ID: 1105607659

View in Genome Browser
Species Human (GRCh38)
Location 13:21940123-21940145
Sequence TCTGTATCCCCAAGGCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105607659_1105607666 -8 Left 1105607659 13:21940123-21940145 CCAATCAGCCTTGGGGATACAGA 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1105607666 13:21940138-21940160 GATACAGAGGGGGCATGGAGTGG 0: 1
1: 0
2: 3
3: 27
4: 374
1105607659_1105607668 4 Left 1105607659 13:21940123-21940145 CCAATCAGCCTTGGGGATACAGA 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1105607668 13:21940150-21940172 GCATGGAGTGGCTGCTCTCAGGG 0: 1
1: 0
2: 0
3: 42
4: 249
1105607659_1105607667 3 Left 1105607659 13:21940123-21940145 CCAATCAGCCTTGGGGATACAGA 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1105607667 13:21940149-21940171 GGCATGGAGTGGCTGCTCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105607659 Original CRISPR TCTGTATCCCCAAGGCTGAT TGG (reversed) Intergenic