ID: 1105606766

View in Genome Browser
Species Human (GRCh38)
Location 13:21932490-21932512
Sequence GCCAGAGCAACTACCTTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105606766_1105606770 0 Left 1105606766 13:21932490-21932512 CCCTCGAAGGTAGTTGCTCTGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1105606770 13:21932513-21932535 CCCAAAATCTTGCTGCCCAGAGG 0: 1
1: 0
2: 1
3: 9
4: 135
1105606766_1105606774 17 Left 1105606766 13:21932490-21932512 CCCTCGAAGGTAGTTGCTCTGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1105606774 13:21932530-21932552 CAGAGGCCACCTCCCTGCCCAGG 0: 1
1: 0
2: 11
3: 78
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105606766 Original CRISPR GCCAGAGCAACTACCTTCGA GGG (reversed) Intergenic
905542776 1:38773563-38773585 GCCAGAGCAACTGCATTGGTAGG + Intergenic
907332229 1:53678864-53678886 GCCAGAGAATCTGCCTTCTATGG + Intronic
1065624011 10:27612430-27612452 GCCAGAGCCACTGCCTACAAAGG + Intergenic
1072727335 10:97822543-97822565 GTCAGCGCCACAACCTTCGATGG + Intergenic
1076708197 10:132313840-132313862 GCCAGAGCTAGCACCTTCCACGG - Intronic
1089697168 11:120223038-120223060 GCCAGAGCCGCCACATTCGAAGG + Intronic
1090969063 11:131623959-131623981 GTCAGAGCAACTGCCTTTGTGGG - Intronic
1093847585 12:23992192-23992214 GCCAGACCAACTTCCTTTAAGGG - Intergenic
1096957687 12:55543414-55543436 GCAAGAGCAAACACATTCGAGGG - Intergenic
1101748809 12:107565689-107565711 GGCAGAGCAACTACCAACGAGGG - Intronic
1103611312 12:122125883-122125905 GCCAGGGCATCTGCCTTCCAGGG + Intronic
1105606766 13:21932490-21932512 GCCAGAGCAACTACCTTCGAGGG - Intergenic
1109992908 13:70082376-70082398 CCTAGAGCAACTACCTACTATGG - Intronic
1120946185 14:89999724-89999746 GCCAAAGCACCTACTTTCAAAGG - Intronic
1127851034 15:62911917-62911939 GCCACACCAACCACCTTCCAAGG + Intergenic
1131274222 15:90967292-90967314 CTCAGAGAAACTACCTTCAAGGG - Intronic
1131284999 15:91049532-91049554 GCCACAGCAACAACCTCCTAAGG - Intergenic
1131345124 15:91639560-91639582 GCCACAGCAGCTACATTGGAGGG + Intergenic
1139422472 16:66857053-66857075 CCCAGAGCAAGTCCCTTCTATGG + Intronic
1143336686 17:6176695-6176717 GCCAGAGGCCCTGCCTTCGATGG - Intergenic
1150798007 17:68254966-68254988 GCCAGGACAACTACAGTCGAGGG - Intronic
929569770 2:43014842-43014864 GCTAGAGCAACCACCTTGGAGGG + Intergenic
934919866 2:98334182-98334204 GCCACAGCATCTACCTTCCCTGG - Intronic
935276111 2:101476544-101476566 GCCCCAGCAACTACCTTCCAGGG - Intergenic
943994564 2:194744690-194744712 GACAGAGTACCTACCTTCAATGG - Intergenic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1182133186 22:27874229-27874251 GCCAGAGCAACTACTGTGGCTGG + Intronic
1185053182 22:48564299-48564321 GCCAGAGCAGCTACCTAAGGGGG + Intronic
949205595 3:1435077-1435099 GCCACAGCAACTTCTTTTGAGGG + Intergenic
961209606 3:125115691-125115713 GCCAGAACAATTATCTTCAATGG - Intronic
966723852 3:183090922-183090944 TCCAGAGCACTGACCTTCGATGG + Intronic
971610247 4:28714823-28714845 GCATGTGCACCTACCTTCGAAGG + Intergenic
971671610 4:29564831-29564853 GCAAGAGCAAACACATTCGAAGG + Intergenic
981267796 4:142807162-142807184 GCCAGAGCCATTTCCTTCCATGG + Intronic
982247213 4:153365039-153365061 GCCAGTGGAACTATCTTCCAAGG - Intronic
989257333 5:39379773-39379795 GCCAGACCTACAACCTTCCATGG + Intronic
1000239269 5:159394367-159394389 ACCACAGCATCTACCTTGGAGGG - Intergenic
1004445552 6:15694209-15694231 GCCAGGGTAATTACCTTCTAGGG + Intergenic
1005409152 6:25524102-25524124 GCCAGAGAAACTACTTTAGTAGG + Intronic
1014112982 6:117641223-117641245 AACAGAGGAACTACCTTGGAGGG - Intergenic
1017590170 6:155970559-155970581 GACAGAGCAATTTCCTTCCAGGG + Intergenic
1017642704 6:156509835-156509857 GCCAGAGCAACTTCTTAGGAAGG - Intergenic
1024177479 7:46855987-46856009 GCCAGAACAAGTGCCCTCGAGGG - Intergenic
1027336113 7:77152313-77152335 GTCAGAGCCATTACCTTCAAAGG + Intronic
1029779674 7:102718789-102718811 GTCAGAGCCATTACCTTCAAAGG - Intergenic
1031634776 7:124089316-124089338 GCCAGAGGAAATATCTTCTATGG - Intergenic
1034165255 7:149020569-149020591 GCCTGAGCAACAGCCTTTGAGGG + Intronic
1047931350 8:129731468-129731490 TCCAGAGAAACTACCTTAAAGGG + Intergenic
1053142030 9:35688514-35688536 GCCAAAGCAGCTACCTTGGCAGG - Intronic
1055303475 9:74905465-74905487 GGCAGAGCAACTCCCCTCAAGGG + Intergenic
1057024860 9:91727065-91727087 GGCAGAGCACCTATCTCCGATGG - Intronic
1058085768 9:100746511-100746533 GCAAGAGCAAATACATTCAAAGG - Intergenic