ID: 1105601480

View in Genome Browser
Species Human (GRCh38)
Location 13:21892228-21892250
Sequence AGCTGCTTCCAGAAGCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105601480_1105601485 -5 Left 1105601480 13:21892228-21892250 CCTTCAGGCTTCTGGAAGCAGCT 0: 1
1: 0
2: 2
3: 46
4: 272
Right 1105601485 13:21892246-21892268 CAGCTGGGCTCCGGTGTGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 269
1105601480_1105601484 -9 Left 1105601480 13:21892228-21892250 CCTTCAGGCTTCTGGAAGCAGCT 0: 1
1: 0
2: 2
3: 46
4: 272
Right 1105601484 13:21892242-21892264 GAAGCAGCTGGGCTCCGGTGTGG 0: 1
1: 0
2: 0
3: 24
4: 232
1105601480_1105601486 -4 Left 1105601480 13:21892228-21892250 CCTTCAGGCTTCTGGAAGCAGCT 0: 1
1: 0
2: 2
3: 46
4: 272
Right 1105601486 13:21892247-21892269 AGCTGGGCTCCGGTGTGGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 228
1105601480_1105601488 9 Left 1105601480 13:21892228-21892250 CCTTCAGGCTTCTGGAAGCAGCT 0: 1
1: 0
2: 2
3: 46
4: 272
Right 1105601488 13:21892260-21892282 TGTGGCTGGGCTAGAGCCAGAGG 0: 1
1: 0
2: 2
3: 28
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105601480 Original CRISPR AGCTGCTTCCAGAAGCCTGA AGG (reversed) Intergenic
900228954 1:1546411-1546433 AGCTGCTTCCAGGGGCCTCGGGG - Intronic
900777277 1:4594552-4594574 AGGTGCCTGCAGAGGCCTGATGG - Intergenic
901028353 1:6291390-6291412 TGCTGCTCCCAGAAGCTGGAAGG + Intronic
901665683 1:10824915-10824937 AGCTGCCTCCCGCAGCTTGAGGG - Intergenic
901912905 1:12475155-12475177 AGCTGCTTCCAGTACCCAAAGGG - Intronic
902369234 1:15994928-15994950 AGATGCTTCTAGAAGCCTGGAGG - Intergenic
902634131 1:17724119-17724141 ATCTGCTGCAAGAAGCCTCAAGG - Intergenic
902668112 1:17953466-17953488 AGCTGCTTCTAGAACCCAGCAGG + Intergenic
902752562 1:18527421-18527443 AGAAGCTTCCAGAATCCTGTGGG - Intergenic
902753255 1:18532186-18532208 TGCTCCTTCCAGAAGCTCGAGGG - Intergenic
904333771 1:29784265-29784287 TGCTGCTTCCAGAAGCCGGATGG - Intergenic
904873551 1:33636398-33636420 AGCTGCATCCTGGGGCCTGATGG - Exonic
904907441 1:33908401-33908423 AGGAGCTGCCAGATGCCTGATGG - Intronic
906284883 1:44580755-44580777 AGCAGCTTCCAGAGCTCTGAAGG - Intronic
906918013 1:50032511-50032533 ATCTCCTTCCAGATCCCTGAGGG - Intergenic
907272381 1:53298591-53298613 AGAAGCTTCCAGAGGCCAGAAGG + Intronic
907307845 1:53523412-53523434 AGCTGCTTCCTCCAGCCTGCAGG + Intronic
908634727 1:66150234-66150256 AGCTGATTCCAGAATTCTTATGG - Intronic
909585403 1:77282608-77282630 GGCTGCTTTCAGAACCCTGCTGG - Intronic
909977205 1:82059248-82059270 AGCTCTTTCCAGAATCATGATGG - Intergenic
909996844 1:82290306-82290328 AGCTGCTTTGAGGAGCCTGTAGG - Intergenic
910606635 1:89092432-89092454 GGTTGCTTTCAGAAGCCTGGTGG + Intergenic
912427542 1:109608036-109608058 AGCTGCTTCCAAAAAGCTAAGGG - Exonic
913114387 1:115683186-115683208 AGCTCCCTCACGAAGCCTGAAGG + Intronic
915245808 1:154555709-154555731 AGTTGCTTACTGAAGCCAGAGGG - Intronic
917433446 1:174995647-174995669 AGTTGCTTTCAGAGTCCTGATGG - Intergenic
920396286 1:205648537-205648559 ATCTGATTACAGCAGCCTGACGG - Intergenic
920624744 1:207586063-207586085 AGCTTCTTACAGAAGGCTGATGG + Intronic
920713275 1:208316015-208316037 AGCCGCTTCTAGGAGCCTGCAGG + Intergenic
920793171 1:209112064-209112086 AACTGCTTCCAGAAGCTTCTAGG + Intergenic
922580228 1:226691847-226691869 AGCTGCTTCCAGAGCTCTGGGGG - Intronic
924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG + Intergenic
924706790 1:246508827-246508849 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1063907656 10:10797693-10797715 GGCTACTTCCAGGATCCTGAGGG + Intergenic
1065335032 10:24648392-24648414 AGCTGCTTTCAGATGTTTGAAGG - Intronic
1065933104 10:30496661-30496683 AGCAGCTTCCAGATGCCTAGAGG + Intergenic
1067242180 10:44506421-44506443 ATCTGCGTCCTGAAGCTTGAGGG - Intergenic
1067355189 10:45517558-45517580 GGCTGCTTACAGAAGGCAGAGGG - Intronic
1067905576 10:50287486-50287508 AGCTGCTTCCATGAGCCTCATGG - Intergenic
1069806324 10:71127239-71127261 AGCTGCTCCAGGAAGGCTGAAGG + Intergenic
1070186125 10:74064326-74064348 AGCTGGTTCCAGAAACATCAAGG - Intronic
1072785841 10:98281398-98281420 CTCTGCTTCCAGGAGTCTGATGG + Intergenic
1073778175 10:106808990-106809012 AACTGCTTCCAGATTCCTGCAGG - Intronic
1074151364 10:110762639-110762661 GGCTCCTACCAGAATCCTGAAGG + Intronic
1074323626 10:112426736-112426758 GGCTGTTTCAAAAAGCCTGAAGG - Intronic
1075078164 10:119365431-119365453 AGCTGCTTCTGTCAGCCTGAAGG - Intronic
1075778230 10:125001597-125001619 TGCTGCTTCCAGGACCCTAAGGG + Intronic
1076695467 10:132245287-132245309 AGCTGCGCGCAGAAGCCGGAGGG + Intronic
1076983672 11:219568-219590 AGCTGTATGAAGAAGCCTGATGG - Intronic
1078543728 11:12231290-12231312 AGCTCATCCCAGAAGCCAGATGG + Intronic
1079994916 11:27285950-27285972 AAGTGCCTCCAGTAGCCTGAGGG - Intergenic
1081540197 11:44029209-44029231 AGATCCTTCCAGAGGCCTGCAGG + Intergenic
1082826720 11:57585218-57585240 AGCTGCTGCCAGGAGACTGGTGG - Intergenic
1083032057 11:59601887-59601909 ATGGGCTTGCAGAAGCCTGAGGG - Intronic
1083540618 11:63509399-63509421 AGCTCCTGCCAGAAACATGATGG + Intronic
1083596245 11:63919379-63919401 ATCTGCTCCCAGCAGCATGAAGG + Intergenic
1083998110 11:66282217-66282239 AGCTGCTGCCCCAACCCTGACGG + Intronic
1086089052 11:82986589-82986611 TGCTTCATCCAGCAGCCTGAAGG + Intronic
1087457424 11:98404419-98404441 AGCTGCTTCAAGAAACCAGATGG - Intergenic
1089328011 11:117670577-117670599 AGCTGCTGCGTGAAGGCTGACGG + Intronic
1090508587 11:127346681-127346703 AGCTGCTTCAGTAATCCTGATGG + Intergenic
1091283777 11:134397014-134397036 AGCTGCTTCCAGAGGAAAGATGG - Intronic
1091492321 12:943877-943899 ATCTTCTTCCAGAAGCCTCACGG + Intronic
1091789253 12:3262053-3262075 AGCTGGTGCCAGAAACCTTAAGG + Intronic
1095970093 12:47895832-47895854 AGCTCCTGCCGGAAGCCTGCTGG + Intronic
1096930241 12:55199979-55200001 AGTTGCTTGCATAAGCCTCAAGG - Intergenic
1100231447 12:92612369-92612391 AGCTGTTTCCAGAAGTGTTAGGG - Intergenic
1100382345 12:94073565-94073587 AGATGCTTCCACAAGCCAGATGG + Intergenic
1101065657 12:101017590-101017612 AGCTACTTCCTGAGGCCTGGAGG - Intronic
1101505317 12:105340942-105340964 AACTCCTTCCAGAGGCCTTAGGG - Intronic
1102428792 12:112865402-112865424 CTCTGCTTCCAGACGCCTGGTGG + Exonic
1103343151 12:120231859-120231881 GGCTGCAGCCAGGAGCCTGATGG - Intronic
1103928705 12:124437739-124437761 AGCTGCTTCCAGAAGGCCCCAGG - Intronic
1103931760 12:124454341-124454363 AGAGGCTTCCACAAGGCTGATGG - Intronic
1105601480 13:21892228-21892250 AGCTGCTTCCAGAAGCCTGAAGG - Intergenic
1105841830 13:24260359-24260381 AGCTCCTTACAGAGGCCTGGAGG - Intronic
1106138066 13:26989537-26989559 AACTGTTTCCAGAAGACAGAGGG + Intergenic
1106428797 13:29659298-29659320 AGCTGGTTTCAAAAGCCAGAGGG - Intergenic
1107820397 13:44280778-44280800 AGGTGCTTCCAGTAGCTTCATGG - Intergenic
1108167832 13:47711242-47711264 AACTACTTCCAGAAGCCAGAGGG + Intergenic
1109278009 13:60323268-60323290 AGCTGGCTCCAGAAGGTTGAGGG + Intergenic
1113535720 13:111064844-111064866 AGCAGCTTCCAGAAGGCAGTAGG - Intergenic
1114616700 14:24072300-24072322 AGCTCCTGCCAGGAGCCTGAAGG + Intronic
1114766095 14:25372286-25372308 AGCAGATTCCAGCAGCATGAAGG + Intergenic
1115683380 14:35766983-35767005 AGCTTCTTACAGTAGCCAGATGG + Intronic
1115701166 14:35954325-35954347 AGCTGCTTCCACTAGCCAGGTGG + Intergenic
1118565476 14:67136208-67136230 AGCAGCTTCCAGAACCCTTAGGG - Intronic
1118745801 14:68772234-68772256 AGCTGGTTCCAGCAACCTGCTGG - Intergenic
1119444134 14:74649403-74649425 AGCAGGTTCCAACAGCCTGAGGG - Intergenic
1119857278 14:77910016-77910038 AGCTGCTGCCAGGAGCATGGTGG + Intronic
1120183739 14:81371105-81371127 AGCTGCTCTCAGAAGTCAGAGGG + Exonic
1120981272 14:90291475-90291497 ATCTGCTTCCAGGAGACTGCTGG + Intronic
1121182789 14:91942207-91942229 AGCTTCTTCCAGAACCCCTAAGG + Intronic
1122044438 14:99013016-99013038 TGCTGCTCCCAGAAGCCTGCAGG - Intergenic
1123162105 14:106288183-106288205 AGCTGCTTCCTGAAGCCTTCAGG + Intergenic
1126870310 15:52980229-52980251 AGCTGATTCCTGAAGGCTGTGGG + Intergenic
1127353021 15:58171416-58171438 AGCTGCCTCCAGCTGCCTGGAGG - Intronic
1127608228 15:60611704-60611726 AGCTGCTTTGGGAAACCTGATGG + Intronic
1127896096 15:63300189-63300211 AGCTGCTTAAAGAAACCAGATGG - Intronic
1128659090 15:69484761-69484783 TGGAGCTTCCAGAATCCTGAGGG - Intergenic
1129461145 15:75700602-75700624 AGCTGCCCCCAGGAGGCTGAGGG + Intronic
1129488601 15:75902364-75902386 AGCTGCTTAAGGAAGCCAGATGG - Intergenic
1129723685 15:77891140-77891162 AGCTGCCCCCAGGAGGCTGAGGG - Intergenic
1129867554 15:78921252-78921274 TGCTGCTTCCTGAAGCCTCCGGG - Exonic
1129960224 15:79677508-79677530 AGCTTCTTTGAGAAGCCTGCGGG - Intergenic
1129960238 15:79677592-79677614 AGCTTCTTTGAGAAGCCTGCGGG - Intergenic
1130923979 15:88371512-88371534 AGCTGCTGCCATGAGCCTGGTGG + Intergenic
1132030337 15:98433845-98433867 GGCTACTTCCAGAAACCTCAGGG - Intergenic
1132811722 16:1802523-1802545 AGCTGCTTCTGAAAGTCTGATGG + Intronic
1133667714 16:7985907-7985929 AGCTCCTTCCTAAAACCTGAAGG + Intergenic
1134411167 16:14004120-14004142 AGCTCCTTGGAGAAGCCAGAAGG + Intergenic
1137662038 16:50216116-50216138 AGCTTCTTCCAGAGTCCAGAGGG - Exonic
1140202220 16:72903931-72903953 AGCTGCTTCCAGTGGGCTGAAGG - Intronic
1141201066 16:81898027-81898049 AGCTCCTTCCATCTGCCTGATGG - Intronic
1141511253 16:84513728-84513750 AGCAGCGTCCAAAAGGCTGAGGG + Intronic
1141554749 16:84829566-84829588 AGCTGACCCCAGAAGCCTGGGGG - Intronic
1141697550 16:85627292-85627314 GGCTTCTGCCAGAAGCCAGAGGG - Intronic
1142408503 16:89904295-89904317 ACCTGCTTCCAGCAGCAGGAGGG + Intronic
1143206072 17:5139850-5139872 AGATGCTTCTAGAAGCCTGGAGG - Intronic
1145762168 17:27431289-27431311 AGATGCTTCTAGTAGCCTGGAGG - Intergenic
1146668097 17:34718127-34718149 ATCTGCTCCTAGGAGCCTGATGG - Intergenic
1146842539 17:36165987-36166009 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146854851 17:36253946-36253968 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146865769 17:36334430-36334452 AGATGCTTCTAGAAGCCTGGAGG - Exonic
1146870751 17:36377838-36377860 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146878109 17:36428919-36428941 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1146882050 17:36450023-36450045 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1147068639 17:37935042-37935064 AGATGCTTCTAGAAGCCTGGAGG - Exonic
1147073634 17:37978462-37978484 AGATGCTTCTAGAAGCCTGGAGG + Intronic
1147080161 17:38014579-38014601 AGATGCTTCTAGAAGCCTGGAGG - Intronic
1147085156 17:38058000-38058022 AGATGCTTCTAGAAGCCTGGAGG + Exonic
1147096110 17:38138539-38138561 AGATGCTTCTAGAAGCCTGGAGG - Intergenic
1147101102 17:38181966-38181988 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1147323282 17:39658625-39658647 AGCAGCCTCCAGTAGCCTGAGGG + Intronic
1148743544 17:49906388-49906410 AGATGCTTCCAGACTCCCGAAGG + Intergenic
1149208836 17:54280471-54280493 AGGTGCTTCCAGAACCCACAGGG + Intergenic
1149525855 17:57355240-57355262 ATGTGCATCCAGAATCCTGACGG - Intronic
1149845693 17:60008429-60008451 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1150084041 17:62265009-62265031 AGATGCTTCTAGAAGCCTGGAGG + Intergenic
1152056745 17:78034507-78034529 AGCTGCTTGGGGAAGCCTCACGG - Intronic
1154353261 18:13604932-13604954 TGCTGCTTCCAGAATGCTCAAGG + Intronic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1156962943 18:43055022-43055044 AGCTACTTCCACAAGCCTGAAGG - Intronic
1157991624 18:52503815-52503837 GGCTGCTTCCTGAGCCCTGATGG + Intronic
1158965011 18:62614745-62614767 AGCTGCTTCGTGGAGCCTGAAGG + Intergenic
1159782123 18:72672354-72672376 CTCTGCTTCCAGAAGCAAGAGGG - Intergenic
1160002395 18:75038273-75038295 AGCTGCTCCCAGGAGCTGGATGG + Intronic
1160205572 18:76828512-76828534 CACTGTTACCAGAAGCCTGAGGG - Intronic
1161839017 19:6667421-6667443 AGCTGCTCCCAGGAGCCTGCAGG + Exonic
1164686847 19:30172361-30172383 GGCCCCTTCCAGCAGCCTGAGGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165119011 19:33547108-33547130 AGCTGGCTCCAGAAGCCAAAAGG - Intergenic
1165653524 19:37512030-37512052 AGCAGCTTCCAGAATCCCTAAGG - Intronic
1166219530 19:41355500-41355522 AGATGCTTCCAGATGCCAGGTGG - Intronic
1166670766 19:44708303-44708325 GGCTGCTTCCTTCAGCCTGATGG - Intronic
1202635511 1_KI270706v1_random:40793-40815 AGCTGCCACCTGATGCCTGATGG - Intergenic
927150342 2:20191973-20191995 AGGTGCTCCCTGCAGCCTGACGG - Intergenic
931458569 2:62431636-62431658 ACCTGCTTCCAGAAACCTACTGG - Intergenic
932073558 2:68643762-68643784 CGCTTCTTCCAGAAGCCGGCAGG - Exonic
932199159 2:69810484-69810506 AGCTGCTTCCATAAGCAGGCTGG + Intronic
932400488 2:71477527-71477549 ACCTGCTTACAGAAGGCTGATGG + Intronic
932992989 2:76811346-76811368 AGCAGCTTGCAGAGGCTTGAAGG + Intronic
934779726 2:96961887-96961909 AGATGCTTCCTGAAGCCCGCAGG - Intronic
934819456 2:97359583-97359605 AGCTTCTCCCAGATGGCTGAGGG - Intergenic
935284870 2:101555728-101555750 AACTGTTTCCAGAAGGCTGGAGG - Intergenic
935677809 2:105610707-105610729 TGCTCCTTCCAGAAGCACGAGGG + Intergenic
936166950 2:110129137-110129159 AACTGCTTCCATAAGCCAGCAGG + Intronic
936733102 2:115407402-115407424 AACTGCTTCCTGAAGACAGAGGG + Intronic
937454741 2:122031659-122031681 AGCTGCATCCAGTAGGCAGAGGG + Intergenic
937646815 2:124274852-124274874 AGCTGCTTAAAGAAGTCAGATGG - Intronic
940563027 2:155325757-155325779 AGTGGGTTCCAGAAGCCTGAGGG + Intergenic
940564134 2:155339008-155339030 TGGTGTTTACAGAAGCCTGATGG - Intergenic
940858188 2:158746141-158746163 AGATGCTTGCAGCTGCCTGACGG + Intergenic
940895498 2:159078720-159078742 TGCTGCTTCCAGAAATCAGAAGG - Intronic
944744122 2:202638221-202638243 TGCTGGCTCCAGAAGGCTGAAGG - Intronic
944908171 2:204283462-204283484 AGCTGCTTCCAGAGGATTCATGG + Intergenic
946471152 2:219962496-219962518 AGCTGCTCCCAGAATCCTGTGGG + Intergenic
947823908 2:233091437-233091459 AGCTCCTTCCAGAGGCTTCAGGG + Intronic
948672005 2:239574739-239574761 AGCTGATTTCTGGAGCCTGAAGG - Intergenic
1169029142 20:2394763-2394785 AGCTGCCACCAGAAGCCTCCAGG - Intronic
1169203746 20:3728918-3728940 AGCTGCTCCCAGTTGCCTGCAGG - Intergenic
1170484252 20:16800140-16800162 AGTTGCTTCCAGAACTCTAACGG - Intergenic
1171721134 20:28564293-28564315 TGCTGCTTCCCAAGGCCTGATGG + Intergenic
1171785331 20:29458658-29458680 TGCTGCTTCCCAAGGCCTGATGG + Intergenic
1171862988 20:30418528-30418550 TGCTGCTTCCCAAGGCCTGATGG - Intergenic
1174009621 20:47439147-47439169 AGCTGTTTCCAGAAGGAGGAGGG - Intergenic
1175041820 20:56059272-56059294 AGCAGCTTCCAGAAGTCAGCAGG - Intergenic
1180365197 22:11932434-11932456 AGCTGCCACCTGATGCCTGATGG + Intergenic
1181100379 22:20534932-20534954 GTCTGCTTCCTGAAGCCTGAAGG - Intronic
1181273611 22:21675052-21675074 TGCTTCTTCCAGAAGCTGGACGG + Exonic
1181330849 22:22089486-22089508 GGCAGCTTCCTGAAGCCTGCAGG + Intergenic
1181460832 22:23085049-23085071 AGCTGCCTCCAGAAAACTCAGGG - Intronic
1181481995 22:23205903-23205925 AGCTGCCTCCAAATGCCTGGTGG + Intronic
1181974249 22:26717598-26717620 AGCTGCTTCTAACAGCCTCAGGG + Intergenic
1182895948 22:33859446-33859468 CACTTCTTCCAGAAGCCTGGTGG - Intronic
1182933124 22:34194055-34194077 AGCTGCTGCCTGCAGCTTGAAGG + Intergenic
1183092559 22:35532785-35532807 AGCTGCTGCCAGAATCCGGAGGG + Intergenic
1183641037 22:39092570-39092592 CGTCGCTTCCACAAGCCTGATGG + Intergenic
1184864588 22:47195275-47195297 GGCAGCTGCAAGAAGCCTGATGG + Intergenic
949381934 3:3456337-3456359 AGGTTCTTCCAGGAGCCTTAGGG - Intergenic
951647164 3:24905650-24905672 ACCTGCTTAAAGAAGCCTGGAGG + Intergenic
952828467 3:37543725-37543747 AGCTGCTTCTAGATGCTTCAGGG + Intronic
953668015 3:44940005-44940027 AGCTGCTCACAGAGGCCAGAAGG + Intronic
954594388 3:51812894-51812916 AGCTCCTTCCAGAAGCTCTAGGG + Intergenic
954682376 3:52352739-52352761 AGCTGCTTCCTCAAGCCTGGGGG - Intronic
956526606 3:70170026-70170048 AACTGCTTCCAGAGGGCTAAAGG - Intergenic
960252390 3:115470410-115470432 AGCTGGTTCCAGCTGCCTGAGGG + Intergenic
962158944 3:132978669-132978691 TGCAGCCTCCAGTAGCCTGAGGG + Intergenic
962251318 3:133837854-133837876 ACCAGCTTCCAGGAGGCTGAGGG - Intronic
962325701 3:134430331-134430353 AGCTGCGTCCAGCACCCTGCTGG + Intergenic
962432679 3:135334683-135334705 AGCTATTTCCAGAAGCCTTAAGG + Intergenic
964301183 3:155286972-155286994 ATCAGCTTCGAGAAGCCTGTAGG + Intergenic
965514294 3:169604490-169604512 AGCTGCTTCCACAGGGCTCAGGG - Intronic
969253699 4:5988599-5988621 AGCTGCTTTCAAGAGCCTGTGGG - Exonic
969292331 4:6248008-6248030 TGCTACCTCCAGAAGCCTGCAGG + Intergenic
969313316 4:6366866-6366888 GGCTTCCTCCAGAAGCCAGAGGG + Intronic
969325387 4:6441133-6441155 AGGGGGTTCCAGCAGCCTGAGGG + Intronic
969472256 4:7395846-7395868 AGCTGTTTCCAGCAGGCTTAGGG + Intronic
969513523 4:7633274-7633296 GGCTGATGCCAGGAGCCTGAGGG + Intronic
970585935 4:17514207-17514229 AGTTGGTCACAGAAGCCTGAAGG - Intergenic
971775517 4:30959617-30959639 TTTTTCTTCCAGAAGCCTGATGG + Intronic
973298757 4:48556446-48556468 CCTTGCTTCCAGCAGCCTGAAGG + Intronic
975392203 4:73833469-73833491 AGATGGTTCCAGAAGCCTATGGG + Intergenic
977676683 4:99756107-99756129 AGATGCTTCCAAATTCCTGAAGG + Intergenic
979281552 4:118874240-118874262 ATTAGCTTCCAGAAGCCTAAGGG + Intronic
980188351 4:129491351-129491373 AGCTACTTCCAGAAGGCCAATGG - Intergenic
980977817 4:139627894-139627916 TCCTGCTTGCAGAAGCCTGTGGG - Intergenic
981772776 4:148329073-148329095 ACCAGCTTCCAGACCCCTGAAGG - Intronic
982038669 4:151373020-151373042 ATCTGCTTCCAGCATCCTTATGG + Intergenic
983488153 4:168355779-168355801 TACTCCTTCCAGAAGCATGAGGG + Intergenic
984084990 4:175298617-175298639 AGATGCTTCCAAAAGGCTTATGG - Intergenic
985009244 4:185565833-185565855 AGAGGCTTCTAGAAGACTGAGGG + Intergenic
985370453 4:189280681-189280703 TGCTGCTTCCCAAGGCCTGATGG + Intergenic
985379470 4:189377173-189377195 AGCTGCTACCAGCTGCCTGCAGG - Intergenic
1202762826 4_GL000008v2_random:126672-126694 AGCTGCCACCTGATGCCTGATGG - Intergenic
985781185 5:1872640-1872662 AAATGCTTCCAGAATCCTGCAGG + Intergenic
989537032 5:42575647-42575669 AGCTGGCTCCAGCAGCCTGAGGG + Intronic
991501231 5:67279398-67279420 ATCTGCTGCCTGAACCCTGAAGG - Intergenic
993884071 5:93396098-93396120 AGCTGCTTAAAGAAACCAGATGG - Intergenic
995592861 5:113717664-113717686 AGCCATTTCCAGCAGCCTGAAGG - Intergenic
996045866 5:118873153-118873175 AGCTGCTTAGAGAACCCAGAGGG + Intronic
997812778 5:136988421-136988443 TACTGCTTCCAGAAGCCTGGAGG - Exonic
999260930 5:150238650-150238672 AGCTGGTTCCAGAAGTCTAAGGG + Intronic
999728096 5:154453601-154453623 AGTTGCTTCCAGAACTCTGGAGG - Intronic
1001014925 5:168131833-168131855 AGCTGATTCCACAGGCCTGGTGG - Intronic
1003193308 6:3892875-3892897 AGCTGCTCCAAGAGGCCTCAGGG - Intergenic
1003408941 6:5846521-5846543 AGCAGACTCCAGAAGCATGACGG - Intergenic
1006253236 6:32808046-32808068 AGCTGCTTAGAGAAGCCGTAGGG - Intergenic
1006312152 6:33268455-33268477 GGCTGCTTCCAGTAGCCTCCAGG + Intronic
1006595321 6:35188900-35188922 ACCCTGTTCCAGAAGCCTGAGGG - Intergenic
1007425948 6:41746228-41746250 AGCTGGTGCCAGGTGCCTGAGGG - Intronic
1011158691 6:84363778-84363800 AGCTGCTTCCAGAAGGGTCTAGG - Intergenic
1011688452 6:89843483-89843505 ATCTGCTGCCTGAATCCTGAAGG - Intronic
1015133774 6:129844590-129844612 AGCTGCCTCCTGAAGCTTTAAGG + Intronic
1017221286 6:151968790-151968812 AGTTGCTCCCACCAGCCTGAAGG - Intronic
1017643594 6:156517856-156517878 AGCTGCTCCCATGAGGCTGATGG - Intergenic
1017865482 6:158439527-158439549 ACCTCCTTCCAGGAGCCTGCTGG + Intronic
1018027164 6:159815571-159815593 GTCTGCCTCCAGAAGCCTGCAGG + Intronic
1018783947 6:167093585-167093607 AGCTGTTTCCAGAATCCTCTGGG + Intergenic
1019210001 6:170397396-170397418 AGCTGATGCCAGATGCCTGTGGG + Intronic
1019263082 7:93240-93262 GGATGCTTCCAGCAGTCTGAGGG - Intergenic
1020140153 7:5607437-5607459 AGCAGCTGCGAGAAGACTGAGGG + Intergenic
1021060572 7:16105677-16105699 GGTTGCCTTCAGAAGCCTGATGG + Intronic
1021602213 7:22375600-22375622 AGCTGCTTACAGGGGCCTGCAGG - Intergenic
1022214686 7:28246968-28246990 AGCAGCTTCTAGAAGCCAAAGGG - Intergenic
1022360244 7:29650117-29650139 GGCTGCTTCCAGAAGCGCGGAGG + Intergenic
1023550750 7:41367786-41367808 AGTTGCTTCCAGGAATCTGAGGG + Intergenic
1023628503 7:42139955-42139977 AGCTCCTCACAGAAGCCTGCTGG + Intronic
1023649327 7:42352025-42352047 GGCTGATCCCAGAAGCCAGAGGG - Intergenic
1023996799 7:45163511-45163533 AGGTGCTGCCAGCAGCCAGAGGG + Intronic
1026484363 7:70805284-70805306 AGCTGCTTCCAAATGCCATAAGG + Intergenic
1026932470 7:74231372-74231394 CGGTTCTTCTAGAAGCCTGAAGG - Intergenic
1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG + Intergenic
1030103284 7:105965260-105965282 GCCTGCTTCCAACAGCCTGAAGG - Intronic
1030113602 7:106046932-106046954 ATCAGCTTCCAGGAGCCAGAGGG + Intergenic
1030297709 7:107945593-107945615 AGCTGTTTCCACAAGCCTGGGGG - Intronic
1030807749 7:113937479-113937501 AGCTGCTTAGAGAAGTCTTAGGG - Intronic
1030815751 7:114034942-114034964 AGCTCCATCCTGAACCCTGAGGG - Intronic
1032429677 7:131850403-131850425 AGCAGCCACCAGAAGCCAGAAGG - Intergenic
1034449181 7:151128358-151128380 AGCTGCTTCCTGATGGATGATGG + Intronic
1034944495 7:155253275-155253297 AGCAGCTTCCAGCATCCCGAAGG - Intergenic
1034980742 7:155474556-155474578 TGCTGGTTCCAGAGCCCTGAGGG - Intronic
1035565314 8:637073-637095 GGCTGCTTCCTGTTGCCTGAAGG + Intronic
1035654068 8:1292355-1292377 AGCTGTTTCCAGGTGGCTGATGG - Intergenic
1038163283 8:25061052-25061074 AGATGCATCCAGAAGGCAGAGGG - Intergenic
1040542454 8:48372457-48372479 AGTTGCTTTGAGAACCCTGATGG - Intergenic
1046037614 8:108862879-108862901 AGCTGATTCCTGATGCCTTATGG - Intergenic
1046846822 8:118926175-118926197 GGCTGCTTACAGAAGCGTTAAGG + Intronic
1048575277 8:135685241-135685263 GGCTGCTTTCAGAAGCTTGCAGG + Intergenic
1049029386 8:140023170-140023192 ACCTGCTTCCCGAAGGCTGCTGG + Intronic
1052041716 9:23746666-23746688 AGCTAATTCCAGAAGCCAGTTGG - Intronic
1052752134 9:32502704-32502726 AGCAGCTACCAGAAACCGGAAGG - Intronic
1053572866 9:39328010-39328032 AGCTTCTTTCTGAGGCCTGAAGG - Intergenic
1054094429 9:60886719-60886741 AGCTTCTTTCTGAGGCCTGAAGG - Intergenic
1054115900 9:61162631-61162653 AGCTTCTTTCTGAGGCCTGAAGG - Intergenic
1054124278 9:61291001-61291023 AGCTTCTTTCTGAGGCCTGAAGG + Intergenic
1054591855 9:67019913-67019935 AGCTTCTTTCTGAGGCCTGAAGG + Intergenic
1056091065 9:83206814-83206836 AACAGCTTCTGGAAGCCTGAAGG - Intergenic
1056543094 9:87591243-87591265 ACATGCTTTCAGAAGCCTAAGGG - Intronic
1056584658 9:87920208-87920230 AGCTGCAGCCAGGAGCCAGATGG - Intergenic
1059477348 9:114558141-114558163 AGCTGTTTCCAGAACACAGAAGG - Intergenic
1059859802 9:118447206-118447228 TGATTCATCCAGAAGCCTGAAGG - Intergenic
1062503392 9:136860884-136860906 AGCTGCATCCAGAAGCAAGCAGG - Intronic
1202801560 9_KI270720v1_random:4080-4102 TGCTGCTTCCCAAGGCCTGATGG + Intergenic
1203446110 Un_GL000219v1:57889-57911 TGCTGCTTCCCAAGGCCTGATGG + Intergenic
1203543589 Un_KI270743v1:111553-111575 AGCTGCCACCTGATGCCTGATGG - Intergenic
1187383575 X:18827504-18827526 AGCTGTTTCAGGGAGCCTGAGGG - Exonic
1187821224 X:23290450-23290472 AGCTCCTTAAAGTAGCCTGAGGG + Intergenic
1188012983 X:25076986-25077008 GGCTGCCTCCAGAATCCTGCGGG + Intergenic
1188057474 X:25558195-25558217 AGTTGCTTCCACAAACATGATGG + Intergenic
1188772778 X:34174825-34174847 AGCTGCTACCAGATGCTTGTAGG + Intergenic
1189375774 X:40465374-40465396 AGATGCTTCCAGCAGCTAGATGG + Intergenic
1189850698 X:45173681-45173703 AGCTACTTAGAGAAGGCTGAGGG - Intronic
1190667105 X:52705849-52705871 AGCTGATTCCAGGTGACTGAGGG - Intronic
1190672313 X:52752559-52752581 AGCTGATTCCAGGTGACTGAGGG + Intronic
1195162667 X:102185690-102185712 ATCTGCTGCCTGAACCCTGAAGG - Intergenic
1195689148 X:107609784-107609806 AGCTGGTTGCATAAGCCTTAAGG + Intergenic
1196545092 X:116953789-116953811 ACCTGCTTCCAGATTCCTGAAGG + Intergenic
1197764515 X:130051231-130051253 AGCTGCGGCCAGAAGGCTAAGGG - Intronic
1199042915 X:143135594-143135616 TTCTGCTTCCAGAAGCTGGAAGG - Intergenic
1199849013 X:151711968-151711990 AGCTGCTTCCAGGAGCAGGAAGG + Intergenic