ID: 1105607662

View in Genome Browser
Species Human (GRCh38)
Location 13:21940127-21940149
Sequence TCAGCCTTGGGGATACAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105607651_1105607662 26 Left 1105607651 13:21940078-21940100 CCTTTCATTGAACAAATGTTGAG 0: 1
1: 1
2: 10
3: 61
4: 435
Right 1105607662 13:21940127-21940149 TCAGCCTTGGGGATACAGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 306
1105607654_1105607662 -10 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607662 13:21940127-21940149 TCAGCCTTGGGGATACAGAGGGG 0: 1
1: 0
2: 0
3: 21
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105607662 Original CRISPR TCAGCCTTGGGGATACAGAG GGG Intergenic