ID: 1105587486

View in Genome Browser
Species Human (GRCh38)
Location 13:21758478-21758500
Sequence CATTTTGCACAATTGGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105587475_1105587486 22 Left 1105587475 13:21758433-21758455 CCCCCCAAAGCATGCCAACTTAG 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587483_1105587486 -3 Left 1105587483 13:21758458-21758480 CCAGCAAGCGCCAGGGAACACAT 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587471_1105587486 26 Left 1105587471 13:21758429-21758451 CCCCCCCCCCAAAGCATGCCAAC 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587474_1105587486 23 Left 1105587474 13:21758432-21758454 CCCCCCCAAAGCATGCCAACTTA 0: 1
1: 1
2: 1
3: 18
4: 177
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587479_1105587486 18 Left 1105587479 13:21758437-21758459 CCAAAGCATGCCAACTTAGTGCC 0: 1
1: 0
2: 1
3: 11
4: 66
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587477_1105587486 20 Left 1105587477 13:21758435-21758457 CCCCAAAGCATGCCAACTTAGTG 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587473_1105587486 24 Left 1105587473 13:21758431-21758453 CCCCCCCCAAAGCATGCCAACTT 0: 1
1: 0
2: 1
3: 22
4: 309
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587478_1105587486 19 Left 1105587478 13:21758436-21758458 CCCAAAGCATGCCAACTTAGTGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587472_1105587486 25 Left 1105587472 13:21758430-21758452 CCCCCCCCCAAAGCATGCCAACT 0: 1
1: 1
2: 2
3: 13
4: 256
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587480_1105587486 8 Left 1105587480 13:21758447-21758469 CCAACTTAGTGCCAGCAAGCGCC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129
1105587476_1105587486 21 Left 1105587476 13:21758434-21758456 CCCCCAAAGCATGCCAACTTAGT 0: 1
1: 0
2: 2
3: 8
4: 102
Right 1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105587486 Original CRISPR CATTTTGCACAATTGGCCAT TGG Intergenic
907589938 1:55656673-55656695 CATTTTACAGAATTGTGCATTGG + Intergenic
907750247 1:57256476-57256498 CATTTTCCACATTTACCCATCGG + Intronic
908079053 1:60555277-60555299 CATTTTACACAAATGTTCATAGG + Intergenic
910262205 1:85303627-85303649 CATTTTGGACAATTGGCAAATGG + Intergenic
913133753 1:115866961-115866983 GATTTTCCAGATTTGGCCATTGG + Intergenic
913142020 1:115950837-115950859 GATTTTGCACATTAGCCCATGGG + Intergenic
913794927 1:122597018-122597040 CTTTTTGTGCAATTGGCAATTGG + Intergenic
913812239 1:122908094-122908116 CTTTTTGCGCAATTGGCAAGTGG + Intergenic
913829593 1:123218946-123218968 CTTTTTGTGCAATTGGCAATTGG + Intergenic
913832544 1:123272105-123272127 CTTTTTGTACAATTGGCAAGTGG + Intergenic
913876735 1:124064706-124064728 CTTTTTGTACAATTGGCAAGTGG + Intergenic
913881032 1:124141455-124141477 CTTTTTGTGCAATTGGCAATTGG + Intergenic
913883633 1:124188308-124188330 CTTTTTGTACAATTGGCAAGTGG + Intergenic
914749460 1:150524068-150524090 CATTTTGGACATTTGGCCTCTGG + Intergenic
920493999 1:206441230-206441252 GATTTTGAACAATTGGACCTAGG + Intronic
922605615 1:226888201-226888223 CATGTGGCACAAGTGGACATGGG + Intronic
924709954 1:246523489-246523511 CATTTTCCACAACTGCCCAAAGG + Intergenic
1066810716 10:39330622-39330644 CATTTTGCAGAATTTGCAAAGGG - Intergenic
1073473696 10:103739428-103739450 GCTTTGGCACAATTGGCCAGTGG + Intronic
1077436575 11:2542255-2542277 CCTTTTGCCCTCTTGGCCATTGG - Intronic
1080996333 11:37606897-37606919 CATTCTGGATAATTGGCCTTGGG + Intergenic
1087079247 11:94153812-94153834 CATTTAGCACAATGGGGCAATGG + Intronic
1089083707 11:115799083-115799105 CACTTTGCAAAATTGGCTAGTGG - Intergenic
1092052053 12:5478748-5478770 CATTTTGCACATTGGTCCAGGGG + Intronic
1094883636 12:34835119-34835141 CGTTTTGTACAATTTGCAATTGG - Intergenic
1095029542 12:37251834-37251856 CGTTTTGTACAATTTGCAATTGG - Intergenic
1097369713 12:58762876-58762898 CATTTTGAAAAATAAGCCATAGG + Intronic
1099802933 12:87479888-87479910 CAGTTTCCACCACTGGCCATTGG + Intergenic
1100960172 12:99954513-99954535 AATTGTGAACAATTGGTCATTGG - Intronic
1104204549 12:126625659-126625681 AGATTTGCATAATTGGCCATTGG - Intergenic
1105334617 13:19455090-19455112 CAATTTTCAAAATTGGCCAAGGG + Intronic
1105587486 13:21758478-21758500 CATTTTGCACAATTGGCCATTGG + Intergenic
1107270030 13:38604761-38604783 CATTTTACAGAACTGGCCACTGG - Intergenic
1108629033 13:52262701-52262723 CAATTTTCAAAATTGGCCAAGGG + Intergenic
1108657022 13:52543775-52543797 CAATTTTCAAAATTGGCCAAGGG - Intergenic
1113532908 13:111042473-111042495 CACTTTGCATCATTGGTCATGGG + Intergenic
1117539164 14:56729924-56729946 CATTTTGGACAACTGGGCAGGGG - Intronic
1120516638 14:85478799-85478821 AATTTTTCTCATTTGGCCATAGG - Intergenic
1127592460 15:60439337-60439359 CTTCTTGCACAATTTGTCATAGG + Intronic
1129141325 15:73600737-73600759 TATGTTGCACAATTGGTCAAAGG - Intronic
1130286413 15:82558826-82558848 CGTTTTCCACACTTGGCCTTGGG + Intronic
1135392743 16:22107389-22107411 CATTTGGCACTATTGGCATTTGG - Intronic
1138749594 16:59402566-59402588 CACATTGCACAATTGGACAATGG + Intergenic
1138757584 16:59506760-59506782 AATTTTGCACATTTGACCTTGGG - Intergenic
1141238105 16:82239135-82239157 CATTGTCCCCAGTTGGCCATTGG - Intergenic
1153961336 18:10142740-10142762 AATTTTTCACAATTGGACTTGGG - Intergenic
1154977100 18:21469358-21469380 AATTTTCCAGCATTGGCCATTGG + Intronic
1156088349 18:33436581-33436603 CATTTTACAGCATTGGCCAAGGG - Intronic
1157626549 18:49055702-49055724 CATTCTGCCCATTTGGCCCTCGG - Intronic
1157643106 18:49238038-49238060 CATTTTGCACAAATGCACGTAGG + Intronic
1163827377 19:19531147-19531169 CATGCTGCAAAATTGGCCAGAGG + Intronic
1163873903 19:19849739-19849761 CATTTTCACCAAGTGGCCATAGG + Intergenic
1163880342 19:19915239-19915261 CATTTTCACCAAGTGGCCATGGG - Intronic
1163903762 19:20132608-20132630 CATTTTTACCAAGTGGCCATAGG + Intergenic
1163940574 19:20489473-20489495 CATTTTTACCAAGTGGCCATGGG - Intergenic
1163956418 19:20646426-20646448 CATTTTTACCAAGTGGCCATGGG + Intronic
1163963981 19:20726203-20726225 CATGTTGCACATATGGCCAGAGG + Intronic
1164329515 19:24240072-24240094 CATTTTGTGGAATTGGCGATGGG - Intergenic
1164362361 19:27528209-27528231 CATTTTGTAGAATTGGCAATGGG + Intergenic
1164363589 19:27547386-27547408 CATTTTGTAGAATTGGCAATGGG + Intergenic
1164489136 19:28690617-28690639 CAACTTTCACAATTGGCCAGTGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
924992200 2:321894-321916 CTTTTTGCATGATTTGCCATAGG - Intergenic
927098645 2:19768890-19768912 CATTATGCACAAAAGGCCATTGG - Intergenic
929611829 2:43276482-43276504 CCTTTTGCATAATTGGCTTTAGG - Intronic
930207785 2:48605550-48605572 CATTTTGTACATTTTCCCATTGG - Intronic
931088185 2:58857277-58857299 CATTTTGCATAATTGGCCACAGG + Intergenic
933177924 2:79196581-79196603 TATTTTGTACAATTGCCCAGGGG + Intronic
935039607 2:99413618-99413640 CATCTTGCAGAATAGGACATAGG - Intronic
937786746 2:125908318-125908340 CAATAAGCACAATTGCCCATAGG - Intergenic
942898376 2:181085729-181085751 CCTTTTGCACAGGTGGCCTTAGG + Intergenic
943533883 2:189122836-189122858 CATTTTCCACTAGTGGCCTTTGG - Intronic
1170183198 20:13556414-13556436 CATTTTGCAAAGTTCTCCATGGG - Intronic
1171729397 20:28669136-28669158 CTTTTTGGAGAATTGGCCAGTGG + Intergenic
1171731874 20:28714459-28714481 CTTTTTGGAGAATTGGCCAGTGG + Intergenic
1171732208 20:28720611-28720633 CTTTTTGGAGAATTGGCCAGTGG + Intergenic
1171909984 20:30941875-30941897 CTTTTTGCAGAATTGGCAAGTGG - Intergenic
1174804328 20:53593362-53593384 CAATTTGCCCAGTTGGCCCTTGG - Intronic
1176475731 21:7203370-7203392 CTTTTTGGAGAATTGGCCAGTGG - Intergenic
1176758692 21:10749386-10749408 TATTTTCCACAAAAGGCCATAGG - Intergenic
1177465312 21:21470876-21470898 CCCTTTGCAAAATTTGCCATAGG - Intronic
1177644229 21:23881640-23881662 CATTTCCCACCATTGGGCATTGG - Intergenic
1181820603 22:25472463-25472485 CACCTGGCACAATTGGCCCTGGG + Intergenic
1182063207 22:27412613-27412635 AATCTTGAACAATTGGCCACAGG - Intergenic
1182807284 22:33084068-33084090 CATTTTCAACAATGGGCTATAGG - Intergenic
1182818541 22:33191164-33191186 TATTTTACACAACTGCCCATAGG + Intronic
1185213333 22:49584420-49584442 CATTTGGCACAGTTTGCCGTGGG - Intronic
950075927 3:10187237-10187259 CATTTTACAAAATGGGGCATCGG - Intronic
958199351 3:90289035-90289057 CATTTTGCAGAATCTGCAATGGG - Intergenic
963269593 3:143272689-143272711 CATTTTGCAAAATCTGCCGTTGG - Intronic
965912437 3:173795855-173795877 CATTTTGTAAAAATGGCCTTAGG + Intronic
967368636 3:188717219-188717241 CATGTTGCTGAATTGGTCATGGG + Intronic
978828906 4:113058705-113058727 CATTTTAAATTATTGGCCATTGG - Intronic
979201526 4:117985029-117985051 CATTTAGCACAATTGGCTTATGG - Intergenic
989841229 5:46073675-46073697 CCTTTTTCACCATTGGCCTTGGG - Intergenic
989899973 5:47156752-47156774 CTTTTTGCGGAATTTGCCATAGG + Intergenic
992963061 5:81974559-81974581 CATTTAAAACAATTGGCAATAGG - Intronic
995634996 5:114177856-114177878 CATTTTGATCAATTAGACATCGG + Intergenic
995773082 5:115693328-115693350 CATTTTTCTCAATTGCACATGGG - Intergenic
996177397 5:120376836-120376858 CATTGTGTAAAAATGGCCATAGG - Intergenic
998381327 5:141727748-141727770 CATTTTACACAGATGGTCATGGG - Intergenic
999346745 5:150829186-150829208 CATTCTGGACAATTGGCTTTGGG + Intergenic
1000820467 5:165976571-165976593 CATTTTGGAAAATTTCCCATGGG - Intergenic
1000850542 5:166334692-166334714 TATTTTGCACACATGCCCATAGG - Intergenic
1002568031 5:180124275-180124297 CATTTTGTAGAATTAGCCAGTGG - Intronic
1004030891 6:11868444-11868466 CATGGTGCACATTAGGCCATTGG + Intergenic
1007123298 6:39401470-39401492 CATTTTCCACTATGGGCAATTGG + Intronic
1009061723 6:58404158-58404180 GTTTTTGCACAATTGGCAAAGGG - Intergenic
1009094667 6:58962958-58962980 CATTTTGCATAATTTGCAATGGG + Intergenic
1010842696 6:80666090-80666112 CATTTTGTTCATTAGGCCATTGG + Intergenic
1013671724 6:112410667-112410689 CATTTTCCAAAATTGTCCAATGG - Intergenic
1018010382 6:159664793-159664815 CTTTTTGCACATTTGGGCCTTGG - Intergenic
1022154795 7:27649228-27649250 CATTTTGCACATTTGGTCAGAGG - Intronic
1022425189 7:30261954-30261976 CATTTTCTACAATTAGCAATAGG - Intergenic
1023031915 7:36097132-36097154 CATTTTAAACACTTGACCATAGG + Intergenic
1024762977 7:52622767-52622789 CATTTTTCACAATTGCCAAAAGG + Intergenic
1027970468 7:85074245-85074267 CTTTCTGCCCAAGTGGCCATAGG + Intronic
1031360451 7:120843504-120843526 CAGTTTGAACAATTGGCCTTGGG - Intronic
1037742950 8:21621904-21621926 CATTTTGCTCTGTTGGCCAGCGG - Intergenic
1040113722 8:43590082-43590104 CTTTTTGTACAAGTGGCAATGGG + Intergenic
1040348046 8:46529864-46529886 CATTTTTCACTATTTGCCTTGGG - Intergenic
1043601969 8:81951177-81951199 CATATTACACAACTGACCATTGG + Intergenic
1044204037 8:89470998-89471020 CATTCTGCAGAATTGGCTAAGGG - Intergenic
1045913961 8:107444091-107444113 CATCTGGCTCAATTGTCCATGGG + Intronic
1050325483 9:4493040-4493062 CATTTTGCAGACATGGCCTTTGG + Intronic
1051930641 9:22381099-22381121 CATTTTGCAGTCTTGGACATTGG - Intergenic
1052276417 9:26681658-26681680 CTTTTTGTTCAATTGGCCAGTGG + Intergenic
1053317792 9:37067187-37067209 GTTTTTGCAAAAATGGCCATTGG - Intergenic
1057295366 9:93831952-93831974 CATTATTCACAATTAGCCAAAGG - Intergenic
1059429898 9:114243640-114243662 CCCTTTTCACAACTGGCCATGGG - Intronic
1203404475 Un_KI270515v1:5501-5523 TATTTTCCACAATAGGCCACAGG - Intergenic
1203411164 Un_KI270579v1:6059-6081 CTTTTTGGAGAATTGGCCAGTGG - Intergenic
1186806113 X:13141255-13141277 AATTTTGAAGAATTGGCCATTGG - Intergenic
1187602934 X:20851809-20851831 CATTTTGGACTTTTGGCCTTTGG + Intergenic
1189486089 X:41433357-41433379 CAGAATGCACAATTGACCATTGG + Intergenic
1190988860 X:55524959-55524981 AATTTTACACAACTAGCCATTGG - Intergenic
1191565763 X:62527126-62527148 CTTTTTGCATAATTTGCAATTGG - Intergenic
1200957920 Y:8970285-8970307 CATTTTCCCCAAGTGGGCATGGG - Intergenic
1202597186 Y:26553038-26553060 CAATTTTCAAAATTGGCCAAGGG - Intergenic