ID: 1105607663

View in Genome Browser
Species Human (GRCh38)
Location 13:21940128-21940150
Sequence CAGCCTTGGGGATACAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 397}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105607654_1105607663 -9 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607663 13:21940128-21940150 CAGCCTTGGGGATACAGAGGGGG 0: 1
1: 0
2: 0
3: 46
4: 397
1105607651_1105607663 27 Left 1105607651 13:21940078-21940100 CCTTTCATTGAACAAATGTTGAG 0: 1
1: 1
2: 10
3: 61
4: 435
Right 1105607663 13:21940128-21940150 CAGCCTTGGGGATACAGAGGGGG 0: 1
1: 0
2: 0
3: 46
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105607663 Original CRISPR CAGCCTTGGGGATACAGAGG GGG Intergenic