ID: 1105607665 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:21940133-21940155 |
| Sequence | TTGGGGATACAGAGGGGGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 404 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 40, 4: 359} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1105607654_1105607665 | -4 | Left | 1105607654 | 13:21940114-21940136 | CCAGGCCTTCCAATCAGCCTTGG | 0: 1 1: 1 2: 1 3: 14 4: 191 |
||
| Right | 1105607665 | 13:21940133-21940155 | TTGGGGATACAGAGGGGGCATGG | 0: 1 1: 0 2: 4 3: 40 4: 359 |
||||
| 1105607658_1105607665 | -9 | Left | 1105607658 | 13:21940119-21940141 | CCTTCCAATCAGCCTTGGGGATA | 0: 1 1: 0 2: 0 3: 5 4: 98 |
||
| Right | 1105607665 | 13:21940133-21940155 | TTGGGGATACAGAGGGGGCATGG | 0: 1 1: 0 2: 4 3: 40 4: 359 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1105607665 | Original CRISPR | TTGGGGATACAGAGGGGGCA TGG | Intergenic | ||