ID: 1105586140

View in Genome Browser
Species Human (GRCh38)
Location 13:21744697-21744719
Sequence CTTCCTTGACTCATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105586137_1105586140 -8 Left 1105586137 13:21744682-21744704 CCTGGATCCTACTTTCTTCCTTG 0: 1
1: 0
2: 1
3: 26
4: 292
Right 1105586140 13:21744697-21744719 CTTCCTTGACTCATGGAAAATGG 0: 1
1: 0
2: 0
3: 17
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105586140 Original CRISPR CTTCCTTGACTCATGGAAAA TGG Intergenic
904143611 1:28372280-28372302 CTTCCCTGATTCATGTAAAGGGG - Intronic
904307564 1:29599968-29599990 CTTACTTGCCTCCTGGAAGAAGG - Intergenic
904928578 1:34067887-34067909 CTTCCTGGAGTCATGGAGAGTGG - Intronic
905169253 1:36099605-36099627 CTTCCTGCTCTCATGGAAGATGG + Intronic
906251044 1:44311324-44311346 TTTACCTGACTCATGGTAAAAGG - Intronic
907248320 1:53121907-53121929 CTGCTTTGACTCATTGAGAAAGG + Intronic
907505774 1:54917105-54917127 CTTCCTTGACACAAAGAAAGGGG + Intergenic
907868521 1:58422050-58422072 CCTACTTGCCTCATGGAACAAGG + Intronic
907904856 1:58775228-58775250 CTTCCTTGACACACTGAGAATGG + Intergenic
908179299 1:61588351-61588373 ATTCCTTGACTCATCCAAAGTGG + Intergenic
909375023 1:74930336-74930358 CTTACCTGACTCCTGCAAAAAGG - Intergenic
910217494 1:84857045-84857067 CTGCCTTGACAGATGGCAAATGG - Intronic
911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG + Intergenic
914837312 1:151218385-151218407 TTTCCTTGTCTCAAGGAAAAAGG + Intronic
915419665 1:155769881-155769903 CTTCCTTGGCTTATGGTTAATGG + Intronic
916520148 1:165556326-165556348 ATTCATAGACTCATGGAACATGG - Intronic
920294071 1:204945288-204945310 GTTCCTTGACACAAGGAACAGGG - Intronic
920840981 1:209553535-209553557 CTTACTTTATTCATGGAAAAAGG - Intergenic
924188874 1:241527029-241527051 CTTCTTTGAGTCAAAGAAAAAGG + Intergenic
924458672 1:244238822-244238844 CTTTCTTCACTAATGGAAGAAGG - Intergenic
924635294 1:245781481-245781503 ATTCTTTGACTCTTGGAAGAAGG - Intronic
1063886551 10:10585400-10585422 CTACCTTGGGTCATGGAGAAAGG + Intergenic
1065846850 10:29751640-29751662 CTTCCTTTACTCTTGGGATAAGG - Intergenic
1065884311 10:30063291-30063313 CTTTCTTGAGTCCTGGAGAAGGG + Intronic
1068440771 10:57052948-57052970 CCTCATTGACTCCTGGAGAAGGG + Intergenic
1068471693 10:57473455-57473477 CTTCTGTGACTCATGGTAAGTGG + Intergenic
1069590643 10:69639690-69639712 ATTCCTTTACTCTGGGAAAAAGG - Intergenic
1072306192 10:94109657-94109679 CTTCCTTAATAAATGGAAAATGG + Intronic
1074277261 10:112015319-112015341 CTTCCTTGAATTATCTAAAATGG + Intergenic
1074451807 10:113565414-113565436 CTGCCTCCACTCATGGCAAAAGG + Intronic
1074653300 10:115550817-115550839 CTTCCTTCCCTAATGGAATAAGG + Intronic
1074777886 10:116779543-116779565 CTTCCCTGTCTCCTGGCAAAGGG - Intergenic
1075513165 10:123088573-123088595 ATTCCATGACACATGGAGAATGG - Intergenic
1075969599 10:126641216-126641238 CTTCCTTGAATCATGACGAAGGG + Intronic
1078601742 11:12738236-12738258 CTGCCTTAAAGCATGGAAAATGG + Intronic
1079839538 11:25379099-25379121 CCTCATTGTCTAATGGAAAACGG - Intergenic
1079966281 11:26984025-26984047 CTTCCTTGGCTGGGGGAAAAGGG + Intergenic
1083039718 11:59673733-59673755 CTGCTTTGACTAATGGAATATGG + Intergenic
1084568902 11:69948071-69948093 GTTCCTTGGCACAGGGAAAATGG + Intergenic
1087845323 11:102965187-102965209 CTTCCGTGACTCGTGGGAAGGGG + Intergenic
1088423052 11:109669752-109669774 CTGTGTTGCCTCATGGAAAAAGG - Intergenic
1088668547 11:112118865-112118887 CTTCTGTACCTCATGGAAAATGG - Intronic
1089033848 11:115363675-115363697 CTTCATTCACTAATGGGAAAAGG + Intronic
1089519729 11:119055918-119055940 CTTCGTTTACCCATGGAAAGTGG - Intronic
1090931293 11:131300186-131300208 CTTCCTTCACTCAAGGAATCGGG + Intergenic
1092042954 12:5401495-5401517 CTTCCTGGGCCCATGGAAGAAGG + Intergenic
1093843876 12:23943235-23943257 CTTCACTTACTCATGGACAATGG - Intronic
1095285947 12:40410346-40410368 CTTGCTAGAAACATGGAAAATGG + Intronic
1098241169 12:68468494-68468516 CTTGCTTGACTCAAGGAGAAAGG + Intergenic
1098360770 12:69652322-69652344 GTTCCAGGACTCAGGGAAAAAGG + Intronic
1098905201 12:76154781-76154803 CTTTGGTGACTGATGGAAAAGGG + Intergenic
1099521910 12:83674874-83674896 TTTCTTTGACTGATTGAAAATGG + Intergenic
1101337267 12:103807605-103807627 CTTCCTTGGCACATGGATTACGG + Intronic
1105586140 13:21744697-21744719 CTTCCTTGACTCATGGAAAATGG + Intergenic
1105912692 13:24885771-24885793 CATCCTTAACTAATGGATAAAGG - Intronic
1106287383 13:28329500-28329522 CTTCCTCGCCTCCAGGAAAACGG - Intronic
1106949555 13:34867898-34867920 CTTCCTGGAGTCAGGGAAAAAGG + Intergenic
1109155900 13:58908856-58908878 CTTCCTTTAGTAATGAAAAATGG + Intergenic
1110248597 13:73356265-73356287 CTTCCTTGACTCTCTGACAAAGG - Intergenic
1111001339 13:82187517-82187539 CTTACTTGAATCATGAAAAATGG - Intergenic
1111029549 13:82577216-82577238 CTTCCTTGATAAATGGAACAAGG - Intergenic
1111263799 13:85779507-85779529 CTTCCTTAAATCATACAAAAGGG - Intergenic
1111826650 13:93276214-93276236 CTTGCTTGACTAAGGGTAAATGG - Intronic
1114053277 14:18941981-18942003 TTTCATTGATTCATGTAAAAAGG - Intergenic
1114109281 14:19459945-19459967 TTTCATTGATTCATGTAAAAAGG + Intergenic
1114902784 14:27085623-27085645 TTTTCTTGATTAATGGAAAATGG + Intergenic
1115462769 14:33680348-33680370 CTTCCTGAATTCAGGGAAAAAGG + Intronic
1116615873 14:47137569-47137591 CTGCTTTCACTCATGGCAAAAGG - Intronic
1118815748 14:69312764-69312786 CTTCCTTGGCTCAAGGATCAGGG - Intronic
1119945024 14:78684447-78684469 CTTCCGTGTCTCCTGGAAAGGGG - Intronic
1122252682 14:100451058-100451080 CTTTTTTCACTCTTGGAAAATGG - Intronic
1124331323 15:28819097-28819119 CCTCCTTTTCTCATGGAAGAAGG + Intergenic
1125483320 15:40095207-40095229 CTTGGTTTCCTCATGGAAAAGGG - Intronic
1125774706 15:42201741-42201763 CTTCCTTGAATGATGTAATATGG - Intronic
1127913624 15:63437854-63437876 GATCCTTGACCCATGGAGAAGGG + Intergenic
1128984535 15:72209598-72209620 CTTCCTTGACACAAGGAAGATGG - Intronic
1129054363 15:72808352-72808374 AGTCCTTAACTCATGGAAATGGG - Intergenic
1129323249 15:74786483-74786505 CTTCCTTGGCTACTGGAACAGGG - Intronic
1134226033 16:12390773-12390795 CTTACTTCCCTCCTGGAAAATGG - Intronic
1134351012 16:13437735-13437757 GATCCTTGACTCATGGGGAAAGG + Intergenic
1139417545 16:66826261-66826283 ATTCCTTTATTCATGGAATATGG - Intronic
1140767938 16:78177424-78177446 CTCCCATGACTCATGAAAGATGG + Intronic
1140904456 16:79398522-79398544 CTTCCAGGACTCATGGAACCAGG + Intergenic
1140956902 16:79874606-79874628 CTTGCTTGACTCATGGCAACCGG + Intergenic
1143019220 17:3908000-3908022 CTTCCCTGTCTCTTGGGAAAAGG - Intronic
1146760611 17:35474521-35474543 CTCACTTGAATCATGGAAGATGG - Exonic
1147027804 17:37603528-37603550 ACTCCTTGATTCATGGAGAATGG + Intronic
1147211758 17:38875939-38875961 CTCCCTTGACTACTGGGAAATGG + Intronic
1147412184 17:40261625-40261647 CTTCCTTTATTCAGGGCAAAGGG - Intronic
1147495212 17:40908944-40908966 CCTCCTTGACTGATGGACACAGG - Intergenic
1149612600 17:57968487-57968509 ATTCCTTGGCTCATGGGCAAGGG + Intergenic
1149697429 17:58627103-58627125 CTTCCTGGACACTTGAAAAAGGG + Intronic
1150992105 17:70271646-70271668 CTTCCTTAGGTCAAGGAAAAAGG - Intergenic
1152996932 18:416518-416540 ATTCCATGACTCATTGAAAATGG + Intronic
1153037576 18:778883-778905 CTCCTTCGACTCTTGGAAAATGG - Intronic
1155532960 18:26786110-26786132 CTTCCTCGAGTCATGGCACAGGG - Intergenic
1160744347 19:703825-703847 CTTCCTGGACTCAGGGACAGGGG - Intergenic
1163840538 19:19606139-19606161 CTTCCTGAACTCAAGGAAAAAGG - Intronic
1164864846 19:31596338-31596360 TTTCCTTTACTCATGGGTAATGG + Intergenic
1167930192 19:52857447-52857469 CTTCCTTCACTCAGAGCAAATGG - Intronic
1168164101 19:54534702-54534724 CTTCCTTGACTCACGGTTCAAGG - Intronic
926427286 2:12750619-12750641 CTTTCTTGACTCAGGGAGGAGGG + Intergenic
926933694 2:18065832-18065854 CTTCCCAGACTCAAGGACAAGGG + Intronic
927858380 2:26541776-26541798 CTTTCTTGCCACAGGGAAAATGG + Intronic
930331296 2:49988198-49988220 TTTCTTTGACTCTTTGAAAATGG + Intronic
930903758 2:56540827-56540849 CTTCACTGACCCAGGGAAAAAGG + Intergenic
931680623 2:64745719-64745741 CTGCCTTCACTCATGGAGAGTGG + Intronic
932656973 2:73618761-73618783 CTTCTGTGACTGCTGGAAAATGG + Intergenic
934844088 2:97650735-97650757 CTTCCTTGCCTCATGGTAACTGG + Intergenic
936691238 2:114891783-114891805 CTTCAATCACTCAAGGAAAAAGG - Intronic
937388289 2:121457324-121457346 CTGCCTTTACTCAGGGAATAGGG + Intronic
938471260 2:131564511-131564533 TTTCATTGATTCATGTAAAAAGG - Intergenic
939853919 2:147334183-147334205 CTTCCCTGTCTCCTTGAAAATGG + Intergenic
940094262 2:149956283-149956305 CATCCTTGACCAATGGAAGATGG + Intergenic
940767960 2:157810304-157810326 TTTCCTTGCCTCATGTTAAATGG - Intronic
942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG + Intergenic
942524819 2:176841879-176841901 CTGCTTTCACTCATGGCAAAAGG - Intergenic
944351639 2:198734408-198734430 CTTCCTCAACCAATGGAAAATGG - Intergenic
1169500061 20:6150964-6150986 CTGCATTCACTCATGGCAAAAGG + Intergenic
1169500281 20:6153214-6153236 CTCCCTTGACACATGGGAATTGG + Intergenic
1169968759 20:11246440-11246462 TTTTGTTCACTCATGGAAAATGG + Intergenic
1170758645 20:19229326-19229348 CTTTACTGACTCAGGGAAAAGGG - Intronic
1170874829 20:20240632-20240654 TTTCATTGACTCATGGAGGAAGG - Intronic
1170974942 20:21153725-21153747 CTTCTATGACTCAAGGAGAAAGG - Intronic
1173441556 20:43081639-43081661 CTTCATTGACTCAGAGAATATGG + Intronic
1173466327 20:43284829-43284851 CTTACTAGAAACATGGAAAAGGG + Intergenic
1175643945 20:60655476-60655498 GTTCCTTGAACCATGGGAAAAGG + Intergenic
1175964002 20:62651178-62651200 CTTCCATGACTCAGGGCTAAAGG - Intronic
1176984787 21:15423099-15423121 CGTCCTTGACTCTGGGAGAAAGG + Intergenic
1178138528 21:29655676-29655698 CTTCCCCTTCTCATGGAAAAGGG - Intronic
1180471750 22:15664356-15664378 TTTCATTGATTCATGTAAAAAGG - Intergenic
1183725481 22:39586889-39586911 CTTCCTTGACTCCTGGGCAGGGG - Intronic
1185328939 22:50243003-50243025 CTTCCTTTTATCATGGTAAAAGG - Intronic
954940841 3:54371602-54371624 CTTACTTGAGTGATGGAAATTGG - Intronic
955966777 3:64397000-64397022 TTTTCTTGACCCATGGAACATGG - Intronic
956985724 3:74697579-74697601 CTTCCTTACCTCATGCAAACAGG - Intergenic
959601999 3:108197702-108197724 CTCCCAAGACTCAAGGAAAAGGG + Intronic
960028471 3:113034221-113034243 CTTCCTTGAATCAGGGCACATGG + Intergenic
960844905 3:121996194-121996216 CTTCCTTCAATCAGGGAGAAAGG + Intronic
961796931 3:129415814-129415836 CTCCCTTAATTCCTGGAAAATGG + Intronic
962477009 3:135763612-135763634 CTTCCTTCATGCCTGGAAAAGGG + Intergenic
963800580 3:149672032-149672054 CTTCCCTGTCTCCTAGAAAAAGG + Intronic
965922910 3:173940967-173940989 CTTTCTTTAATTATGGAAAATGG - Intronic
966052491 3:175637646-175637668 CTTCTTCCACTCATGGAAGAAGG - Intronic
966310336 3:178587054-178587076 CTTCCTTTACTGATTCAAAATGG + Intronic
966331517 3:178819670-178819692 GTTTCTTGACTCATTGATAAAGG - Intronic
966623176 3:181987574-181987596 GTTCTTTTGCTCATGGAAAATGG + Intergenic
968961957 4:3750215-3750237 CATCCGTGTCTCATGAAAAAGGG + Intergenic
969216734 4:5729140-5729162 CTTCCTTGCCAGAAGGAAAATGG - Intronic
970689695 4:18608354-18608376 GTTCCTTCACACATGGAAACTGG - Intergenic
974615050 4:64269709-64269731 ATTCCTGGCCTGATGGAAAAAGG - Intergenic
975763479 4:77641417-77641439 CTACCTTTACACATGCAAAACGG + Intergenic
976727536 4:88229304-88229326 CTTCCTTGATTTATGACAAATGG + Intronic
977449502 4:97176820-97176842 CTGCTTTCACTCATGGAAGAGGG + Intergenic
979738030 4:124112913-124112935 CTTTCTTCTCCCATGGAAAAGGG + Intergenic
980165097 4:129216235-129216257 CTTCCTTCACTCATTCAACATGG + Intergenic
981415781 4:144491812-144491834 GTTTCTTGCTTCATGGAAAATGG - Intergenic
986001058 5:3631172-3631194 CTTCCTTCACTCCTGGAGATGGG + Intergenic
986024077 5:3833637-3833659 CCTCATTGTCTCATGGCAAAGGG + Intergenic
986066872 5:4242816-4242838 CTTCCTAGATTTAAGGAAAAAGG + Intergenic
986425407 5:7626597-7626619 CTGCCTCCACTCATGGATAATGG + Intronic
987444755 5:18004008-18004030 CATCCATGACTCAAGGAAGAAGG + Intergenic
987830384 5:23087729-23087751 CTTCATAGAATAATGGAAAATGG + Intergenic
992584266 5:78218897-78218919 TTTTCTTGAGGCATGGAAAATGG + Intronic
992599362 5:78382576-78382598 CTTCAGGGACTCATGGGAAAGGG - Intronic
992864316 5:80942146-80942168 CTTCCTTCACTCAAGGATCATGG - Intergenic
993108460 5:83626642-83626664 CTTCCTTGAATGAGGGCAAAGGG + Intergenic
994398475 5:99248879-99248901 CTTCATTTACTAATAGAAAAAGG - Intergenic
994685131 5:102941293-102941315 CTTCCTTGCCGCAAGGCAAATGG + Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995441540 5:112197737-112197759 GTTCCTTGGATCATGGTAAAGGG - Intronic
996111737 5:119573714-119573736 CTTCCTTGCCTTAGGCAAAAAGG - Intronic
996523830 5:124456016-124456038 CTTCCTTTTCACATAGAAAATGG - Intergenic
997818080 5:137037058-137037080 TTTCATTGTCTCATAGAAAAAGG - Intronic
1001173095 5:169440192-169440214 CCTCCTTGACTCTTTAAAAAGGG + Intergenic
1001238826 5:170052382-170052404 CTCCCTTGCCTCATGTTAAAAGG - Intronic
1001311256 5:170612605-170612627 CTTCCTAGACTCAGGAAAATGGG - Intronic
1002139200 5:177128565-177128587 CTACCAGGACTCAGGGAAAATGG + Intergenic
1003125510 6:3352635-3352657 CTCACCTGAATCATGGAAAATGG + Intronic
1004013851 6:11714448-11714470 CTTTCTTGGTTCTTGGAAAATGG + Exonic
1004318040 6:14608708-14608730 CTTCATGGACTCATTGAAAGTGG + Intergenic
1008201380 6:48594878-48594900 CTTCCTTAACTCAATGACAAGGG - Intergenic
1010216292 6:73404935-73404957 CTTCCTGCAGTGATGGAAAATGG + Intronic
1010588664 6:77686310-77686332 CTTCCTCAACTCATGGTGAAGGG + Intergenic
1011101617 6:83728414-83728436 CTTCCTTCGCTCATTGAGAAGGG + Intergenic
1012023428 6:93956494-93956516 CTTCCTTGACACATTGACCAGGG + Intergenic
1013742332 6:113301797-113301819 CTTCCTTGACTCACACAAATGGG - Intergenic
1015241606 6:131030196-131030218 CTTCCTTGACCAATGGATAGAGG + Intronic
1018094134 6:160370221-160370243 CTTCCTGGATTCAAGGGAAAGGG + Intronic
1020674056 7:11158470-11158492 CTACCTTGACTGATGGACCAAGG - Intronic
1021610842 7:22456670-22456692 ACTCCTTGAGTCATGAAAAAAGG + Intronic
1021934505 7:25616304-25616326 GTTCCTTCATTCATGTAAAATGG - Intergenic
1026577273 7:71582800-71582822 CTTCGGTGACTCAGGGGAAAGGG + Intronic
1031257411 7:119471929-119471951 TTTCCTTGCCTCCTGTAAAATGG + Intergenic
1032458860 7:132094458-132094480 CTTACTGGTCTCCTGGAAAATGG + Intergenic
1033861108 7:145629265-145629287 CTTCTTTGTCTGATGGAACATGG - Intergenic
1034025757 7:147701978-147702000 TTTCCTTAACTGAGGGAAAAAGG + Intronic
1034082221 7:148289520-148289542 CTTCTTGGACACAGGGAAAAAGG - Intronic
1035552818 8:543653-543675 CATTCCTAACTCATGGAAAATGG - Intronic
1038376761 8:27047682-27047704 CTTCCTTGAGGCTGGGAAAAGGG + Intergenic
1040923786 8:52653944-52653966 CTTCCCTTACTCGTGGAACAAGG + Intronic
1041717138 8:60942724-60942746 CTGCCTACACTCAAGGAAAAGGG + Intergenic
1043330191 8:79107015-79107037 CTTCCTTTACTAAAAGAAAAGGG + Intergenic
1043875891 8:85485497-85485519 CTTCGTAGACTCAGGGAAAAGGG - Intergenic
1044258027 8:90088864-90088886 CTTTATGGACTCATGGACAAGGG - Intronic
1047025356 8:120817709-120817731 CTCCCTTGATTCATGAGAAAGGG + Intergenic
1047371078 8:124256561-124256583 TTTCCTTGAGCTATGGAAAAAGG - Intergenic
1047695202 8:127396461-127396483 CATCCTTCACTCATGAAATAGGG + Intergenic
1048399947 8:134055955-134055977 CATAATTGTCTCATGGAAAAAGG - Intergenic
1048720520 8:137319268-137319290 CTTCATTGACTCATGGTGAGGGG + Intergenic
1050252187 9:3756684-3756706 CTTCATTCACTCATAGAATAGGG + Intergenic
1051970679 9:22883690-22883712 CTTTCTTGACTCATCAAAAAGGG + Intergenic
1052787931 9:32847074-32847096 CTTCCTTGAGTCAGAGAAGATGG + Intergenic
1055152473 9:73019355-73019377 CTGCTTTCACTCATAGAAAAAGG + Intronic
1055494959 9:76844775-76844797 CTTCCTTATCTCTTGGAAACTGG - Intronic
1055848032 9:80591250-80591272 CTTCAGAGACTCATGTAAAAGGG - Intergenic
1058554561 9:106153058-106153080 CTTCATTTCCTCATGGAGAAAGG + Intergenic
1058596388 9:106620572-106620594 CTTCCTTGACTGATGTAAAGTGG - Intergenic
1058745636 9:107987870-107987892 CAGCCTTGGCTCCTGGAAAAAGG + Intergenic
1059000847 9:110347342-110347364 CTACTTGGTCTCATGGAAAAAGG + Intergenic
1059798007 9:117720729-117720751 CTTGCTTGGCCCATGGGAAATGG - Intergenic
1060475313 9:123982567-123982589 CTTCATTTCCTCCTGGAAAAAGG - Intergenic
1185521044 X:739975-739997 GTACCTTGACTCTTGGATAATGG - Intergenic
1187327378 X:18303748-18303770 CTTCCTAGACTTATGGAAGCAGG + Intronic
1187378882 X:18782297-18782319 CTTCCATGAGTCATGCAAAAAGG - Intronic
1187689055 X:21845985-21846007 CATCCATGACTCATGGAAATGGG - Intronic
1187766198 X:22644984-22645006 CTTCCTGGACTAATTGAAAGGGG - Intergenic
1188867112 X:35326827-35326849 ATTTGTTGACTCATGGAACATGG - Intergenic
1189905371 X:45753869-45753891 CTTTCTTCACTCATAGAAAGAGG - Intergenic
1191102389 X:56745765-56745787 CTACCTGGACTCATCAAAAATGG - Intergenic
1193636243 X:83952754-83952776 CTTTCTGGACTCAGGGAAAAGGG + Intergenic
1194055756 X:89128870-89128892 ATAACTTGACTCATGGAGAATGG - Intergenic
1195535904 X:106009149-106009171 CTTACTTGCCTCCTGGAAAACGG - Intergenic
1195941568 X:110171993-110172015 CTTCCTGGAGTCATGAAGAATGG + Intronic
1199752198 X:150830626-150830648 CTTCCTTAACTCAGAAAAAAAGG - Intronic