ID: 1105607658

View in Genome Browser
Species Human (GRCh38)
Location 13:21940119-21940141
Sequence TATCCCCAAGGCTGATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105607658_1105607665 -9 Left 1105607658 13:21940119-21940141 CCTTCCAATCAGCCTTGGGGATA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG 0: 1
1: 0
2: 4
3: 40
4: 359
1105607658_1105607667 7 Left 1105607658 13:21940119-21940141 CCTTCCAATCAGCCTTGGGGATA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1105607667 13:21940149-21940171 GGCATGGAGTGGCTGCTCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 273
1105607658_1105607668 8 Left 1105607658 13:21940119-21940141 CCTTCCAATCAGCCTTGGGGATA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1105607668 13:21940150-21940172 GCATGGAGTGGCTGCTCTCAGGG 0: 1
1: 0
2: 0
3: 42
4: 249
1105607658_1105607666 -4 Left 1105607658 13:21940119-21940141 CCTTCCAATCAGCCTTGGGGATA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1105607666 13:21940138-21940160 GATACAGAGGGGGCATGGAGTGG 0: 1
1: 0
2: 3
3: 27
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105607658 Original CRISPR TATCCCCAAGGCTGATTGGA AGG (reversed) Intergenic