronic
995643456 5:114284640-114284662 TCCTTTAATTCCAGCTACTGGGG - Intergenic
1002794345 6:459248-459270 GTCTTAGAATGCATCTTCTGTGG - Intergenic
1008677870 6:53840634-53840656 TCTTTTTATTCCACCTTCTGAGG + Intronic
1009808346 6:68630711-68630733 TCCCTTGCTATCATCTTCTGAGG - Intergenic
1010178898 6:73061749-73061771 TCATCTCATTGCATCTTCTTGGG - Intronic
1011496166 6:87938478-87938500 TGCTTTGTTTACATCTTGTGTGG + Intergenic
1013275347 6:108579655-108579677 GCCTCTGCTTGCATGTTCTGGGG + Intronic
1014326286 6:119999389-119999411 TACTTTAAATGGATCTTCTGTGG + Intergenic
1014727017 6:124983552-124983574 TCATTCTATTCCATCTTCTGTGG + Intronic
1015395908 6:132734342-132734364 ACCATAGATTCCATCTTCTGGGG + Exonic
1018374569 6:163198961-163198983 ACCTTTCATTTCATCTCCTGTGG - Intronic
1018481998 6:164200336-164200358 TCATTTCTTTGCATCTTGTGTGG - Intergenic
1019084311 6:169459965-169459987 TCCTTTTATTTCACCTTGTGGGG - Intronic
1021254812 7:18377992-18378014 TCATTTTCTTGCATCTACTGGGG - Intronic
1021353485 7:19625451-19625473 TCCATTAATTGGTTCTTCTGTGG - Intergenic
1024207312 7:47174864-47174886 TCCTTTGCTGGCATCTTAAGAGG - Intergenic
1024693289 7:51826613-51826635 ACCTGTGATTGGATCTGCTGGGG + Intergenic
1025146128 7:56505740-56505762 GTCTCTGACTGCATCTTCTGTGG + Intergenic
1025262973 7:57433280-57433302 GTCTCTGACTGCATCTTCTGTGG - Intergenic
1028309048 7:89306771-89306793 GCCTGTGATTGCTTCTTTTGGGG - Intronic
1029314632 7:99700235-99700257 TCCTTTGAGTTCATATTCTATGG + Intronic
1029543130 7:101196252-101196274 TTCTCTCCTTGCATCTTCTGGGG - Exonic
1033393016 7:140946670-140946692 TGCTTTCTTTGCATATTCTGTGG - Intergenic
1033864053 7:145666237-145666259 TCAGTTGTTTGCATCTTTTGAGG - Intergenic
1034857789 7:154569086-154569108 TCCTTTTATTACATATTTTGTGG - Intronic
1034857911 7:154570576-154570598 TCCTTTTATTACATATTTTGTGG - Intronic
1037209968 8:16375117-16375139 TCCTTGGAGTGCAGCTTGTGGGG - Intronic
1038082181 8:24151121-24151143 TCCTTTGATTTCAGATTCTCAGG + Intergenic
1038252126 8:25914658-25914680 TCCTTTCCTTGAATCTTCTTGGG - Intronic
1041875620 8:62683734-62683756 CCCTTTCATTCCATCTTCTCAGG - Intronic
1042461275 8:69072111-69072133 TCCTTTGGCTGCTTCTTCAGGGG - Intergenic
1043836323 8:85051300-85051322 TCCTTTGATTGTTTTATCTGAGG + Intergenic
1044095231 8:88055815-88055837 TCCTTGCAATGCATCTTTTGGGG - Intronic
1046183824 8:110687530-110687552 TCCCTTCATTGCACATTCTGTGG + Intergenic
1047221165 8:122919336-122919358 TTGTTTGATTGCAACGTCTGGGG + Intronic
1047270091 8:123349617-123349639 TCCATTGATTTCAATTTCTGTGG - Intronic
1047610459 8:126515670-126515692 TCTTTTACTTGCTTCTTCTGTGG + Intergenic
1048890701 8:138943913-138943935 TCTTTTGATTGTATCTTAAGGGG - Intergenic
1049083543 8:140460348-140460370 TCCCTTGCTTGGATCTTATGAGG - Intergenic
1049271149 8:141696948-141696970 TCCTTGGGTTTCATCTTTTGTGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1055616155 9:78075064-78075086 GCCTTGGATTACATCATCTGTGG - Intergenic
1057147241 9:92766304-92766326 TCCTTTGATTGACCTTTCTGAGG + Intergenic
1058183298 9:101824003-101824025 TCCTTGCATTGCATCTTTTTAGG - Intergenic
1059168260 9:112099470-112099492 TGCTTTGAATGCATAATCTGGGG - Intronic
1059253903 9:112911420-112911442 ACCTTTCTTTGCATCTCCTGGGG + Intergenic
1059666383 9:116450202-116450224 TGCTTTGAATGCATTTTCTATGG + Intronic
1060144100 9:121236069-121236091 TCCTTCCATTGCCTCTTCAGAGG - Intronic
1060432714 9:123564256-123564278 TCACTTGGTTGCAACTTCTGGGG + Intronic
1061778933 9:132984563-132984585 TCCTTTGAATGCACCTGCAGTGG + Intronic
1187309703 X:18130066-18130088 GCCTTGGATTGCTCCTTCTGGGG - Intergenic
1187945893 X:24426217-24426239 TCCTTGTATTTCATTTTCTGTGG - Intergenic
1188085515 X:25897359-25897381 GCAATTGATTGCATCATCTGCGG - Intergenic
1188294777 X:28434069-28434091 TCCATTGACTGCTTCTTCTTGGG + Intergenic
1188683149 X:33037034-33037056 GGTTTTGATTGCATTTTCTGAGG + Intronic
1191773096 X:64783810-64783832 GCAATTGATTGCATCATCTGTGG + Intergenic
1192050408 X:67719237-67719259 GCCTATGATGCCATCTTCTGGGG + Intronic
1193159813 X:78215745-78215767 GCAATTGATTGCATCATCTGTGG + Intergenic
1193798159 X:85902190-85902212 TAATTTGCTTGCATCTTATGAGG - Intronic
1195692112 X:107635554-107635576 GCCTGTGATTGCAGCTACTGGGG - Intronic
1196013762 X:110915801-110915823 GCCTTTGATGGCATTTGCTGTGG - Intergenic
1197338145 X:125233173-125233195 TCCTGTGATTGCAGCTACTCTGG - Intergenic
1197826426 X:130595324-130595346 TGCTTTCATTGCTTTTTCTGGGG + Intergenic
1198424843 X:136507075-136507097 TGCTTTTATTGCATGTTTTGGGG + Intronic
1199778367 X:151035517-151035539 TCCATTGATGGCAAGTTCTGGGG + Intergenic
1199862041 X:151809878-151809900 GCCTTTGACTGCAGCTTCTGAGG - Intergenic
1200164055 X:154023987-154024009 TGCTGTCATTGCTTCTTCTGAGG - Intronic
1201599343 Y:15711101-15711123 TCCCTTTATTGCATTTGCTGTGG + Intergenic
1201917578 Y:19198905-19198927 TCCTTTCATTTCAGATTCTGGGG + Intergenic