ID: 1105600023

View in Genome Browser
Species Human (GRCh38)
Location 13:21878504-21878526
Sequence CAGTGTGACTGAGGGGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 6, 3: 106, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105600023_1105600032 13 Left 1105600023 13:21878504-21878526 CCCTATGCCCCTCAGTCACACTG 0: 1
1: 0
2: 6
3: 106
4: 326
Right 1105600032 13:21878540-21878562 CCTTTACTCCTGAACCCAGCTGG 0: 1
1: 0
2: 3
3: 20
4: 140
1105600023_1105600035 23 Left 1105600023 13:21878504-21878526 CCCTATGCCCCTCAGTCACACTG 0: 1
1: 0
2: 6
3: 106
4: 326
Right 1105600035 13:21878550-21878572 TGAACCCAGCTGGCTCACAAGGG 0: 1
1: 0
2: 0
3: 12
4: 126
1105600023_1105600034 22 Left 1105600023 13:21878504-21878526 CCCTATGCCCCTCAGTCACACTG 0: 1
1: 0
2: 6
3: 106
4: 326
Right 1105600034 13:21878549-21878571 CTGAACCCAGCTGGCTCACAAGG 0: 1
1: 0
2: 1
3: 12
4: 231
1105600023_1105600036 24 Left 1105600023 13:21878504-21878526 CCCTATGCCCCTCAGTCACACTG 0: 1
1: 0
2: 6
3: 106
4: 326
Right 1105600036 13:21878551-21878573 GAACCCAGCTGGCTCACAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105600023 Original CRISPR CAGTGTGACTGAGGGGCATA GGG (reversed) Intergenic
900753039 1:4411755-4411777 GAATTCGACTGAGGGGCATAAGG + Intergenic
901029591 1:6299207-6299229 CAAGGTGACTGAGGAGCAAATGG + Intronic
903019643 1:20385085-20385107 CAGTGTGACTGAGTGGAGAAGGG - Intergenic
903885799 1:26540365-26540387 CTGTGTGACCAAGGGGCTTAAGG - Intronic
905715744 1:40148204-40148226 CAGTGTGACTGATGAGCCAACGG - Intergenic
906799219 1:48721489-48721511 CAGTGTGACTGTTGGCAATACGG + Intronic
906831378 1:49035302-49035324 GAATTTGATTGAGGGGCATAAGG + Intronic
907325066 1:53632400-53632422 GAGTGTGACTGAGGGGCATGTGG + Intronic
909084369 1:71154299-71154321 GAATTTGACTGAGGAGCATAAGG - Intergenic
909100499 1:71342593-71342615 GAATTTGACTGAGGGGCATAAGG + Intergenic
909713054 1:78673894-78673916 GAGTTTAACTGAGGGGCATAAGG + Intergenic
910365398 1:86459878-86459900 GAATTTGACCGAGGGGCATAAGG + Intergenic
911960505 1:104296210-104296232 CAGTTGGCATGAGGGGCATAAGG - Intergenic
912187168 1:107292274-107292296 AAATTCGACTGAGGGGCATAAGG + Intronic
912237337 1:107866255-107866277 GAATTCGACTGAGGGGCATAAGG - Intronic
912626977 1:111213417-111213439 GATTTTGACTGAGGGGAATAAGG + Intronic
914318820 1:146539898-146539920 GAATTTGACTGAGGGGCATAAGG + Intergenic
914495538 1:148193459-148193481 GAATTTGACTGAGGGGCATAAGG - Intergenic
915708430 1:157869730-157869752 CATTGTCAGTGAGGGGCAGATGG + Intronic
915839838 1:159205014-159205036 CAGGGGAAATGAGGGGCATAGGG - Intronic
916256673 1:162794926-162794948 CAGTGAGGCTGTGGGGCAGAAGG + Intronic
916706513 1:167356631-167356653 GAATTCGACTGAGGGGCATAAGG + Intronic
918531482 1:185527062-185527084 GAGTGTGAGTGAGGGACTTATGG + Intergenic
919746007 1:201009539-201009561 CAGTGTGAGGGAGGGGCCTGTGG - Intronic
922875396 1:228936425-228936447 AAATTCGACTGAGGGGCATAAGG - Intergenic
923979993 1:239310757-239310779 CAGGGTAACTGAGGGGCCCATGG - Intergenic
924298275 1:242611168-242611190 GAATTTGACTGAGGGGCAGAAGG + Intergenic
1063786579 10:9391917-9391939 GAATTTGACTGAGGGGCATAAGG + Intergenic
1065209608 10:23390133-23390155 GAATTTGACTAAGGGGCATAAGG + Intergenic
1065309269 10:24398474-24398496 CAATTTGACTGAGGGGCCTAAGG + Intronic
1065640349 10:27776064-27776086 GAATGCGACTGAGGGGCATAAGG + Intergenic
1066289263 10:33998941-33998963 GAATTCGACTGAGGGGCATAGGG + Intergenic
1066723134 10:38360583-38360605 CAGTGAGGCTGTGGGGCAGAAGG + Intergenic
1067684509 10:48458474-48458496 CAGTGTGGGTGAGGCGCAGACGG + Intronic
1067893936 10:50159860-50159882 GAATTTGACGGAGGGGCATAAGG - Intergenic
1067954909 10:50780404-50780426 GAATTTGACTGAGGGGCATAAGG + Intronic
1068191989 10:53664622-53664644 GAATTTGACTGAGGGGCATAGGG + Intergenic
1068438520 10:57020933-57020955 GAATTTGACTGAGGGGCATAAGG - Intergenic
1068497103 10:57796394-57796416 GAATTTGACTGAGGGGCATAAGG - Intergenic
1068506431 10:57905796-57905818 CAGTGTGAGTGATGGGCAGTGGG - Intergenic
1069107136 10:64397093-64397115 GAATTTGACTCAGGGGCATAAGG + Intergenic
1069174318 10:65271335-65271357 GAATTCGACTGAGGGGCATAAGG + Intergenic
1069330288 10:67283766-67283788 GAATTTGACCGAGGGGCATAAGG - Intronic
1069786751 10:70993153-70993175 CATTGAGACTGCGGGGCAGAAGG - Intergenic
1071823763 10:89303937-89303959 GAGTGTGACTGAGATGCACATGG + Intronic
1072781079 10:98252389-98252411 CAAGGTGGCTGAGGGGCACAAGG - Exonic
1072987409 10:100153327-100153349 CAGTGTGACAGAGGGAGATCTGG - Intronic
1073338661 10:102729159-102729181 CACTGTGAGTGAGGGGGAGAGGG + Intronic
1073516428 10:104079520-104079542 CAGTGTGAATGAGAGTCATGTGG - Intronic
1074002690 10:109388355-109388377 GAATTTGACTGAGGGGCATAAGG - Intergenic
1075618986 10:123911898-123911920 GAATTCGACTGAGGGGCATAAGG + Intronic
1077753731 11:5003042-5003064 GAAATTGACTGAGGGGCATAAGG + Intergenic
1078281265 11:9903517-9903539 GAATTGGACTGAGGGGCATAAGG + Intronic
1078367089 11:10715745-10715767 CAGTGTGGAGGAGGGGGATACGG - Intergenic
1078691800 11:13588327-13588349 CAGTATGATTGATGGGCATTTGG - Intergenic
1081159021 11:39731300-39731322 GAATTTGACTGAGGGGCATAAGG + Intergenic
1081749695 11:45501212-45501234 CAGAGTGACCGAGTGGGATAGGG - Intergenic
1082942725 11:58725601-58725623 GAATTTGACTGAGGGGCAGAAGG + Intronic
1084024237 11:66437957-66437979 CAGTGAGATGGAGGGGCAAAGGG + Intronic
1085044366 11:73344544-73344566 GAGTGTGGCTGAGGGGCCCAGGG + Intronic
1085471466 11:76761109-76761131 CAGTGGGAATGAGGGGCAGCAGG - Intergenic
1086537539 11:87866158-87866180 CAGGGAGAGTGTGGGGCATAGGG + Intergenic
1086986524 11:93255995-93256017 CAGTGTGGCTCAGGAGCAGATGG + Intergenic
1087797507 11:102470075-102470097 GAATTTGACTGAGGGGCATAAGG - Intronic
1088384099 11:109233473-109233495 CACGGCGACTGAGGGACATATGG - Intergenic
1089298432 11:117483380-117483402 AACTTTGACTGAGGGGCATCAGG + Intronic
1090980236 11:131713765-131713787 GACTTAGACTGAGGGGCATAAGG + Intronic
1091757940 12:3067508-3067530 CAATTCGACTGAGGGGCATAAGG - Intergenic
1094201073 12:27794998-27795020 CAGGGGGACTGAGGGGCCCATGG - Intronic
1095314748 12:40746424-40746446 GAATTTGACTGAGGGGCATAAGG + Intronic
1095383266 12:41619389-41619411 CAGTGTGACTCTGGAGCATAAGG + Intergenic
1097134147 12:56837341-56837363 GAATTTGACTGAGGGGCATAAGG + Intergenic
1097451469 12:59741898-59741920 TAATTTGACTGAGGGGCATAAGG + Intronic
1098659564 12:73075377-73075399 CAGTGTCACAGAGGTGCAGATGG - Intergenic
1099102368 12:78458833-78458855 GAATTTGACTGTGGGGCATAAGG + Intergenic
1099401946 12:82211192-82211214 CACTGTGACTCAGGGATATAAGG + Intergenic
1099687805 12:85911396-85911418 TAATTTAACTGAGGGGCATAAGG - Intergenic
1100135791 12:91551965-91551987 TAATTTGACTGAGGGGCGTAAGG + Intergenic
1100569969 12:95838099-95838121 CAATTTGACTGAGGGGCAGAAGG + Intergenic
1101280827 12:103253737-103253759 GAATTTGACTGAGGGGCATAAGG - Intronic
1101296745 12:103431862-103431884 GAATTTAACTGAGGGGCATAAGG + Intronic
1101475494 12:105043095-105043117 CAGTCTGAATGAAGGTCATATGG + Intronic
1103554759 12:121759322-121759344 GAATTTGACTGAGGGGCATAAGG + Intronic
1104067974 12:125320779-125320801 CATTGGGACTGTGGGGAATATGG + Intronic
1104833876 12:131774111-131774133 CAGTGTGGCTGCGGGGCACGGGG + Intronic
1104836915 12:131797642-131797664 CAGTGTGCCTGGTGGGCATCAGG - Intronic
1104893947 12:132152861-132152883 CAGTGTGACTGGGGGGAGTTTGG + Intergenic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1106711766 13:32343451-32343473 CAGAATGACTTAGGGGCAAAAGG - Intronic
1108353076 13:49604957-49604979 GAACTTGACTGAGGGGCATAAGG - Intergenic
1109176830 13:59167467-59167489 GAATTTGACGGAGGGGCATAAGG + Intergenic
1109359939 13:61282635-61282657 GAATTTGACTGAGGGGTATAAGG + Intergenic
1110519927 13:76463695-76463717 CAGTGAGGCTGAGTGGCACATGG - Intergenic
1110937360 13:81307645-81307667 GAATTTGACTGAGGGGCATGAGG - Intergenic
1111151157 13:84254856-84254878 GAATTTGACTGAGCGGCATAAGG - Intergenic
1111344119 13:86926330-86926352 GACTTTGACTGAGGAGCATAAGG + Intergenic
1111434127 13:88184235-88184257 GATTTTGACTGAGGGGCATAAGG - Intergenic
1111798872 13:92958266-92958288 CAATTTGACTGAGGGGCATAAGG - Intergenic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1113480394 13:110615951-110615973 CGGGGTGACAGAGGGGCAGAGGG + Intronic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1115887956 14:37994633-37994655 GAATTTGACTGAGGGGCATAAGG - Intronic
1116064947 14:39970802-39970824 CAATTTGACCAAGGGGCATAAGG - Intergenic
1116173321 14:41430639-41430661 GAATTCGACTGAGGGGCATAAGG - Intergenic
1116276413 14:42839277-42839299 GAATTTGACTGAGGGGCATAAGG - Intergenic
1116341260 14:43726164-43726186 GAATTTGACTGAGGGGCATAAGG - Intergenic
1116479592 14:45382699-45382721 AAATTTGACTGATGGGCATAAGG + Intergenic
1116566175 14:46446942-46446964 GAATTCGACTGAGGGGCATAAGG - Intergenic
1116708584 14:48335571-48335593 AAATTTGACTGAGGGGCAGAAGG - Intergenic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1119064764 14:71514024-71514046 AAAATTGACTGAGGGGCATAAGG + Intronic
1119214313 14:72856836-72856858 CACAGTTACTGAGGGGCACAGGG - Intronic
1119298443 14:73552160-73552182 GAATTTGACTGAGGGGCATAAGG - Intronic
1119302740 14:73584347-73584369 GAATTTGACTGAGGGGCATAAGG - Intergenic
1119596974 14:75944120-75944142 GAATTTGACTGAGGGGCATAAGG - Intronic
1120028081 14:79608507-79608529 CAGTGAAACTGAGGGGCAGCAGG - Intronic
1120403417 14:84063203-84063225 AAGTGTGACTGAGGGGGAGCTGG + Intergenic
1120477591 14:85008044-85008066 TAATTTCACTGAGGGGCATAAGG + Intergenic
1120970000 14:90199276-90199298 GAATTTGACTGAGGGGCATAAGG - Intergenic
1121004278 14:90478452-90478474 GAATTTGACTGAGGGGCATAAGG + Intergenic
1122680382 14:103456411-103456433 AAGTGTGAATGAGGGGAAGAGGG - Intronic
1123778304 15:23601951-23601973 GAATTCGACTGAGGGGCATAAGG + Intronic
1126597011 15:50393049-50393071 GAATTTGACTGAGGGGCATAAGG - Intergenic
1128849835 15:70943306-70943328 GAATTTGACTGAGGGGCATAAGG + Intronic
1129804018 15:78438791-78438813 CAGAGAGACTGAGGGGCCTTAGG - Intronic
1130015230 15:80180915-80180937 CAGGGTCTCTGAGGGGCATGAGG + Intronic
1131010059 15:89009828-89009850 GGTTTTGACTGAGGGGCATAAGG - Intergenic
1131047674 15:89326476-89326498 CAGTGTGACTGAATGGCAGCAGG + Intronic
1131721823 15:95177597-95177619 CAGTGTGGCTAAAGGGTATATGG - Intergenic
1136241590 16:28947903-28947925 CTGTGTGACTGTGGGGCAACAGG + Intergenic
1136853644 16:33634910-33634932 TAATTTGACTGAGGGGCAGAAGG + Intergenic
1137386925 16:48050397-48050419 GAATTTGTCTGAGGGGCATAAGG - Intergenic
1138522844 16:57581384-57581406 GAGTTTGACTGAGGGGTATAAGG + Intronic
1138748282 16:59389175-59389197 GAATTCGACTGAGGGGCATAAGG + Intergenic
1140128057 16:72134216-72134238 GAATTTGACTGAGGGGCAGAAGG - Intronic
1141196562 16:81865576-81865598 CAGAGAGACTGAGGGGCCTGGGG - Intronic
1203115235 16_KI270728v1_random:1483355-1483377 TAATTTGACTGAGGGGCAGAAGG + Intergenic
1143846407 17:9775565-9775587 CAGGGTCACTGAGGGGCCCAGGG - Intronic
1144147691 17:12414095-12414117 CAGAGGGACAGGGGGGCATATGG + Intergenic
1144209971 17:13005902-13005924 CAGTGTGAGTGTGGGGGGTAAGG - Exonic
1144300589 17:13919892-13919914 GAATTTGACTGAGGGGCATAAGG - Intergenic
1147723082 17:42550521-42550543 CACTGTCACAGAGGGGCAAAGGG - Exonic
1147724294 17:42556747-42556769 CACTGTCACAGAGGGGCAAAGGG - Intergenic
1148747228 17:49925272-49925294 CAGTCTGAGTGAAAGGCATAGGG - Intergenic
1148956818 17:51361047-51361069 GAATTTGACTGAGGGGCATAAGG + Intergenic
1149501107 17:57153099-57153121 GAGTGTGACTGAAGAGCATGAGG + Intergenic
1149799562 17:59554769-59554791 TAATTCGACTGAGGGGCATAAGG + Intergenic
1150827891 17:68492727-68492749 GAATTTGACTGAGGGGCATAAGG + Intergenic
1151572469 17:74933739-74933761 CAGTATGACCGTGGGGCATGAGG + Exonic
1153539260 18:6136308-6136330 CAGGGTGACTCAGGAGAATAGGG + Intronic
1154044821 18:10894834-10894856 GAATCTGACTGAGGGGCACAAGG - Intronic
1156291233 18:35750225-35750247 GAATTTGACTGACGGGCATAAGG + Intergenic
1156644293 18:39141144-39141166 TAATTTGACTGACGGGCATAAGG - Intergenic
1158935062 18:62356877-62356899 CAGTGTTACTAAGAGTCATATGG + Intronic
1159324957 18:66902758-66902780 AAATTTGACTGAGGGGCATAAGG - Intergenic
1159654423 18:71014792-71014814 GCATTTGACTGAGGGGCATAAGG - Intergenic
1159745671 18:72231972-72231994 GAATTCGACTGAGGGGCATATGG + Intergenic
1159903529 18:74069804-74069826 GAGTCTGAATGACGGGCATATGG - Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG + Intergenic
1161714579 19:5868122-5868144 CAGTGTGTCTGAGGGCCAGAGGG - Intronic
1162117786 19:8442027-8442049 CAGTGTGATTGAGGGGCAGGTGG + Intronic
1164465612 19:28485107-28485129 GAATTTGACTAAGGGGCATAAGG + Intergenic
1165323871 19:35102797-35102819 CAGAGTGAGTGAGGGGCAGGTGG - Intergenic
1165573016 19:36791454-36791476 CAGTGGGGCTGAGGGGAGTAGGG - Intergenic
1165941214 19:39415593-39415615 CCGAGTGAGGGAGGGGCATAGGG + Intronic
1166418503 19:42614173-42614195 GAATTTGACTAAGGGGCATAAGG - Intronic
1167222974 19:48215157-48215179 GAATTTGACTGAGGGGCATAAGG - Intronic
1168087147 19:54056583-54056605 CAGGGTCAATGAGGGGCAGAGGG - Intronic
1168517890 19:57023662-57023684 GAATTTGACTGTGGGGCATAAGG - Intergenic
925497638 2:4469878-4469900 CCATGTGACTGAGTGGCAGATGG + Intergenic
925552794 2:5094230-5094252 AAATTTGACTGAGGGGCATAAGG - Intergenic
926439570 2:12874111-12874133 GTATTTGACTGAGGGGCATAAGG + Intergenic
927351530 2:22123007-22123029 GAATTTGACTGAGGGGCATAAGG - Intergenic
927636341 2:24819959-24819981 CAGTGTGACAGAGGGGCCATTGG + Exonic
928650552 2:33399736-33399758 GAATTTGACTGAGGGGTATAAGG + Intergenic
928854941 2:35791683-35791705 GAATTTGACTGAGGGGCATAAGG - Intergenic
930591050 2:53326757-53326779 GAATTTGACTGAGGGGCACAAGG - Intergenic
930755853 2:54971298-54971320 AAGTGTGACTGAGGGGCTTACGG - Exonic
931246437 2:60496317-60496339 TGGTGTTACTGAGGGGCAAAGGG + Intronic
932005588 2:67924003-67924025 CAATTCGAGTGAGGGGCATAAGG - Intergenic
932870223 2:75390943-75390965 CAATTTGACTGAGGGGCATAAGG + Intergenic
933069189 2:77836339-77836361 GAATTTGGCTGAGGGGCATAGGG - Intergenic
933688809 2:85163400-85163422 CTGGGTGATGGAGGGGCATAGGG - Intronic
933840111 2:86279645-86279667 CAGTGAGCCTGAGGGAGATATGG + Intronic
934165686 2:89292141-89292163 GAATGCGACTGAGGGGCATAAGG - Intergenic
934201591 2:89890315-89890337 GAATGCGACTGAGGGGCATAAGG + Intergenic
935299965 2:101685612-101685634 GAATTTGACTGAGCGGCATAAGG + Intergenic
935489732 2:103702786-103702808 AAGTGTGACTGTGGGTCATCTGG - Intergenic
935957440 2:108391442-108391464 CAACTTGACTGAGGAGCATAAGG - Intergenic
936840614 2:116764081-116764103 GAATTCGACTGAGGGGCATAAGG + Intergenic
937543292 2:122985949-122985971 CAGTGGGACTGAGGCCCACAGGG - Intergenic
938290757 2:130148858-130148880 GAATTCGACTGAGGGGCATAAGG + Intergenic
939577172 2:143909575-143909597 AAGTTTGACCGAGGGGCATAAGG - Intergenic
939858475 2:147389565-147389587 GAATTTGACTGAGGGGCATAAGG - Intergenic
940109859 2:150139614-150139636 GAGTGTGACTTTGGGACATACGG - Intergenic
940868440 2:158839475-158839497 GAATGGGACTGAGGGGCATAAGG - Intronic
943068914 2:183118682-183118704 GAATCTGACTAAGGGGCATAAGG + Intronic
943903018 2:193465442-193465464 GAATTCGACTGAGGGGCATAAGG + Intergenic
943905160 2:193490067-193490089 GAATTTGACTGAGGGGTATAAGG - Intergenic
944586167 2:201175743-201175765 GAATTTGACTGAGGGGCATAAGG + Exonic
946563943 2:220942396-220942418 CTGTGTCACTGAGGGGCTTCTGG + Intergenic
947100260 2:226613223-226613245 CAGTGGGCATGAGGGGCATGTGG - Intergenic
947612284 2:231531544-231531566 CAGTGTGATTCTGGGGCATGGGG - Intergenic
948925409 2:241093403-241093425 CTGTGTGGCTGAGGGGCTTGAGG - Exonic
948993345 2:241565394-241565416 CAGTGGGCCTGAGGGGCAGAAGG - Intronic
1168831176 20:846001-846023 CACTGTGAGTGAGGGGCCAAGGG + Exonic
1169028006 20:2386125-2386147 CAGTGAGACTGACGGGCATGGGG - Intronic
1169708717 20:8537103-8537125 GAATTTGACTGAGGGGCATAAGG + Intronic
1171094203 20:22315897-22315919 CAGGGAGACTGAGGGGCCTCTGG + Intergenic
1171880701 20:30615983-30616005 CAGTGTGTCTTGGGGCCATAAGG - Intergenic
1173064690 20:39699200-39699222 CAGTGTTAGTGGGGAGCATATGG - Intergenic
1173247584 20:41347314-41347336 CAGTGTGAGTGAGGGAGAGATGG + Intronic
1173394023 20:42661315-42661337 CAATGAGACTAAAGGGCATATGG + Intronic
1174128378 20:48325382-48325404 TAGTGTGTCTGAGGGGCAGGGGG - Intergenic
1175322186 20:58096984-58097006 CAGGATGAATGAGGGGCAGAAGG - Intergenic
1175631004 20:60536378-60536400 GAATTTGACTGAGGGGCAGAAGG + Intergenic
1175791550 20:61743448-61743470 CAGTGGGCATGAGGGGCATGAGG - Intronic
1177024436 21:15904832-15904854 AGATTTGACTGAGGGGCATAAGG - Intergenic
1177547663 21:22579472-22579494 GAATTAGACTGAGGGGCATAAGG - Intergenic
1177559300 21:22729745-22729767 GAATTTGACTGAGGGGCATAAGG + Intergenic
1178524805 21:33318553-33318575 AAATTCGACTGAGGGGCATAAGG - Intergenic
1178837558 21:36111681-36111703 GAATTTGACTGAGGGGCATAAGG - Intergenic
1179047623 21:37860619-37860641 CAGTGTGAGTGATGGGGAGAAGG - Intronic
1179054735 21:37920636-37920658 GAATTCGACTGAGGGGCATAAGG - Intergenic
1179254819 21:39706497-39706519 GAATTTGACTGAGGGGCATAAGG + Intergenic
1179619136 21:42601125-42601147 GAATTAGACTGAGGGGCATAAGG + Intergenic
1181339308 22:22165672-22165694 CTGTGTAAGTGAGGGGCAGAAGG + Intergenic
1184499752 22:44864495-44864517 GAGTTCAACTGAGGGGCATAAGG + Intergenic
949676453 3:6459837-6459859 GAACTTGACTGAGGGGCATAAGG + Intergenic
950021371 3:9789978-9790000 AAGTGTCACTGAGGGGGAGAAGG + Intronic
950373443 3:12550703-12550725 GAATTCGACTGAGGGGCATAAGG - Intronic
951722658 3:25717389-25717411 CAGTGTCATTGATGGGCATTTGG - Intergenic
952454132 3:33457107-33457129 AAATTCGACTGAGGGGCATAAGG + Intergenic
952675818 3:36029194-36029216 GAATTTGACTGAAGGGCATAAGG + Intergenic
953194546 3:40720232-40720254 GAATTTGTCTGAGGGGCATAAGG - Intergenic
953259335 3:41322394-41322416 AAATTTGTCTGAGGGGCATAAGG - Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
953812363 3:46124215-46124237 GAATTTGACTAAGGGGCATAAGG - Intergenic
954292687 3:49658112-49658134 CGGTGGGGCTGAGGGGCTTAGGG - Exonic
954349979 3:50035160-50035182 CAATTTGACTGAGGGTCATAAGG + Intronic
954645667 3:52130209-52130231 CCCTCTGACTGAGGGGCATGTGG - Intronic
954889574 3:53912932-53912954 GAATTTGACTGAGGGGCATAAGG + Intergenic
955319999 3:57967631-57967653 GAATTTGACTGAGGGGCAAAAGG + Intergenic
956882357 3:73523575-73523597 AAGTTTTACTGAGGGTCATAAGG + Intronic
957130971 3:76222253-76222275 GAATCTGACTGAGAGGCATAAGG + Intronic
958435422 3:94089852-94089874 GAATTAGACTGAGGGGCATAAGG - Intronic
959649532 3:108738129-108738151 GAATTTGACGGAGGGGCATAAGG - Intergenic
961326301 3:126111417-126111439 CAGTGAGACTCAGGGGCAGCGGG - Intronic
961978665 3:131054007-131054029 CAGTGTGTCTTAGGGACAGAGGG + Intronic
962215260 3:133515483-133515505 CAATGTGACTGTGGTACATAAGG - Intergenic
962246613 3:133800528-133800550 AAGTGTGACTGATGGATATAGGG + Intronic
962475693 3:135753190-135753212 TAGTGTGACGGAGGAGCACAGGG + Intergenic
962897790 3:139731506-139731528 CCATGTGACTGAGCGTCATATGG - Intergenic
963230745 3:142906661-142906683 GAATTCGACTGAGGGGCATATGG - Intergenic
963458058 3:145572678-145572700 GAATTTGACTGAGTGGCATAAGG + Intergenic
964862366 3:161216975-161216997 GAATTTGACTGAGGGGCATAAGG - Intronic
965711386 3:171559517-171559539 CAGGGTGACTGTGGGGCCTTGGG - Intergenic
966983955 3:185162970-185162992 CAGTGTGCTTGAGGGGTATGTGG + Intergenic
967462029 3:189758667-189758689 GAATGCAACTGAGGGGCATAAGG - Intronic
968341195 3:197957304-197957326 CAGTGTGACAGAGGGACCTCTGG - Intronic
968609628 4:1551133-1551155 CAGTGTGTCTAAGGGCCATGGGG + Intergenic
969348435 4:6583630-6583652 GAATTCGACTGAGGGGCATAAGG + Intronic
970422757 4:15920493-15920515 GAATTTGACAGAGGGGCATAAGG - Intergenic
970471103 4:16380048-16380070 GAATTAGACTGAGGGGCATAAGG + Intergenic
971279363 4:25229835-25229857 CAATTCCACTGAGGGGCATAAGG + Intronic
971787157 4:31119475-31119497 GAATTTGACTCAGGGGCATAAGG + Intronic
971860354 4:32094092-32094114 GAATTTGACTGAGGGGCATAAGG + Intergenic
971955823 4:33416949-33416971 GAATTTGACTGAGGGGCATAAGG - Intergenic
972241875 4:37202236-37202258 GAATTTGACTGAGGGGCATAAGG - Intergenic
972865031 4:43221544-43221566 GAATACGACTGAGGGGCATAAGG + Intergenic
974453654 4:62098039-62098061 CAGTGTGGCTGAGAGGAATGTGG - Intergenic
974462350 4:62204572-62204594 GAATTTGACTGAGGGGCATAAGG - Intergenic
974505600 4:62767084-62767106 CACTGTGACTGAGTGGTACATGG + Intergenic
974691234 4:65300079-65300101 GAATTTGACTGAGGGGCATAAGG + Intergenic
974840090 4:67289371-67289393 GAATTTGACTGAGGGGAATAAGG - Intergenic
974876570 4:67710154-67710176 GAATTTGACTGAGGGGCATAAGG + Intergenic
974945297 4:68519624-68519646 GAATTTGACTGAGCGGCATAAGG - Intergenic
975397636 4:73895533-73895555 TAATTTGACGGAGGGGCATAAGG - Intergenic
975703463 4:77089000-77089022 GAATTTGACTGAGGGGCATAAGG + Intergenic
976008548 4:80459565-80459587 GAATTTGACTGAGGGGCATAAGG - Intronic
976072357 4:81256383-81256405 CAGTGTGAGTCGGGGGCACATGG - Intergenic
976078353 4:81324912-81324934 CAGTCTAACTGATGGGCATTTGG - Intergenic
976214574 4:82704254-82704276 CTGTGTGTCTGAGGGCCACAGGG + Intronic
976818270 4:89175219-89175241 GAATTTGACTGAGGGGCATAAGG - Intergenic
977869204 4:102070066-102070088 GAATTTGACAGAGGGGCATAAGG + Intronic
978392678 4:108243438-108243460 CAGAGTGAGTGAGGGGTAAATGG + Intergenic
978938577 4:114410217-114410239 GAATTTGACTGAAGGGCATAAGG + Intergenic
979056126 4:115997421-115997443 GAATTTGACTGACGGGCATAAGG + Intergenic
979065205 4:116122871-116122893 GAATGCGACTGAGGGGCATAAGG + Intergenic
980449879 4:132957495-132957517 CAGTGTGACTGTGGTGAAGATGG + Intergenic
980798418 4:137715100-137715122 GATTTTGACTGAGGGGCATAAGG - Intergenic
982103746 4:151993591-151993613 GCATTTGACTGAGGGGCATAAGG + Intergenic
983038687 4:162898615-162898637 GAATTTGACTGAGGGGCATAAGG + Intergenic
983406309 4:167335468-167335490 GAATTTGACTGAGGGGCATAAGG + Intergenic
984084479 4:175291986-175292008 GAAATTGACTGAGGGGCATAAGG + Intergenic
984824857 4:183915391-183915413 CAGAGTGACTGAGGTGCATGGGG + Intronic
985500567 5:241849-241871 CAGTGTGACTAAGGCACAGAAGG + Intronic
986028573 5:3873772-3873794 CAGTGTGAATGATGGGCTTTGGG + Intergenic
986751640 5:10792985-10793007 GAATTTGACTGAGAGGCATAAGG - Intergenic
986795025 5:11201705-11201727 CAGTGTGGTTGAGGGGGTTATGG + Intronic
986977805 5:13412580-13412602 GAATTTGACTGAGGGGCATAAGG - Intergenic
987572094 5:19676978-19677000 TATTTTGACTGAAGGGCATAAGG - Intronic
987655012 5:20796203-20796225 GAATTTGACTGAGGAGCATAAGG - Intergenic
988131169 5:27108226-27108248 GAATTTGACTGAGGGGCATAAGG + Intronic
988768551 5:34407699-34407721 GAATTTGACTGAGGAGCATAAGG + Intergenic
989187399 5:38638415-38638437 GAGTTCAACTGAGGGGCATAAGG + Intergenic
990114280 5:52369284-52369306 GAATTTGACTGAGGGGCATAAGG + Intergenic
990213126 5:53502063-53502085 GAATTTGACTGAGGGGCATAAGG + Intergenic
990318054 5:54602564-54602586 GAATTAGACTGAGGGGCATAAGG + Intergenic
990896109 5:60701418-60701440 GAGTTCGACTGAGGGGCATAAGG + Intergenic
991657620 5:68919900-68919922 GAATTTGACTGAGAGGCATAAGG + Intergenic
991686351 5:69185747-69185769 GGATTTGACTGAGGGGCATAAGG + Intergenic
992399123 5:76395545-76395567 GAATTCGACTGAGGGGCATAAGG - Intergenic
993177255 5:84502726-84502748 CAATTTGACTGAGGGGCAGAAGG + Intergenic
993406992 5:87524304-87524326 GAATTTGACTGAGGCGCATAGGG + Intergenic
994000816 5:94776808-94776830 CAGTGTGTCTGAGTGGAAGAAGG - Intronic
994281437 5:97908179-97908201 GAATTTGGCTGAGGGGCATAAGG - Intergenic
994754017 5:103772832-103772854 AAATTCGACTGAGGGGCATAAGG - Intergenic
995004125 5:107170510-107170532 CTGGCTGACTGTGGGGCATAAGG + Intergenic
995130053 5:108620568-108620590 GAATTTGACGGAGGGGCATAAGG + Intergenic
995191400 5:109322450-109322472 GAATTTGACTGAGGGGCATAAGG - Intergenic
996953383 5:129155018-129155040 GAATTTGACTGAGGGGCATAAGG + Intergenic
998456986 5:142281069-142281091 CAGTGTGCCAGAGGGGCCAACGG + Intergenic
998796094 5:145820703-145820725 GAATTCGACTGAGGGGCATAAGG + Intronic
999652093 5:153777681-153777703 CAGTGTGTGTGAGGGGGATGAGG - Intronic
1000766576 5:165299132-165299154 GAATTTGACCGAGGGGCATAGGG + Intergenic
1001944248 5:175765595-175765617 CAGTGGGGCTAAGAGGCATAAGG + Intergenic
1002018188 5:176342763-176342785 CAGTAACACTGAGGGGAATAAGG - Intronic
1002312944 5:178325632-178325654 CAATGGGACTGATGGGCAGACGG - Intronic
1002399765 5:178985118-178985140 CAGTGTGGATGAGAGGCACAGGG - Intronic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1003201897 6:3969140-3969162 GAATTTGGCTGAGGGGCATAAGG + Intergenic
1005158317 6:22833880-22833902 CAATGTGGCCAAGGGGCATAAGG - Intergenic
1005416179 6:25603011-25603033 CAAAGTGACTGTGGGGAATAAGG - Intronic
1005812157 6:29525904-29525926 GAATTCGACTGAGGGGCATACGG + Intergenic
1006017994 6:31097745-31097767 GAATTTGACTGAGGGGCATAAGG - Intergenic
1006295810 6:33169578-33169600 CATTGTCACTGAGGGGAGTAGGG - Intronic
1006646715 6:35520005-35520027 CAGTGTGAGTGAGTGGGATTCGG + Intergenic
1007389434 6:41542056-41542078 GGGTGTGACGGAGGGGCACAAGG - Intergenic
1008694347 6:54016626-54016648 CAGTGTGACAGAGGGGCTGTTGG + Intronic
1009401551 6:63262295-63262317 GAATTTGACTGAGGAGCATAAGG + Intergenic
1009684007 6:66932984-66933006 GAATATGACTGCGGGGCATAAGG - Intergenic
1010732165 6:79402847-79402869 CAGTGTGTCTGAGTGGAAGAAGG - Intergenic
1010977294 6:82330047-82330069 GAATTCGACTGAGGGGCATAAGG - Intergenic
1011014602 6:82741087-82741109 CAGTCAGACTGAAGTGCATAAGG + Intergenic
1011313831 6:86009606-86009628 CATTATCAGTGAGGGGCATATGG + Intergenic
1011355814 6:86472484-86472506 ATGAATGACTGAGGGGCATAAGG - Intergenic
1012000230 6:93645186-93645208 GAATCTGACTGAGGAGCATAAGG - Intergenic
1014366377 6:120547907-120547929 CAGTGTAAATGAGGAGCAAATGG - Intergenic
1015824856 6:137300793-137300815 GAATTTGACTGAGGGGCATAAGG + Intergenic
1016126707 6:140412397-140412419 GACTTTGATTGAGGGGCATAAGG - Intergenic
1017426974 6:154332049-154332071 GAATTTGGCTGAGGGGCATAAGG - Intronic
1018134901 6:160769616-160769638 GAATTTGACTGAGGGGCATGAGG - Intergenic
1019159882 6:170062717-170062739 CAGTGTGGCTGATGTGCACAGGG - Intergenic
1019434699 7:1015935-1015957 CAGGGTCACTGAGGGGCGTCAGG - Intronic
1019817733 7:3213429-3213451 GAATTCGACTGAGGGGCATAAGG - Intergenic
1021050281 7:15974780-15974802 CAGAGTGACTTAGGGTGATATGG - Intergenic
1021506381 7:21390034-21390056 GAATTTGACTGAGGAGCATAAGG - Intergenic
1024954609 7:54903726-54903748 AAGTGTGACTGTGGGGCCTTTGG - Intergenic
1026352194 7:69527104-69527126 GAATTTGACTGAGGGGCATAAGG - Intergenic
1027007429 7:74707276-74707298 CCGTGTGAATAAGGGGCACAGGG - Intronic
1027616558 7:80431309-80431331 GAATTTGACTGAGGGGCATAAGG - Intronic
1028581186 7:92411167-92411189 AACTTTGACTGAGGAGCATAAGG + Intergenic
1030257744 7:107529803-107529825 GAATTCGACTGAGGGGCATAAGG - Intronic
1030515554 7:110533799-110533821 GAATTTGACTGAGAGGCATAAGG - Intergenic
1030825751 7:114155712-114155734 GAATTTGATTGAGGGGCATAAGG + Intronic
1032168993 7:129568543-129568565 CATTGTGACTGTGGGTCACAGGG - Intergenic
1034685621 7:152968364-152968386 GAATTTGACTGAGGGCCATAAGG - Intergenic
1036625967 8:10471782-10471804 GAGTTTGACTGAGGGGCATAAGG + Intergenic
1037132874 8:15427673-15427695 GAATTTGACTGAGGGGCATAAGG - Intronic
1037968976 8:23158222-23158244 GAATTGGACTGAGGGGCATAAGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1039095965 8:33885669-33885691 GAATTTGACTGAGGGGCATAAGG + Intergenic
1039419045 8:37420352-37420374 CGGGGGGACTGCGGGGCATATGG - Intergenic
1039500061 8:38009581-38009603 GAATTCGACTGAGGGGCATAAGG - Intergenic
1039959213 8:42232824-42232846 GAATTTGACTGAGGGGCATAAGG + Intergenic
1041377276 8:57217054-57217076 GAGTTTGACTGAGGGGCATGAGG + Intergenic
1041395654 8:57388309-57388331 AAATTTGACTGAGGGGCATAAGG - Intergenic
1041482814 8:58342440-58342462 GAATTTGACTGAGGGGCATAAGG + Intergenic
1041821095 8:62033634-62033656 CAGTGTGAGTGAGTGGGATGTGG + Intergenic
1042225902 8:66514123-66514145 CAGTGTCACTGAGGGGTGTCGGG - Intronic
1043814657 8:84787413-84787435 CAGTATTACTGAAGGGCATTTGG + Intronic
1044085512 8:87937772-87937794 GAATTCGACTGAGGGGCATAAGG - Intergenic
1044123357 8:88425607-88425629 GAATTTAACTGAGGGGCATAAGG - Intergenic
1044861919 8:96532378-96532400 CAGAGAGACTCAGGGGCATCTGG - Intronic
1044914896 8:97102680-97102702 CAGTGTCACTGAGGGAATTATGG + Intronic
1045427762 8:102084328-102084350 TAATTTGACTGAGGGGCATAAGG + Intronic
1046184301 8:110692978-110693000 GAATTTGACTAAGGGGCATAAGG + Intergenic
1046386977 8:113518537-113518559 TAATTTGACTGAGGGACATAAGG - Intergenic
1047152944 8:122285021-122285043 GAATTTGACGGAGGGGCATAAGG - Intergenic
1047257887 8:123229573-123229595 CTGAGTGAGTGAGGGGCATAAGG + Intronic
1048128460 8:131663800-131663822 GAATTTGACTGAGGGGCATAAGG - Intergenic
1048174908 8:132142870-132142892 CAGGGTGACTGTGTGGCAGAAGG - Intronic
1050588623 9:7139850-7139872 TAATTTGACTCAGGGGCATAAGG + Intergenic
1051972979 9:22913370-22913392 GAATGTGACTGCGGGGCATAAGG - Intergenic
1056123251 9:83510374-83510396 CAGTGTTACTGATGGGCATGTGG + Intronic
1056435180 9:86569035-86569057 GAATTTGACTGAGGGGCCTAAGG + Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057949238 9:99356666-99356688 CAGTGAGACTGACGGACAGAGGG - Intergenic
1058069906 9:100591387-100591409 CAGTGTGGCTGAGGAACAAAGGG + Intergenic
1058247855 9:102653189-102653211 GAATTTGACTGAGGGACATAAGG - Intergenic
1058536928 9:105971014-105971036 CAGTAAGACTGAGAGGCATTAGG - Intergenic
1059323657 9:113488513-113488535 CAGAGTGTCAGAGAGGCATATGG + Intronic
1060538779 9:124415216-124415238 TAGTGTGACTCAGGGGAATCAGG - Intronic
1061420292 9:130469892-130469914 CAGTGGGGCTGAGGGGCTGAAGG + Intronic
1062051350 9:134448678-134448700 CAGTGTCACTGGAGGGCATGTGG + Intergenic
1062723095 9:138054593-138054615 CCGTGTGACTGATGGGCACTTGG + Intronic
1185757508 X:2663414-2663436 GAATTTGACTGAGGGCCATAAGG - Intergenic
1185886738 X:3790006-3790028 GAATTTGACTGAAGGGCATAAGG - Intergenic
1187394560 X:18908152-18908174 CAGTGAGACTCAGGGGCACTGGG - Intronic
1188284489 X:28311491-28311513 GAATTTGACTGAGGGGCATAAGG + Intergenic
1188881165 X:35493508-35493530 GAATTTGACCGAGGGGCATAAGG - Intergenic
1188883344 X:35518054-35518076 GAATTAGACTGAGGGGCATAAGG + Intergenic
1188898619 X:35700179-35700201 GAATTTGACTGAGGGGCATAGGG + Intergenic
1188953687 X:36408200-36408222 GAATTCGACTGAGGGGCATAAGG - Intergenic
1192362555 X:70448843-70448865 CAGGTTGACTAAGGGGCAGATGG + Intronic
1193330729 X:80232834-80232856 GCTTTTGACTGAGGGGCATAAGG + Intergenic
1193405401 X:81094929-81094951 CAGTCTGATTGATGGGCATTTGG - Intergenic
1193518726 X:82503044-82503066 GAATTTGACTGAGGGGAATAAGG - Intergenic
1193583769 X:83295299-83295321 GAATTTGACTGAGGGGTATAAGG - Intergenic
1193731865 X:85111985-85112007 GAATTAGACTGAGGGGCATAAGG + Intergenic
1194111518 X:89839805-89839827 TATTTCGACTGAGGGGCATAAGG - Intergenic
1194234175 X:91361663-91361685 GAATATGAATGAGGGGCATAAGG + Intergenic
1194295158 X:92118204-92118226 CAGTGTTTCTGAAGGGCATATGG - Intronic
1194627594 X:96243657-96243679 GAATTTGACTGAGGGGCATAAGG + Intergenic
1194810610 X:98382952-98382974 GAATTTGACTGAGGGGCATAAGG - Intergenic
1195130357 X:101844928-101844950 TAATGTCACTGAGGGGCAGAAGG + Intronic
1195220433 X:102741120-102741142 GAATTTGACTGAGGGGCATAAGG + Intronic
1195256795 X:103098830-103098852 GAATTTGACTGAGGGGCATAAGG + Intergenic
1195297523 X:103493952-103493974 CAGTGGGATTGCGGGTCATATGG + Intergenic
1196287010 X:113894453-113894475 GAATTTGACTGAGGAGCATAAGG - Intergenic
1196373188 X:115001390-115001412 GAATTTGACTGAAGGGCATAAGG + Intergenic
1197837689 X:130712849-130712871 GAATTCGACTGAGGGGCATAAGG - Intronic
1197932247 X:131707924-131707946 GAATCCGACTGAGGGGCATAAGG - Intergenic
1198757902 X:140000497-140000519 CAATCTGACTGAGGGGCATAAGG + Intergenic
1198957791 X:142150672-142150694 TAATTTGACTGAGGGGCATAAGG - Intergenic
1200612658 Y:5342728-5342750 CAGTGTTTCTGAAGGGCATATGG - Intronic
1201910023 Y:19124521-19124543 GAATTTGACTGAGAGGCATAAGG + Intergenic