ID: 1105604568

View in Genome Browser
Species Human (GRCh38)
Location 13:21916202-21916224
Sequence TAGGGTCTGCAGAAGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 254}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105604559_1105604568 6 Left 1105604559 13:21916173-21916195 CCCCGCTCTCATAGCCACATCAC 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254
1105604558_1105604568 9 Left 1105604558 13:21916170-21916192 CCTCCCCGCTCTCATAGCCACAT 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254
1105604555_1105604568 19 Left 1105604555 13:21916160-21916182 CCCTTCTTGCCCTCCCCGCTCTC 0: 1
1: 0
2: 2
3: 46
4: 747
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254
1105604560_1105604568 5 Left 1105604560 13:21916174-21916196 CCCGCTCTCATAGCCACATCACT 0: 1
1: 0
2: 1
3: 18
4: 197
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254
1105604553_1105604568 25 Left 1105604553 13:21916154-21916176 CCTGTCCCCTTCTTGCCCTCCCC 0: 1
1: 1
2: 12
3: 149
4: 1268
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254
1105604554_1105604568 20 Left 1105604554 13:21916159-21916181 CCCCTTCTTGCCCTCCCCGCTCT 0: 1
1: 0
2: 4
3: 58
4: 777
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254
1105604557_1105604568 10 Left 1105604557 13:21916169-21916191 CCCTCCCCGCTCTCATAGCCACA 0: 1
1: 0
2: 0
3: 26
4: 187
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254
1105604556_1105604568 18 Left 1105604556 13:21916161-21916183 CCTTCTTGCCCTCCCCGCTCTCA 0: 1
1: 0
2: 1
3: 46
4: 587
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254
1105604565_1105604568 -8 Left 1105604565 13:21916187-21916209 CCACATCACTGTGGCTAGGGTCT 0: 1
1: 0
2: 0
3: 23
4: 221
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254
1105604561_1105604568 4 Left 1105604561 13:21916175-21916197 CCGCTCTCATAGCCACATCACTG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG 0: 1
1: 0
2: 0
3: 36
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105604568 Original CRISPR TAGGGTCTGCAGAAGTGGAA GGG Intergenic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902659785 1:17893040-17893062 CAGAGGCTGCAGAAGGGGAACGG - Intergenic
902894237 1:19467919-19467941 TAGGCCCTGCAGGGGTGGAATGG - Intronic
905318853 1:37101457-37101479 AAGGAACTGCAGAAGTGGCATGG + Intergenic
905753763 1:40489423-40489445 CAGGGTCTCCACAAGTGGAAAGG - Intronic
905854201 1:41296839-41296861 TGGGGTCTGCTGACTTGGAAAGG - Intergenic
905958387 1:42020807-42020829 TAGGGTCTGGGGAGGTGGAAAGG + Intronic
906099966 1:43253921-43253943 TCGGCTCTGCAGCAGTGCAATGG + Intronic
906273156 1:44497241-44497263 TAGGGTAGGCACAACTGGAAAGG - Intronic
907797672 1:57733738-57733760 TAGGGTCTGAAGGAGAAGAAGGG + Intronic
908026464 1:59957245-59957267 TAGGATCTGCAGAAGGGAAATGG + Intergenic
908077337 1:60535069-60535091 TAGGGTCTGCAAAAGCAGCAGGG + Intergenic
908152682 1:61319725-61319747 AAGGGGCTGAAGAAGTAGAATGG + Intronic
912481091 1:109982815-109982837 CAAGGTCTGCAGATGTGCAAAGG + Intergenic
912578018 1:110693486-110693508 TAGAGTCTGAAGAAGGAGAAGGG - Intergenic
912775727 1:112505284-112505306 TAGGCTCTGCTGAAGTTCAAGGG - Intronic
915066955 1:153232628-153232650 TGGGGTCTGCAGGATTGGAGTGG - Intergenic
917789178 1:178488442-178488464 CAGGGTCTGGGGAAGTGGCAAGG - Intergenic
918265770 1:182839997-182840019 CAGAGCCTGCAGAAGCGGAAGGG + Intronic
918528053 1:185486578-185486600 CAGAGCCTGGAGAAGTGGAATGG + Intergenic
921259319 1:213371728-213371750 TATGTTATGCAGAAGTGGCAGGG - Intergenic
921784419 1:219211489-219211511 TAGGCTCTTCAGAAGAGTAATGG + Exonic
921793202 1:219313197-219313219 TGGGCTCTGGACAAGTGGAAAGG + Intergenic
923222162 1:231905291-231905313 TATGGTCTTCAGAAGTGCCAAGG + Intronic
923726402 1:236509346-236509368 GAGGGTTGGCAGAAGTTGAAAGG + Intergenic
924920060 1:248619482-248619504 CAGGGGCTGCAGAAGAGGGAGGG + Intergenic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1063176182 10:3552772-3552794 CTGGGTCTTCAGAAGTGAAAGGG - Intergenic
1063857885 10:10275075-10275097 CAGGGTCTGGAGAAGTGGACAGG - Intergenic
1067061704 10:43081147-43081169 GAGGGGCTCCTGAAGTGGAAAGG - Intronic
1067087494 10:43250623-43250645 TGGGGTGTGCCGAAGGGGAAGGG + Intronic
1067560553 10:47301579-47301601 AAGGGGCTGAGGAAGTGGAAAGG - Intronic
1068119789 10:52773825-52773847 GAGGGACTGCAGTAGTGGAGAGG + Intergenic
1070584067 10:77747806-77747828 TAGGGTGTCCGGAAGGGGAATGG + Intergenic
1071353660 10:84771406-84771428 TTGGGTCTGAACAACTGGAAGGG + Intergenic
1073811990 10:107162472-107162494 AAGGGTCTCCAGAACTTGAATGG + Intronic
1075521710 10:123147550-123147572 TGAGGTCTGCAGACGGGGAAGGG + Intergenic
1079013420 11:16848090-16848112 TAGTGGCAGCAGAAGTGGAGAGG + Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081853638 11:46290607-46290629 TGGGGTCTGCAGGAGGGGAAGGG + Intronic
1083209297 11:61172915-61172937 AAGTGTCTGCAGGAGTGAAATGG - Intergenic
1083472001 11:62890222-62890244 TAGAGTCTGAGGGAGTGGAATGG + Intergenic
1084255573 11:67940074-67940096 TAAGTTCTGCAGTAGGGGAAGGG - Intergenic
1084517697 11:69645427-69645449 AAGGGTGTGCAGTAGTGGGAAGG - Intronic
1084817178 11:71655231-71655253 TAAGTTCTGCAGTAGGGGAAGGG + Intergenic
1085803255 11:79611284-79611306 TAAGGTCTGCAATAGAGGAAGGG + Intergenic
1086316671 11:85602146-85602168 TTGGGTCTGAATAATTGGAAGGG - Intronic
1087552063 11:99664034-99664056 TAGTGTCTACAGTATTGGAACGG + Intronic
1088871576 11:113894654-113894676 GAGGGAGTGCAGAAGAGGAACGG - Intergenic
1089266617 11:117267821-117267843 TAGGTTCTACAGAAGTGCCAAGG - Intronic
1089683247 11:120131193-120131215 TTGGGGCTGCAGAGGAGGAAAGG + Intronic
1089702594 11:120254549-120254571 TAGGAGGTGAAGAAGTGGAAAGG + Intronic
1091626837 12:2127485-2127507 TAGGGTTTGCAGAAATGCTAGGG + Intronic
1091684693 12:2553335-2553357 TAGGCTTTACAGAACTGGAAGGG - Intronic
1091809118 12:3380128-3380150 ATGGCTCTGCAGAATTGGAAAGG + Intergenic
1092425810 12:8374808-8374830 TAAGTTCTGCAGTAGGGGAAGGG - Intergenic
1094484188 12:30911342-30911364 ACGGCTCTGCAGAATTGGAAAGG - Intergenic
1095040706 12:37437088-37437110 TGGGGACTGCAGAAATTGAATGG + Intergenic
1095171836 12:39045039-39045061 TAGGGTCTGCAGCTGTGAAACGG - Intergenic
1095740118 12:45597635-45597657 TAGGGTAGGTAGAAGTGGGATGG - Intergenic
1096197738 12:49659336-49659358 TAGCCTCTGCAGGAGTTGAATGG + Intronic
1097468977 12:59965086-59965108 TAGGGACTGCCCAAGTGGAAAGG + Intergenic
1097880263 12:64680378-64680400 TGGTGTCTGCACAAGTGGAGTGG - Intronic
1098075430 12:66724789-66724811 CTTTGTCTGCAGAAGTGGAAGGG + Intronic
1099260422 12:80373911-80373933 TAAGCTCTGCTGAAGTGGCAGGG + Intronic
1099497457 12:83368190-83368212 GAGGGACTGCAAAAATGGAAAGG + Intergenic
1102539816 12:113610583-113610605 AAGGGTCTGAAAAAGTGAAATGG - Intergenic
1103973451 12:124686853-124686875 TGAGGTCTCCAGCAGTGGAAAGG + Intergenic
1104319254 12:127735081-127735103 TGGGGTGTGCAGAACTGGACTGG + Intergenic
1105423808 13:20276496-20276518 TGGGGACTCCAGAAGTGGAGAGG + Intergenic
1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG + Intergenic
1107541697 13:41394871-41394893 TTGTGTCTTCAGGAGTGGAATGG + Intergenic
1108701708 13:52949452-52949474 TAGAGTCTGGAGATGGGGAAGGG + Intergenic
1110731047 13:78878610-78878632 AAGGGTCTACAGATGTTGAATGG + Intergenic
1113533993 13:111049930-111049952 CAGCCTCTGCAGAAGTGGTAGGG - Intergenic
1113633619 13:111905002-111905024 TCGGGTCTGCATAAGTGCGAAGG - Intergenic
1114775164 14:25473436-25473458 GAGGGTCTAAAGAAGAGGAAAGG + Intergenic
1115260208 14:31444429-31444451 GATGGTCTGCAGAAAAGGAATGG + Intronic
1115457026 14:33615378-33615400 CAGCGACTGCAGAGGTGGAAGGG + Intronic
1115501654 14:34055087-34055109 GAGGGCATGGAGAAGTGGAAGGG + Intronic
1118370887 14:65136319-65136341 TAGGCCCTGCAGATGTGGGAAGG - Intergenic
1118810178 14:69267421-69267443 ATGGGTCTGGAAAAGTGGAAAGG - Intronic
1121297797 14:92843797-92843819 TTGTCTCTGCAGAAGTGGCAGGG + Intergenic
1123990001 15:25676085-25676107 TGGGCTCTGCAGCAGTGGCAGGG + Intergenic
1124225285 15:27888096-27888118 TCAGGTCTGCAGAAGTGAAGAGG - Intronic
1126088459 15:45030767-45030789 TAGGTGCTGGAGAAGTGCAAAGG + Intronic
1128860458 15:71066675-71066697 TTGGGTCTGAGGAAATGGAATGG - Intergenic
1129929622 15:79399506-79399528 TTGGGTCTGGAGAAGTAGGATGG + Intronic
1130198882 15:81807086-81807108 TAAGGTTTGCAGGAGTGGAAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132405494 15:101539807-101539829 CTGTGTCTGCAGAGGTGGAAGGG + Intergenic
1132984778 16:2759611-2759633 CAGAGTCAGCAGAAGTTGAACGG - Exonic
1134654209 16:15935042-15935064 TCTTTTCTGCAGAAGTGGAAAGG + Intergenic
1136608247 16:31350970-31350992 TGGGGTCTCCAGAAGGGGAGAGG + Intergenic
1139029883 16:62867256-62867278 GAAGGTCTGGAGAAGTGGCAGGG - Intergenic
1139964562 16:70738233-70738255 TAGAGTCTGCAGAACTGGAGGGG + Intronic
1141002135 16:80317974-80317996 GAGGCACTGCAGAAGAGGAAGGG + Intergenic
1141932113 16:87212411-87212433 TAGGAGCTGCAGAATTGAAAGGG + Intronic
1143255440 17:5554185-5554207 GAGGGTCTGCAGGAGAGGGATGG + Intronic
1143256601 17:5562234-5562256 TAGGATCTGCAGAAGTGGGTGGG - Intronic
1143796804 17:9343567-9343589 GAGGCTCTGAAAAAGTGGAAAGG - Intronic
1143877632 17:10004063-10004085 TAGGGTGTTTAGAGGTGGAAAGG + Intronic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1145377134 17:22361279-22361301 TGGGGACTGCAGAAATTGAATGG - Intergenic
1147919385 17:43906919-43906941 TAGGGTCTGGAGACTTGGGAGGG - Intronic
1148930246 17:51121417-51121439 CAGGGTCTGCCCAAGTGGAAAGG + Intergenic
1149735216 17:58987436-58987458 CAGGGTCTGCAGAGCAGGAATGG + Intronic
1150272742 17:63876980-63877002 TGGGGTCAACAGAAGTGGAGAGG - Intronic
1150274083 17:63884739-63884761 TGGGGTCAACAGAAGTGGAGAGG - Intergenic
1150278396 17:63914273-63914295 TGGGGTCAACAGAAGTGGAGAGG - Intronic
1150606424 17:66695110-66695132 AAGGCTCTGCACAAGAGGAAGGG - Intronic
1150752292 17:67876081-67876103 TAGTATCTACAGAACTGGAAAGG - Intronic
1151078083 17:71297157-71297179 TAAGGGATCCAGAAGTGGAAGGG - Intergenic
1151143367 17:72016493-72016515 TGGGGTCTGGAGAAGGAGAAAGG + Intergenic
1152265441 17:79291610-79291632 CAGGGTCTGCAGAGCCGGAATGG + Intronic
1152450630 17:80377098-80377120 TGGCGTCTGCAGAAGACGAATGG + Intronic
1152763526 17:82122329-82122351 AAGGGTCTGCAGCAGTGGCCAGG - Intronic
1153169617 18:2301066-2301088 AAGGGTCTTTAAAAGTGGAAAGG + Intergenic
1153591659 18:6680455-6680477 TATTGGCTGAAGAAGTGGAAGGG + Intergenic
1153890088 18:9505357-9505379 TAGGGTGTGGAGAAGAGGCAGGG - Intronic
1154057909 18:11029455-11029477 AGGGGTCTGCAGAAGTGGGTTGG - Intronic
1156390646 18:36647695-36647717 AAGGGTCATCAGAAGTAGAATGG + Intronic
1157062347 18:44306333-44306355 TGGGGACTCCAGAAGTGGAGAGG - Intergenic
1157596697 18:48868456-48868478 TAGAGTGTGCAGAATTGCAAGGG - Intergenic
1159102955 18:63975401-63975423 TAGGGTCTGCAGATGTTGGAAGG - Intronic
1160051465 18:75438035-75438057 GAGGTTCTGCAGCAGAGGAATGG + Intergenic
1160409553 18:78666669-78666691 TGGGGTGTGCAGGAGAGGAAGGG + Intergenic
1160417520 18:78721433-78721455 TGGGGGCTTCAGAAGGGGAAGGG + Intergenic
1160445907 18:78926488-78926510 GAGGGTCTGCAGACATGAAAGGG + Intergenic
1160531452 18:79567436-79567458 TAGGATGAGAAGAAGTGGAAAGG + Intergenic
1161580427 19:5077749-5077771 CAGGGGCTGCAGGGGTGGAAGGG + Intronic
1164273859 19:23699737-23699759 CAGAGTCTGCAGAAGTGAATAGG - Intergenic
1164493691 19:28737730-28737752 TCTGGACTGCAGAACTGGAAGGG + Intergenic
1164989576 19:32674677-32674699 TAGGGTCTGCTGGAGGGGAGCGG - Intronic
1165885728 19:39076792-39076814 TAGGGGCTGCAGAATTGGGCAGG + Intergenic
1166002650 19:39887001-39887023 TGGAGTCTGCAGAGCTGGAAAGG + Intronic
1166005436 19:39903253-39903275 TGGAGTCTGCAGAGCTGGAAAGG + Intronic
1166141063 19:40805579-40805601 TTGTGTCTGCAGAAGTGGCTGGG + Intronic
1168009899 19:53521631-53521653 TGGGGTCTGCAGAGGTGGCACGG + Exonic
1168056062 19:53866090-53866112 GGGGGTCTGCAGGAGTGGAGAGG - Intergenic
1168199684 19:54805603-54805625 TTCTGTCTCCAGAAGTGGAAGGG + Intronic
1168201566 19:54819149-54819171 TTCTGTCTCCAGAAGTGGAAGGG + Intronic
926210711 2:10867598-10867620 TGGAGTCTGCAGAGGTGGAAGGG + Intergenic
926428942 2:12766629-12766651 TGGGTCCTGCAGAACTGGAATGG + Intergenic
927854541 2:26519552-26519574 TACAGGCTGCAGATGTGGAATGG - Intronic
927882026 2:26695688-26695710 TAAGGTGTGCAGAAATGAAAGGG + Intronic
928524817 2:32129440-32129462 TAGGGTCAGCAGAGGGTGAATGG - Intronic
930516666 2:52416474-52416496 TAGGGGCTTCAGGAGTGGAAGGG + Intergenic
931851604 2:66257065-66257087 TAGTGTCAGCGTAAGTGGAAAGG + Intergenic
932631160 2:73344626-73344648 GAGGGTCTGGCGAAATGGAAAGG - Intergenic
932980208 2:76654313-76654335 TAGGGGCTGAAGAAGAGGCAGGG - Intergenic
933529974 2:83496480-83496502 TAGGGTGTGGAGAGGTGGGAGGG - Intergenic
938182250 2:129193592-129193614 TATGGTCTGCTGGAGTGGGACGG + Intergenic
939345568 2:140962756-140962778 TGGGATGTGCAGCAGTGGAAAGG + Intronic
939991008 2:148876439-148876461 GAGGGTCTGCAGACATGGGAGGG - Intronic
942889628 2:180972887-180972909 TAGGGATTCCAGAATTGGAAAGG + Intronic
943057077 2:182995086-182995108 GAGGGTATGCAGATGTGAAAGGG - Intronic
943057474 2:182999986-183000008 TGGGGACTCCAGAAGTGGGAAGG + Intronic
944175212 2:196821198-196821220 TAGGGTGTCCAGAGGTGGCATGG + Intergenic
945178207 2:207064764-207064786 GGGGGGCTGCAGAAGAGGAAGGG + Intergenic
946100042 2:217312705-217312727 AAGGGTATGCAGAATTGGATAGG + Intronic
947100705 2:226618265-226618287 CAGTGTCTGCAGATGTTGAAAGG - Intergenic
948163029 2:235840656-235840678 TGGGGGCTGCAGGAATGGAAAGG + Intronic
1171024765 20:21619803-21619825 GAGGGGAGGCAGAAGTGGAAAGG + Intergenic
1171535254 20:25881700-25881722 TAGGGACTGCAGAAATTGAATGG + Intergenic
1171805794 20:29679190-29679212 TGGGGACTGCAGAAATTGAATGG - Intergenic
1171838267 20:30177245-30177267 TGGGGACTGCAGAAATTGAATGG + Intergenic
1179015968 21:37594721-37594743 CAGCGTCCGCAGAAGTGGAAGGG + Intergenic
1179317068 21:40253452-40253474 CAGGTACTGCAGAAGTAGAAAGG - Intronic
1180574656 22:16761283-16761305 TGGGGACTGCAGAAATCGAATGG + Intergenic
1180592776 22:16955302-16955324 CAGGGGCTGCAGCAGTGGACTGG + Intergenic
1181860457 22:25813864-25813886 CAGGGTCTGCAGCCGTGGGAAGG - Intronic
1184523594 22:45009214-45009236 TAGGGTCTGCATGACTGGGAGGG - Intronic
1203300452 22_KI270736v1_random:73452-73474 TGGAGTGGGCAGAAGTGGAATGG + Intergenic
950750963 3:15127691-15127713 TAAGTTCTGCAGTAGGGGAAGGG + Intergenic
951503907 3:23419883-23419905 TCAGGTCTGCAGAAGTCCAAGGG + Intronic
951598678 3:24347365-24347387 TAGGGTCAACAAAAGTGGAAAGG + Intronic
952032030 3:29154857-29154879 TTGGCTCTGCAGAGGTGCAAAGG + Intergenic
952337899 3:32420810-32420832 AATGGCCTGCAGAAGTGGCAAGG + Intronic
953190049 3:40677246-40677268 TATGGACTGTAGAAGTGGAGTGG + Intergenic
954082384 3:48220173-48220195 CTGGGTCTGCAGGAGAGGAAGGG + Intergenic
954278720 3:49560437-49560459 CAGGGCCTGCAGAAGCTGAATGG - Intronic
958029870 3:88095847-88095869 GAGTATCTGCTGAAGTGGAAAGG - Intronic
958181088 3:90061788-90061810 GTGGGACTGCAGAAGTGGAGAGG - Intergenic
960596400 3:119411794-119411816 AAGGGTCTGCTGAACTGTAATGG - Intronic
961179773 3:124867407-124867429 TAGGGTTTGCAGAAGTTGGGAGG - Intronic
961283606 3:125782435-125782457 TAAGTTCTGCAGTAGGGGAAGGG + Intergenic
962052371 3:131830446-131830468 TAGGGTGTAAAGGAGTGGAATGG - Intronic
962109705 3:132431431-132431453 TAGGGTCGGCATCATTGGAAAGG + Intronic
962871865 3:139503648-139503670 TATGTACTCCAGAAGTGGAAGGG - Intergenic
965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG + Intergenic
965614477 3:170579339-170579361 AATGGTCTTCAGAAATGGAAAGG - Intronic
967415289 3:189210419-189210441 TAGGGTCTGTAGCAGTAAAAAGG + Intronic
969014102 4:4091775-4091797 TAAGTTCTGCAGTAGGGGAAGGG - Intergenic
969054680 4:4394223-4394245 AAGGATTTGAAGAAGTGGAATGG - Intronic
969215811 4:5721490-5721512 CAGGGGCTGCAGCAGAGGAAAGG + Intronic
969335083 4:6503090-6503112 TAAAGTCTGCAGCAGTGGCATGG - Intronic
969610104 4:8223010-8223032 CAGGGGCTGCAGAAGGGAAAGGG - Intronic
969739886 4:9016651-9016673 TAAGTTCTGCAGTAGGGGAAGGG + Intergenic
969799041 4:9548168-9548190 TAAGTTCTGCAGTAGGGGAAGGG + Intergenic
969855406 4:9995146-9995168 TGGGGTCTGTAGATGGGGAATGG - Intronic
970048686 4:11885744-11885766 AATGGTCTGAAGAAGTAGAAGGG + Intergenic
970823529 4:20248196-20248218 AATGGCCTTCAGAAGTGGAAAGG - Intergenic
971231668 4:24805072-24805094 TAAGGCCTGTAGAAGTGGATTGG - Intergenic
974007041 4:56568815-56568837 TAGGGCTTGGAGAAGTTGAAGGG - Intronic
979684633 4:123497797-123497819 TAGGGTGGGGAGAGGTGGAATGG - Intergenic
981136879 4:141220770-141220792 GAGGATCTGCAGAAAAGGAAGGG - Intergenic
983122098 4:163899023-163899045 TAGGAACTCCAAAAGTGGAAGGG + Intronic
983577699 4:169276234-169276256 TTTGGTCTGCAGTAGTGGGAAGG + Intergenic
984704428 4:182837314-182837336 TAGGTTCTGCACAAGAGGGATGG - Intergenic
985872708 5:2570015-2570037 AAGGGTCTGCAGAAGAGGAGGGG - Intergenic
986253170 5:6079774-6079796 TCGGGACTGCAGAAGAGGAATGG + Intergenic
987176168 5:15312858-15312880 TGGGATCTGGAGAACTGGAATGG + Intergenic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
994623069 5:102186253-102186275 TAGGGTCCCCACAATTGGAAGGG - Intergenic
996564033 5:124861080-124861102 AAAGGTCTGCAGAAGGGAAAGGG + Intergenic
996623879 5:125545224-125545246 GAGGGTCTTCAGAAGAGAAAAGG + Intergenic
997654592 5:135545626-135545648 TGGGGACTGGAGAAGGGGAATGG + Intergenic
997679390 5:135738671-135738693 TTGGGACTGCAGAGCTGGAAGGG - Intergenic
999423286 5:151463646-151463668 AAGGGTCTGCATCAGTGGAGAGG + Intronic
999694743 5:154179066-154179088 TAGGGTCTGCAGGAAACGAATGG + Intronic
1000280131 5:159774850-159774872 GAGTTTCTGCAGAAGAGGAAAGG + Intergenic
1004829256 6:19459837-19459859 TTGGGTCTGCAGAACTAGCAAGG - Intergenic
1005933548 6:30501135-30501157 TAGGGTCTGGACAAGGGGAAGGG + Intergenic
1007251996 6:40502079-40502101 AAGGCCCTACAGAAGTGGAAAGG - Intronic
1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG + Intronic
1007722616 6:43894197-43894219 TATGCTCTGCAGGAGTGGCAGGG + Intergenic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1010774595 6:79870469-79870491 TAGTGTCTACAGCAGTGGCATGG + Intergenic
1013127248 6:107196244-107196266 TAACTTCTGCAGAAGTGGTAGGG + Intronic
1013429698 6:110044364-110044386 CTGGGTCTGCAGAAGTGAAGTGG - Intergenic
1015495373 6:133876444-133876466 TATGGTTTTCAGAAGTGAAAAGG + Intergenic
1017220010 6:151954944-151954966 TTGGGTCTGTGGAAGTGGGAGGG + Intronic
1021242337 7:18218684-18218706 TATGGTCTGCTGCAATGGAAGGG - Intronic
1023299342 7:38752445-38752467 TAGGTGATGGAGAAGTGGAAAGG + Intronic
1024377119 7:48652595-48652617 TATTGTGTTCAGAAGTGGAATGG + Intergenic
1024722250 7:52150126-52150148 TAGGGACTTCAAAAGTGGAAAGG - Intergenic
1025286761 7:57668724-57668746 TGGGGACTGCAGAAATTGAATGG + Intergenic
1025299307 7:57805304-57805326 TAGGGACTGCAGAAATTGAATGG - Intergenic
1026235076 7:68520345-68520367 TTGGCTTTGCAGAAGTGGGAAGG + Intergenic
1027967042 7:85025465-85025487 TAGGGCCTTTAGTAGTGGAATGG + Intronic
1029172665 7:98641884-98641906 GAGGGTTTGGGGAAGTGGAAGGG + Intergenic
1029481050 7:100813167-100813189 TAGGGTCTTCATAAGTGAAGGGG + Exonic
1029598650 7:101550994-101551016 CTGAGTCTGCAGAAGAGGAAGGG - Intronic
1031849898 7:126851131-126851153 TGGGGTCTGAATAACTGGAAAGG - Intronic
1032553403 7:132806549-132806571 TAGGGTCTTCAAGAATGGAAAGG + Intronic
1035108212 7:156459529-156459551 TAGGTTCTGGAGAGGTGGAAAGG + Intergenic
1035457267 7:159016696-159016718 TAAGGTCTGCAGCGATGGAAGGG - Intergenic
1035457308 7:159016950-159016972 TGAGGTCTGCAGCAGTGGAAGGG - Intergenic
1035457319 7:159017016-159017038 TGAGGTCTGCAGCAGTGGAAGGG - Intergenic
1035878348 8:3216734-3216756 AAAGGTATGCATAAGTGGAACGG - Intronic
1036244912 8:7107894-7107916 TAAGTTCTGCAGTAGGGGAAGGG + Intergenic
1036896911 8:12643563-12643585 TACGTTCTGCAGTAGGGGAAGGG - Intergenic
1037636258 8:20703384-20703406 TAGTCACTGCAGCAGTGGAAGGG - Intergenic
1038146183 8:24898290-24898312 CAGAGACTGCAGAAGTGCAAAGG + Intergenic
1038163700 8:25064399-25064421 TAGAGACTGCAGCAGTGGACTGG - Intergenic
1038837447 8:31142365-31142387 TCTGGTGTGTAGAAGTGGAAAGG + Intronic
1039608888 8:38903545-38903567 TTTGTTCTGCAGAAGTGGGAAGG + Intronic
1039734715 8:40319227-40319249 TAGGGTCAGCAGAAGAGAAGTGG + Intergenic
1039789975 8:40867748-40867770 AAAGGTTTGCAGAAGAGGAATGG - Intronic
1043414673 8:80034393-80034415 CAGGCTCTGCAGAAGTGGCAGGG - Intronic
1043562515 8:81510817-81510839 GAGTATCTGCAGCAGTGGAATGG + Intergenic
1043587430 8:81785247-81785269 TAGCTTCTGTTGAAGTGGAAGGG - Intergenic
1044113213 8:88302647-88302669 TTGGAAATGCAGAAGTGGAAGGG + Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1047292069 8:123540269-123540291 TTGGGGCTGCAGAGGTGCAAAGG - Intronic
1048365125 8:133731790-133731812 GAGGGTGTGCAGAGGAGGAAAGG + Intergenic
1049038043 8:140091912-140091934 ATGGGTCTGCAGAGGTGGAATGG - Intronic
1050634886 9:7601892-7601914 TAGTATTTGCAGGAGTGGAAAGG + Intergenic
1052944156 9:34154176-34154198 TAGAGTGTGCAGAAGAGGAAAGG - Intergenic
1053794271 9:41710720-41710742 TAGGGACTGCAGAAATTGAATGG + Intergenic
1054150902 9:61604103-61604125 TAGGGACTGCAGAAATTGAATGG - Intergenic
1054182679 9:61922764-61922786 TAGGGACTGCAGAAATTGAATGG + Intergenic
1054470679 9:65535214-65535236 TAGGGACTGCAGAAATTGAATGG - Intergenic
1054655828 9:67665715-67665737 TAGGGACTGCAGAAATTGAATGG - Intergenic
1055873355 9:80913094-80913116 GAGAGTCTCCAGAAGTGGACAGG - Intergenic
1057829563 9:98396256-98396278 CAGGGTCTGCAGCTCTGGAAGGG - Intronic
1060004262 9:119985769-119985791 TAGGACCTGCAGAAGAGGAAGGG - Intergenic
1060264183 9:122100880-122100902 ATGGGTGTGCAGAAGTGGAAAGG - Intergenic
1060530236 9:124343532-124343554 TAGGGACTGCAGGAGTGGGGAGG - Intronic
1060546379 9:124463744-124463766 TAGAGTCTACAGATGTGAAAAGG - Intronic
1203563690 Un_KI270744v1:76671-76693 ATGGGCCTGCAGAAGGGGAAGGG - Intergenic
1185690821 X:2153917-2153939 CTGGGTCTCCAGAACTGGAAAGG + Intergenic
1187579698 X:20594565-20594587 TAGGATATGTAGAAGTAGAAGGG - Intergenic
1190421477 X:50288956-50288978 GAGGGTCTGGTAAAGTGGAAAGG - Intronic
1190753439 X:53381184-53381206 TAGTTTCTGAAGAAGTGGAGTGG - Intronic
1197394105 X:125904950-125904972 TAGGGCCTGAATGAGTGGAAAGG + Intergenic
1199846574 X:151695905-151695927 TAGGGTTTGGAGAAGTGGTTTGG + Intronic
1201073316 Y:10169378-10169400 GAGGTTCTGCTGAAGTGGACAGG - Intergenic
1202027148 Y:20536307-20536329 TAGAGTAGGTAGAAGTGGAATGG + Intergenic