ID: 1105607654

View in Genome Browser
Species Human (GRCh38)
Location 13:21940114-21940136
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105607654_1105607667 12 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607667 13:21940149-21940171 GGCATGGAGTGGCTGCTCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 273
1105607654_1105607666 1 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607666 13:21940138-21940160 GATACAGAGGGGGCATGGAGTGG 0: 1
1: 0
2: 3
3: 27
4: 374
1105607654_1105607662 -10 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607662 13:21940127-21940149 TCAGCCTTGGGGATACAGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 306
1105607654_1105607668 13 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607668 13:21940150-21940172 GCATGGAGTGGCTGCTCTCAGGG 0: 1
1: 0
2: 0
3: 42
4: 249
1105607654_1105607665 -4 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG 0: 1
1: 0
2: 4
3: 40
4: 359
1105607654_1105607663 -9 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607663 13:21940128-21940150 CAGCCTTGGGGATACAGAGGGGG 0: 1
1: 0
2: 0
3: 46
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105607654 Original CRISPR CCAAGGCTGATTGGAAGGCC TGG (reversed) Intergenic