ID: 1105592882

View in Genome Browser
Species Human (GRCh38)
Location 13:21810925-21810947
Sequence CTTCAAAACCCGAGGAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105592882 Original CRISPR CTTCAAAACCCGAGGAGCCT TGG Intergenic
900867076 1:5276227-5276249 CTCCAAGACCCCAGGATCCTAGG + Intergenic
902611736 1:17601950-17601972 CTTCTAAAGATGAGGAGCCTGGG + Intronic
904012032 1:27395454-27395476 CTTCCAAACCCGAGGAGGGCAGG - Exonic
904598634 1:31661970-31661992 CAGCAAAACCCCAGGAGCCAGGG + Intronic
910356776 1:86366348-86366370 GTTCAAAAGCCCAGGAGCCTAGG + Intronic
910989674 1:93042097-93042119 CTTCAAAATGCGAAGAACCTGGG - Intergenic
914720689 1:150286518-150286540 CTTTAAAACCAAAGCAGCCTTGG + Exonic
916019435 1:160779088-160779110 CATCAGAACCCCAGGAGCCAGGG - Intergenic
919297875 1:195723606-195723628 ATTCAGAACCAGAGGAGCTTAGG - Intergenic
919721875 1:200845766-200845788 CCTGAAAACCCAAGGACCCTGGG + Intronic
920968587 1:210722656-210722678 AATCAAATCCCCAGGAGCCTAGG - Intronic
921117534 1:212107933-212107955 CATCAAAAACAGAGTAGCCTGGG - Intergenic
923142853 1:231175872-231175894 TTTGCAAACCAGAGGAGCCTCGG - Intronic
924747172 1:246846962-246846984 CTTCAAAATCCAACCAGCCTGGG - Intronic
1063028761 10:2210277-2210299 CTACCAAACAGGAGGAGCCTCGG - Intergenic
1067484470 10:46634884-46634906 CTGCAAAGCCCGAGGACACTGGG - Intergenic
1067610290 10:47706764-47706786 CTGCAAAGCCCGAGGACACTGGG + Intergenic
1069631472 10:69899658-69899680 CTTCCTAACCCAAGGAGGCTTGG + Intronic
1069996357 10:72344423-72344445 CGTCTAAGCCTGAGGAGCCTTGG + Intronic
1074815359 10:117137988-117138010 CTTCGAGACCCGGGCAGCCTCGG + Exonic
1075924804 10:126242736-126242758 CTTGAAATCCTGAGGAGCCTGGG - Intronic
1083160341 11:60850457-60850479 CTTCAAAGGCCGAGGAGCCCCGG - Exonic
1087990298 11:104740732-104740754 CTCCAAAACCAGAGAAGACTCGG - Intergenic
1088844231 11:113651530-113651552 CTTAATAACCAGAGGAGCCTAGG + Intergenic
1089533708 11:119148639-119148661 TTTCAAAAACGCAGGAGCCTTGG - Intergenic
1095459339 12:42425680-42425702 TTTAAAAACCTGAGGAGGCTGGG - Intronic
1096875676 12:54628592-54628614 CATCAAAAGCCTAGGAGCCCAGG + Intergenic
1103947112 12:124532791-124532813 CTTCAAAGCCCCATGAGCCTAGG + Intronic
1105578644 13:21674484-21674506 CTTCACAACCGGGGGAGCCCGGG + Intronic
1105592882 13:21810925-21810947 CTTCAAAACCCGAGGAGCCTTGG + Intergenic
1108036407 13:46294546-46294568 CCTCAAAACCCCAGGAACCTGGG + Intergenic
1113472047 13:110554151-110554173 CTGCAAAACACGTGGAGCCAGGG - Intronic
1113673862 13:112195066-112195088 CTTCACAGCACCAGGAGCCTGGG - Intergenic
1120980920 14:90288273-90288295 CTGCCAAACCCTTGGAGCCTTGG - Exonic
1131336763 15:91556299-91556321 GTTCACCACCCGAGGTGCCTCGG - Intergenic
1131345981 15:91648441-91648463 CTCCATCACACGAGGAGCCTGGG + Intergenic
1131360951 15:91789943-91789965 CAGCAAAACTCCAGGAGCCTTGG + Intergenic
1132829921 16:1923004-1923026 CCTCAAAACCCCTGGGGCCTTGG - Intergenic
1139835953 16:69838683-69838705 CTTCAAAAGCCAAGGAGTATGGG - Intronic
1140723231 16:77789165-77789187 CTTCCAGACCCGGGGTGCCTGGG - Intronic
1141748492 16:85942401-85942423 TTTCAAAAGCCGAGGAGCGTGGG + Intergenic
1143509833 17:7389272-7389294 CTTCAGAAGCCAAGGAGCATGGG - Exonic
1151077392 17:71289086-71289108 CTACATGACCCGGGGAGCCTGGG + Intergenic
1161272020 19:3395061-3395083 CTTGAAAATCCAAGGAGGCTGGG + Intronic
1161410690 19:4115551-4115573 CTTCCAAACCGGAGCAGCCTTGG - Intronic
1164147858 19:22523477-22523499 CCCCCAAACCAGAGGAGCCTTGG + Intronic
925115063 2:1371648-1371670 TGTCAAAACCAGAGGAGCCAAGG + Intergenic
926087150 2:10027709-10027731 CTCCAAACCCCGAGGACCCGTGG + Intergenic
927695264 2:25235512-25235534 CTTAAAATACCCAGGAGCCTGGG + Intronic
929982668 2:46696571-46696593 CTTCAAACCCAGAGAACCCTGGG - Intergenic
929997703 2:46839265-46839287 CTTCAATCCAAGAGGAGCCTGGG - Intronic
936515411 2:113178344-113178366 CTGCAGCACCTGAGGAGCCTGGG - Intronic
945023533 2:205597795-205597817 CTTAAAAACCAGAAGAGACTGGG + Intronic
947049239 2:226023628-226023650 CTCCAAAACCCTAGTAGCCGAGG + Intergenic
948781099 2:240322420-240322442 CTTCAAAACCCGTGGTGTCCTGG - Intergenic
1170998389 20:21388637-21388659 TTTCAAAACCCTAGAGGCCTAGG + Intronic
1172046522 20:32084436-32084458 CTTCCAAGCCCCAGAAGCCTTGG + Exonic
1174185970 20:48706586-48706608 GTTCAAAACCGGAGGAGACAGGG - Intronic
1175082214 20:56430156-56430178 CATCTAAACCCGAGCAGCCAAGG - Intronic
1180736309 22:18020209-18020231 CTGCAAAACCTGAGGACACTGGG + Intronic
1183432612 22:37774799-37774821 CTTCAAAGTCTGAGGAGCCCTGG + Exonic
1184131532 22:42519564-42519586 CCTCAAGACCTGCGGAGCCTGGG + Intronic
1184141754 22:42581780-42581802 CCTCAAGACCTGCGGAGCCTGGG + Intergenic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
950303276 3:11899854-11899876 CTTCAAACCCAGAGGAGACGTGG - Intergenic
950506783 3:13400001-13400023 CTTCAAACCCAGAGGAGACGTGG + Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
965938093 3:174140474-174140496 CCTCAAAACCCTAGGAGACAGGG + Intronic
968582758 4:1402624-1402646 GGCCAACACCCGAGGAGCCTTGG + Intergenic
975874409 4:78819004-78819026 CTTCAAAACCTGACCAGCCTGGG - Intronic
982014966 4:151144574-151144596 CTTCAAACCCCCAGGGGACTTGG - Intronic
983157334 4:164365942-164365964 GATCAAAACTTGAGGAGCCTGGG - Intronic
991200670 5:63987835-63987857 CTTCTAAACCTGAGGGGCCAAGG - Intergenic
1002771748 6:295977-295999 CTTCAAAATCAGTGGAGACTGGG - Intronic
1005213567 6:23498034-23498056 GTTCAAAACCCTGGCAGCCTAGG - Intergenic
1007823787 6:44582077-44582099 CTTGAAGACCTGAGGAGCCCAGG - Intergenic
1008504805 6:52219572-52219594 CATCAAAAGCCCAGGGGCCTAGG + Intergenic
1009926430 6:70126422-70126444 CCTCAAAGCCAGTGGAGCCTGGG - Intronic
1011941178 6:92845550-92845572 CCCCAAAACCCCAGGACCCTGGG - Intergenic
1016722822 6:147322488-147322510 CATCAAAACACGAGGTGCCATGG + Intronic
1018617797 6:165704266-165704288 CTTCAAAGAGAGAGGAGCCTGGG + Intronic
1022432788 7:30343102-30343124 GTTCAAGACCCGACCAGCCTGGG + Intronic
1027001391 7:74657233-74657255 CTGCAAAAGCCGGGGAGCCCCGG - Intergenic
1028124708 7:87099388-87099410 CTTCAAAACCAGCTGAGGCTAGG - Intergenic
1029275147 7:99399531-99399553 CTTCAAAAACCCAGCAACCTGGG - Intronic
1034307137 7:150053133-150053155 CTCCAAAAACCTAAGAGCCTTGG - Intergenic
1034799710 7:154047549-154047571 CTCCAAAAACCTAAGAGCCTTGG + Intronic
1037754610 8:21702883-21702905 CTTCTCCACCCGAGGGGCCTGGG + Exonic
1038467364 8:27776874-27776896 GCTCAGAACCCGAGGAGCATTGG - Exonic
1040483059 8:47843710-47843732 CTTAAAAACCAGAAGAGACTGGG + Intronic
1043432285 8:80206591-80206613 CTTCTAAACCAGAGCAGCCTGGG + Intronic
1049302049 8:141876430-141876452 CTTGAAGACGCGGGGAGCCTGGG - Intergenic
1057411171 9:94817551-94817573 TTTCAAAGCCCCAGGAGCCAAGG - Intronic
1061277485 9:129577730-129577752 TTTCAAAACTGGAGGAACCTTGG + Intergenic
1062153315 9:135032566-135032588 CTTCAAGACTGGAGAAGCCTGGG - Intergenic
1188911095 X:35848854-35848876 GTTCAAAACCAGAAGAACCTGGG + Intergenic
1190131508 X:47752577-47752599 CTCCAAAACCCAGGGACCCTGGG - Intergenic
1192249220 X:69397190-69397212 CTTAAAAGGCCAAGGAGCCTGGG - Intergenic
1198256966 X:134932390-134932412 CGTCAAAACCCAAGAAGACTGGG - Intergenic
1199412626 X:147542401-147542423 CTGCAAAGCCAGAGTAGCCTTGG + Intergenic