ID: 1105607665

View in Genome Browser
Species Human (GRCh38)
Location 13:21940133-21940155
Sequence TTGGGGATACAGAGGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105607658_1105607665 -9 Left 1105607658 13:21940119-21940141 CCTTCCAATCAGCCTTGGGGATA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG 0: 1
1: 0
2: 4
3: 40
4: 359
1105607654_1105607665 -4 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG 0: 1
1: 0
2: 4
3: 40
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105607665 Original CRISPR TTGGGGATACAGAGGGGGCA TGG Intergenic
900166782 1:1247104-1247126 TTGGGGAAGCAATGGGGGCAGGG - Intergenic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
902910583 1:19594057-19594079 TTAGGGATACAGAAATGGCACGG + Intergenic
903045845 1:20563606-20563628 GTGGGGATGCAGAGAGGGGAGGG + Intergenic
903757289 1:25671427-25671449 TTGGGGATACAGAGGGGAATAGG + Intronic
905222254 1:36456232-36456254 TCGGTAATACAGAGGGGGGAAGG + Exonic
906101938 1:43269644-43269666 TTGGGGAAGCACAGGGGCCATGG + Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
906257026 1:44358150-44358172 TCGGGGATGCAGATGAGGCAAGG + Intergenic
907462284 1:54612105-54612127 TAGGGGGTATAGTGGGGGCAGGG + Intronic
907857620 1:58319122-58319144 GTGGGGAGAAAGAGGGGGCTGGG + Intronic
908001538 1:59685095-59685117 TGGGGGATACGCAGAGGGCAGGG - Intronic
908820306 1:68078830-68078852 TGGGGGATGCAGTGGGGGAAGGG + Intergenic
909259961 1:73474776-73474798 CTTGGGAAACAGAGTGGGCAAGG + Intergenic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
912214577 1:107593468-107593490 TGGAGGATACAGAGCAGGCAAGG - Intronic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
913284533 1:117214437-117214459 TTGGGGATAGAGAGAAGGGATGG - Intergenic
915159762 1:153909688-153909710 TTTGGGAGACTGAGGGGGCGGGG + Intronic
915200138 1:154221098-154221120 GAGGGGATACGGCGGGGGCAGGG - Intronic
915585571 1:156842095-156842117 TCGGGGGTACAGAGGGTGCCAGG - Exonic
916080443 1:161228856-161228878 TGGGGGATGCAGAGGAGGGAGGG + Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
916511451 1:165475354-165475376 TTGGGGATAGAGAGTGGGCCAGG - Intergenic
916748255 1:167701048-167701070 TTGGGAATACGGAAGTGGCAAGG - Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917218254 1:172700215-172700237 TTGGGGCTCCAGTGGGGACAAGG - Intergenic
918146738 1:181763209-181763231 CTGGGGATAGAGAGCAGGCATGG + Intronic
919472745 1:197999218-197999240 TTGGGGTGACTGAGGAGGCATGG - Intergenic
922178409 1:223215070-223215092 TTGGGGATGGAGAGGAGGCTGGG - Intergenic
924086238 1:240454731-240454753 TTAGGGATAGAGAAGGGGCTGGG + Intronic
1063087399 10:2832181-2832203 TGGGGGCTTCAGAGGGAGCATGG - Intergenic
1063187021 10:3660732-3660754 GAGAGGATACTGAGGGGGCAAGG + Intergenic
1064215050 10:13393334-13393356 TTGGGGAGACGGGAGGGGCACGG + Intergenic
1064964339 10:21000200-21000222 GAGGGGGTATAGAGGGGGCATGG + Intronic
1065042864 10:21715442-21715464 TTGGGGTTAGAGAGGGTGAAAGG + Intronic
1066628765 10:37437581-37437603 TTTGGGATGCTGAGGTGGCACGG - Intergenic
1067147001 10:43701338-43701360 TTGGGGGTACAGAGGCTGGAAGG + Intergenic
1067616553 10:47762220-47762242 GTGGGGAGGAAGAGGGGGCAAGG + Intergenic
1069761570 10:70815300-70815322 TTGGGGATGCTGAGGCGGGAGGG - Intergenic
1071500248 10:86198332-86198354 TTGGGGAAACAGAGAGAGCTTGG - Intronic
1071936494 10:90537312-90537334 TTGGGAAGACAGACGGGTCAAGG + Intergenic
1075103015 10:119519240-119519262 TTGGGGATCCTGAGAGGACAGGG - Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1076724410 10:132406839-132406861 TTGGGGGGTCACAGGGGGCAGGG - Intronic
1077752840 11:4991567-4991589 TTAGGGATCCAGAGTGGTCAGGG + Intronic
1078064970 11:8072281-8072303 TTGGAGATGCAGAGGGGGAAGGG + Intronic
1078387970 11:10909545-10909567 TTGGGGGTACTGGGGGGGGATGG + Intergenic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078987115 11:16607246-16607268 TTGGGGCGCCGGAGGGGGCAGGG - Intronic
1079122863 11:17697410-17697432 TTGGGGATGGAAAGGGGGCTGGG + Intergenic
1079321123 11:19452397-19452419 TTTGGAAGACAGAGAGGGCATGG - Intronic
1079400507 11:20103059-20103081 CAGGGGATGCAGAGTGGGCATGG - Intronic
1080181455 11:29431175-29431197 TTTGGGAGGCAGAGGGAGCAAGG - Intergenic
1080368841 11:31610511-31610533 TGGGGAATACGGAGGGGGGAAGG - Intronic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1080863342 11:36170024-36170046 CTGGGGATCCAGAGAGGGAAGGG - Intronic
1081613876 11:44579230-44579252 TGGGAGGTAGAGAGGGGGCAGGG + Intronic
1082754775 11:57063451-57063473 TTGGGGCTACTCAGGGGTCAAGG - Intergenic
1083016265 11:59457453-59457475 TTGGGGCCACAGAAGGGGAATGG - Exonic
1083328574 11:61886189-61886211 TTGGGGCTACTGTGGGGTCAGGG - Intronic
1083655528 11:64227373-64227395 AAGGAGATACACAGGGGGCAGGG - Intronic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1083996205 11:66274128-66274150 ATGGGGATGCAGCTGGGGCATGG - Intronic
1084592527 11:70098829-70098851 TGGTGGATACACAGTGGGCAGGG - Intronic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1085218494 11:74852577-74852599 TTGGGGATGGACAGGGGGAAAGG + Intronic
1085453841 11:76654908-76654930 TAGGGGACACAGAGAGGACAGGG - Intergenic
1085555048 11:77411984-77412006 TTGGCGAAACAGAAGGGGCGGGG + Intronic
1085855496 11:80171384-80171406 TTTGGGAAACACTGGGGGCATGG - Intergenic
1086566517 11:88232583-88232605 TTGGGCATACTGAGGGGAAAAGG + Intergenic
1088115277 11:106305451-106305473 ATGGGGAAAGAGAGGGGGAAGGG + Intergenic
1089144260 11:116312984-116313006 TTGGGGATAAAAATGGGGGAAGG + Intergenic
1089307587 11:117536300-117536322 TTGGGGATGGAGACGGGCCAGGG + Intronic
1089515967 11:119031545-119031567 TTGGGGACAGAGACGGGGCCTGG + Intergenic
1089613003 11:119680002-119680024 CTGGGGATACAGAGATGGAAAGG - Intronic
1089683247 11:120131193-120131215 TTGGGGCTGCAGAGGAGGAAAGG + Intronic
1090922401 11:131217857-131217879 TTGGGTGTGCTGAGGGGGCATGG + Intergenic
1091186403 11:133651543-133651565 TGGAGGCTATAGAGGGGGCAGGG - Intergenic
1091193639 11:133714579-133714601 TTGGTGATACAAGGGTGGCATGG - Intergenic
1096073784 12:48789540-48789562 TTGGGGATGAAGAGTGGGCGCGG - Intergenic
1096836342 12:54353578-54353600 TTGTGGGAAAAGAGGGGGCATGG - Intergenic
1096868756 12:54580182-54580204 TGGGGGCTACAGAGAGGGCAGGG + Exonic
1096966135 12:55629561-55629583 ATCGGGAGACAGAGGGAGCAAGG + Intergenic
1097147299 12:56950672-56950694 TAAGGGACACAGAGAGGGCACGG + Intergenic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1098498351 12:71163012-71163034 ATGTGGCCACAGAGGGGGCAGGG - Intronic
1099278085 12:80603813-80603835 GTGATGATACAGATGGGGCAGGG - Intronic
1101581699 12:106047681-106047703 TTGGGAATATAGAGGAAGCAAGG - Intergenic
1102008155 12:109601903-109601925 TTGGGGGTACAGAGGAGTCCCGG - Intergenic
1102027240 12:109720445-109720467 TGGGGGAGGCAGAGGTGGCAGGG + Intronic
1102195410 12:111021823-111021845 TTGGGCACACAGAGAGGGAAGGG + Intergenic
1103058842 12:117842764-117842786 TGGGCAAGACAGAGGGGGCAGGG + Intronic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103836736 12:123827511-123827533 TGGGTGGGACAGAGGGGGCATGG + Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1105448518 13:20477458-20477480 TTGGGGTTGGAGAGCGGGCATGG + Intronic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106099205 13:26679989-26680011 TTGGGGGTGCTGAGGGAGCAGGG - Intronic
1107410112 13:40150672-40150694 TGGGGGAAACAGAGGAGGGAGGG - Intergenic
1107846592 13:44520492-44520514 TTGGGTATGCAGAGGAAGCATGG + Intronic
1109325590 13:60863703-60863725 TTGGGAATCAAGATGGGGCAAGG + Intergenic
1109711431 13:66165393-66165415 TTGGGTTTTCATAGGGGGCACGG + Intergenic
1110465584 13:75797217-75797239 TTTAGGAAACAGAGGCGGCATGG - Intronic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1111141105 13:84119188-84119210 TTGGGGACACTCAGGGGGAAGGG + Intergenic
1112253827 13:97809135-97809157 GGGGGGAGACAGTGGGGGCAGGG + Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113344962 13:109468141-109468163 TTGGAGCTAAAGAGGTGGCATGG - Intergenic
1114066592 14:19064436-19064458 TTTGGGAGATAGAGGGGGAATGG - Intergenic
1114095674 14:19335587-19335609 TTTGGGAGATAGAGGGGGAATGG + Intergenic
1117348731 14:54860020-54860042 TTGGGTATACACAGGGGTCCTGG - Intronic
1117764035 14:59061352-59061374 GTGGGGAGACAGAGTGGGTAAGG - Intergenic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1120970264 14:90201115-90201137 TTGGGGATACAAATGAGACATGG + Intergenic
1122217338 14:100212997-100213019 TTGGGGTGGCAGAGGGGGCAGGG + Intergenic
1122269424 14:100561875-100561897 TTGGGGTTACAGGTGGGGCCAGG - Intronic
1122918766 14:104871027-104871049 TGGGGGCAACAGAGGGGCCAAGG - Intronic
1124600911 15:31132207-31132229 TTGGGGTCACAGAGGGGCCAGGG - Intronic
1125429604 15:39581517-39581539 TTGGGGTTGCAGGGAGGGCAGGG - Intronic
1125557508 15:40598568-40598590 TTGGGGGGCCGGAGGGGGCAGGG - Intronic
1126790179 15:52213824-52213846 GTGGGGATGCAGCGGGGGCTGGG + Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129598190 15:76981286-76981308 TTGGGGAGGCAGTGGGGGCGGGG - Intergenic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1130106318 15:80931287-80931309 TTTGGGAAACAGAGGGGAAAAGG - Intronic
1130978184 15:88793105-88793127 CTTGGCATGCAGAGGGGGCAGGG + Intergenic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132155405 15:99492435-99492457 GTAGGGTTACAGAGGGGGCTCGG - Intergenic
1132785695 16:1656099-1656121 CTGGGCATCCAGAGTGGGCAGGG + Exonic
1133002993 16:2860465-2860487 CTGGGGAAACAGTGTGGGCAGGG + Intergenic
1134307421 16:13045751-13045773 TGGGGGACACAGTGGGGGCAGGG - Intronic
1134907947 16:17997775-17997797 TTGGGGCTACAGAAGAGTCAAGG + Intergenic
1135029915 16:19030105-19030127 CTGGGGATACAGAGAGGAAAGGG + Intronic
1135227476 16:20674443-20674465 TTGGGGGTGGAGAGGGGGGAGGG - Intronic
1136547737 16:30965134-30965156 CTGGGGAGCCAGAGCGGGCAGGG - Exonic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1137368939 16:47886927-47886949 TTGGAGATACAGAGACGTCAGGG + Intergenic
1137621541 16:49879689-49879711 TTGGGATGACAGAGGAGGCAGGG + Intergenic
1138624542 16:58238708-58238730 CTTGGGATATGGAGGGGGCAGGG - Intronic
1140601932 16:76486793-76486815 TTGGGCTTACAGAGGGTGCCTGG - Intronic
1142062516 16:88039887-88039909 GTGGGGACTCAGAGGGGCCACGG - Intronic
1142799586 17:2337124-2337146 ACGGGGATTCAGAGGGGTCACGG + Exonic
1143368861 17:6425938-6425960 TGGGGGATACAGAGAGGTTAAGG - Intronic
1143583940 17:7842206-7842228 TTGGGGCTCCAGCGGGGGCGGGG + Intronic
1144219866 17:13090185-13090207 TTGAGGAGTCAGAGGGGTCATGG - Intergenic
1146262435 17:31430819-31430841 TGTGGGATACAGTGGGAGCATGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1147233355 17:39036275-39036297 TTGGTGTTAGAAAGGGGGCAGGG - Intergenic
1147768325 17:42851460-42851482 TGGGAGATACAGAGGGGCAATGG - Exonic
1147936753 17:44015919-44015941 TTTGGGTTACAGCGGGAGCATGG - Intronic
1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG + Intronic
1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG + Intronic
1148513008 17:48189171-48189193 TTGGGGATACAGAGGTGAGCAGG + Intronic
1149980026 17:61303335-61303357 TTGGGGATACAGCAGCGGCCTGG + Intronic
1150123043 17:62619109-62619131 CTGGGGATGGAGAGAGGGCACGG + Intergenic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150619339 17:66797693-66797715 GTGGGGACACAGAGGGGAGAAGG - Intronic
1152070602 17:78132057-78132079 GTGGGGCTCCAGAGAGGGCAAGG - Intronic
1152108759 17:78345435-78345457 TGGGGGCTTCAGAGGGAGCACGG + Intergenic
1152131662 17:78480839-78480861 TTGGGAGCACAGTGGGGGCAGGG - Intronic
1152293008 17:79451429-79451451 TTGGGGATAGAGAGGAAGCTGGG + Intronic
1152549033 17:81020084-81020106 GTGGGGATACGGAGGGACCATGG + Intergenic
1152892744 17:82891753-82891775 TGGGGGACACAGAGGGGGCTGGG + Intronic
1152945710 17:83196384-83196406 TTGGAGACACAGAGGAGGCTGGG + Intergenic
1155259711 18:24029660-24029682 TTGGGGACTCAGCGGGGGAAGGG - Intronic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155517843 18:26640889-26640911 TTGGGGACACAGAGAGGACAAGG + Intronic
1156121394 18:33846909-33846931 TGGGAGGTACAGAGGAGGCAAGG - Intergenic
1156369301 18:36458336-36458358 ATAAGGATACAAAGGGGGCAAGG - Intronic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157762088 18:50272775-50272797 TTGGGGCTACAGCAGGGTCAGGG + Intronic
1160389725 18:78521087-78521109 TCGGGGATACAGAAAGGTCAAGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160542850 18:79634590-79634612 TTGGGGGCACAGTGGGGGCGAGG - Intergenic
1161198552 19:3001028-3001050 TTTGGGAGACAGAGGTGGCTGGG + Intronic
1161613095 19:5254582-5254604 TTGGGGAGGCAGAGAGAGCAGGG + Intronic
1162084239 19:8238734-8238756 CTGGGGATACCCAGGGGACATGG + Intronic
1162200288 19:9015085-9015107 TGGCGGAGACAGAGGAGGCAGGG + Intergenic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162941576 19:14013365-14013387 TTGGGGATTCAGTGGGGGAAGGG + Intergenic
1163184016 19:15623780-15623802 CTGGGGCTACAGTGGGGACAGGG + Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1164158690 19:22612296-22612318 TGGGGGATGCAGAGGGGGTAGGG - Intergenic
1165077311 19:33287001-33287023 TTGCGGGTGCAGATGGGGCATGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165760973 19:38320977-38320999 TTCTGGGTCCAGAGGGGGCAAGG - Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1167008786 19:46792629-46792651 GTGATGATACAGAGTGGGCAGGG + Intergenic
1167232891 19:48296651-48296673 TGGGGGATCCACAGGGGGCCAGG + Exonic
1167434048 19:49468817-49468839 TTGGGGAGGCCGTGGGGGCAGGG - Intronic
1167477656 19:49710269-49710291 TTGGGGTTACAGATGGGGGTAGG - Intronic
1167594422 19:50419641-50419663 GTGGGGATGGAGAGGGGGCCTGG - Intronic
1168137938 19:54364247-54364269 TTGGGGTGACAGAGGGGACTGGG + Intronic
1168159993 19:54503761-54503783 TTGGGGTGACAGAGGGGACTGGG - Intronic
1168329318 19:55557537-55557559 TGGGGGAGGCAGTGGGGGCAGGG - Intergenic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
925719675 2:6814706-6814728 CTGGGGATAGAGAGAGGGTAGGG + Intergenic
926623562 2:15070513-15070535 TTAGGGACACAGAGGAGCCATGG - Intergenic
928107201 2:28478172-28478194 TTTGGGAGACTGAAGGGGCATGG - Intronic
928216982 2:29370010-29370032 TTGGGGAGAGAGAGTGTGCAGGG + Intronic
930127365 2:47812126-47812148 TTGAGGCTACAGAAGGGGCAAGG - Intronic
932291407 2:70583158-70583180 TTGGGGATGCAGTGGAGGCAGGG - Intergenic
932719927 2:74131408-74131430 TTGGGAATCCAGAGTGGGAAAGG - Intronic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935793769 2:106619094-106619116 TTGGGGGTGGAGGGGGGGCAGGG + Intergenic
936089600 2:109492536-109492558 TTGGGGAAACATAGAAGGCAGGG - Intronic
936255750 2:110909307-110909329 GTGGGGGTACAGGGGAGGCAGGG + Intronic
936282903 2:111158326-111158348 TTAGGGACACTGAGGTGGCAGGG - Intronic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
937888286 2:126915414-126915436 TTGGGTATACAGAGGCACCAGGG - Intergenic
938483983 2:131684564-131684586 TTTGGGAGATAGAGGGGGAATGG - Intergenic
938712335 2:133986147-133986169 TTGGGCCTTCAGAGGGAGCACGG - Intergenic
940968864 2:159872148-159872170 TTGGGAATTCAGAGGAGGGAGGG - Intronic
941126806 2:161594371-161594393 TTGGCCATATAGAGTGGGCAGGG + Intronic
941530769 2:166667834-166667856 TTAGGGACTCAGAGGGGGAAGGG + Intergenic
941987961 2:171526436-171526458 GTGGGGAGAGAGAGGGGGAAAGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
948618463 2:239216991-239217013 TTGGGGTTACACTGGGGGAAGGG - Intronic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
1169038830 20:2476138-2476160 TTGGGAATACAGAGAGAGCTGGG + Intronic
1171250420 20:23642035-23642057 TTGGGGAGAGAGAGGGGAGAAGG - Intergenic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172447272 20:34999768-34999790 CTGTGGATACAGAGCAGGCAGGG - Intronic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1173061005 20:39661164-39661186 ATGTGGAGACAAAGGGGGCATGG - Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173970111 20:47146075-47146097 TGGGGGAGAGAGAGGTGGCAAGG + Intronic
1174046112 20:47735060-47735082 ATGGGAATTCAGAGGGGGCATGG - Intronic
1174168697 20:48603370-48603392 TTGGGGATGCAGGGAGGGAATGG - Intergenic
1174533816 20:51235865-51235887 TTGGGGATGGAGGGAGGGCAAGG + Intergenic
1176073909 20:63239925-63239947 TTGGGGAAACAGGGTGGGCCAGG + Intronic
1178704747 21:34864134-34864156 GTGGGGCCACAGAGAGGGCAGGG - Intronic
1179881849 21:44296313-44296335 GTGGGGGTACAGAGGCCGCAGGG - Intronic
1180485073 22:15787026-15787048 TTTGGGAGATAGAGGGGGAATGG - Intergenic
1180875742 22:19174529-19174551 TTGGGGGTACAAAGGGAGCACGG - Intergenic
1180928383 22:19572053-19572075 TTGCAGAGACAGAGGGGCCAAGG - Intergenic
1181543105 22:23584391-23584413 TGGGGCATAGAGAGTGGGCAGGG - Intergenic
1181593036 22:23896316-23896338 TGGGGGAGACATGGGGGGCATGG + Intronic
1182658481 22:31908235-31908257 TTAGTGAGACAGAGCGGGCATGG - Intergenic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1183602187 22:38846225-38846247 CTGGGGATAGAGATGGGCCAAGG - Intergenic
1183726459 22:39592668-39592690 TCTGGGTGACAGAGGGGGCAGGG - Intronic
1184729694 22:46365772-46365794 TTGGGAACACAGAAGGGGTAGGG - Intronic
1185244918 22:49768374-49768396 GTGGGGAGTCAGAGGAGGCAGGG + Intergenic
950012571 3:9733419-9733441 CTGGGGATACAGAGGTGGATAGG + Intronic
950229718 3:11265942-11265964 TTTGGGATGCAGAGGTGGGAGGG + Intergenic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950598709 3:14011292-14011314 TTGGGGGAAAAGAGGGGGAAAGG - Intronic
950626775 3:14253133-14253155 TGGGGGCAACAGAGGGGGTAGGG + Intergenic
950820743 3:15755631-15755653 ATGGAGATACAGGGGAGGCAGGG + Intronic
950880442 3:16318725-16318747 TGGGGGATACAGGGTGGGAAAGG - Intronic
953221018 3:40971592-40971614 TTGTGGATACAAAGGAGGGAGGG + Intergenic
953232064 3:41074176-41074198 TTGGGGCTAGTGAGGGGGCAGGG - Intergenic
953411530 3:42693039-42693061 GTGGGGATACAGAAGGTGCCAGG - Intronic
953412583 3:42698619-42698641 TTGGGGATACTTGGGGTGCAAGG + Intronic
954574052 3:51665158-51665180 TGGGGGATACAGAGGGGGCGGGG - Exonic
954701645 3:52453811-52453833 TTGAGGATGCAGAAGGGGTAGGG - Intronic
958916359 3:100054798-100054820 ATGGTGAGAGAGAGGGGGCAAGG - Intronic
961452661 3:127009364-127009386 TTGGGGAGGCAGAGCAGGCAGGG + Intronic
961917607 3:130393364-130393386 TGGGGGATACAGTGGGGACACGG - Intronic
962747363 3:138406897-138406919 TTGGAGTTACAGAGGAGGGATGG - Intergenic
963042842 3:141081991-141082013 TTGGGGATACAGGAGGGACATGG - Intronic
967240207 3:187431127-187431149 TTGGGTTTACAGAGAGGGCAAGG - Intergenic
969213277 4:5704325-5704347 TTGGGGAGAGGGAGGAGGCAAGG + Intronic
969324191 4:6431520-6431542 TTGGGGACACAGACGTGGCTGGG - Intronic
969554110 4:7894590-7894612 TCAGGGAGACAGAGGGGGCCTGG + Intronic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
975609070 4:76186145-76186167 GTGGGCATACAGAGGAGGGAGGG + Intronic
976687885 4:87836024-87836046 TTGGGGGTATAGAGGGGACAAGG + Intronic
986151607 5:5134929-5134951 TTGTGGAAACACAGGGGGCTGGG + Intergenic
988267230 5:28967709-28967731 TTGGGGAGCCAGAGGGGAGATGG - Intergenic
988268128 5:28978217-28978239 TTAGGAATACACAGGGGACAAGG - Intergenic
988588858 5:32531486-32531508 TTTGGGATGCAGAGGTGGGAGGG - Intergenic
991419646 5:66428053-66428075 TTTGGGAGACAGAGGTGGGAGGG + Intergenic
992813604 5:80413953-80413975 TTGGGAATATAGAGGGGAGAGGG - Intronic
992891878 5:81211220-81211242 TTGGGAATACACAGGCAGCATGG - Intronic
993364400 5:87018992-87019014 CTGGGCTTACAGAGTGGGCAGGG - Intergenic
995027379 5:107439428-107439450 TTAGGGATACAGTGGGGGATAGG + Intronic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996498411 5:124188449-124188471 TTTGGGAGGCCGAGGGGGCACGG - Intergenic
996525491 5:124474672-124474694 TTGTGGAAACAGAGGGGGTATGG - Intergenic
997474161 5:134133145-134133167 TGGGGGAGACAGAGGGGCAAAGG + Intronic
998193741 5:140048163-140048185 TTAGGGAGACAGAGGTGGGAGGG + Intergenic
998230247 5:140357183-140357205 TTGGGGCCACAGAAAGGGCAAGG + Intergenic
998250720 5:140550419-140550441 TTGCAGATACACAGGGAGCAGGG + Exonic
999061022 5:148635355-148635377 TTGTGGATAGAGAGGGGGAGTGG + Intronic
1000393319 5:160747651-160747673 TAGAGGCTTCAGAGGGGGCATGG + Intronic
1001184738 5:169558867-169558889 ATGGGGATGGAGAGGAGGCAGGG - Intergenic
1001847936 5:174938061-174938083 CTGGGGATACAGAGGGGATGAGG - Intergenic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004630898 6:17420171-17420193 CTGGGGATAAAAATGGGGCAGGG - Intronic
1004886512 6:20056440-20056462 TTGAGAATAAAGAGGGAGCATGG + Intergenic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1006677066 6:35771935-35771957 TTGGGGATACAGATTGGAGATGG - Intergenic
1007649036 6:43405894-43405916 TTGAGGAAAGAGAGGGGGAAGGG + Intergenic
1007693125 6:43715772-43715794 TTGGGGGTTCAGAGGGGCCCTGG + Intergenic
1011043546 6:83057380-83057402 CTGGGGATACAGAGTGAACAAGG - Intronic
1011364234 6:86563189-86563211 TTGGAGATTCAGAGGGGGTCAGG - Intergenic
1012399770 6:98834120-98834142 ATGGGGAAACGGAGGGGGTAAGG - Intergenic
1013076393 6:106775369-106775391 TTGGGTATAAAAAGGGGGCTGGG - Intergenic
1015102670 6:129499923-129499945 TTGGAGAGACAGAGGGGGGCAGG + Intronic
1015772918 6:136787243-136787265 TTGAGGATACAGTGGGTTCAAGG - Intronic
1017596002 6:156029210-156029232 TGGGGGATAAAGATGGGGAAGGG - Intergenic
1017845782 6:158257188-158257210 TTTGGGAGGGAGAGGGGGCAGGG - Intronic
1018003468 6:159599749-159599771 TAGAGGATTCAGAGGGAGCATGG - Intergenic
1019368448 7:647402-647424 TTGGGATCATAGAGGGGGCATGG - Intronic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1020204778 7:6105534-6105556 TTAGGGATGCAGTGGGGGCGGGG - Intronic
1020297710 7:6771015-6771037 TTGGGGAGAGAGAGAGGGGAGGG + Intronic
1020689775 7:11339755-11339777 TTGGGGATGCTGGTGGGGCAGGG + Intergenic
1021058945 7:16085700-16085722 TTGGGGATGGAGATGGGGAAAGG + Intergenic
1022174719 7:27862062-27862084 GGGAGGATACAGAGGGGGAAAGG + Intronic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023927110 7:44677504-44677526 TTGGGGACACAGAGCAGGGAGGG + Intronic
1025710268 7:63901452-63901474 ATGTGGATATTGAGGGGGCAGGG + Intergenic
1025724398 7:64044032-64044054 TTTGGGAAATAGTGGGGGCAGGG - Intronic
1026015852 7:66669995-66670017 TTGGGGGTAGAGAGGAGGCAGGG - Intronic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026285582 7:68959901-68959923 TTTGGGATACAGAAGAGGAAAGG + Intergenic
1029115628 7:98235590-98235612 TTTGGGAGACAGAGGTGGGAGGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029634447 7:101774597-101774619 TTTGGGAGGCAGAGGGGGCGTGG + Intergenic
1029646056 7:101856848-101856870 GTGGGGACACAGAGAGGTCAAGG - Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1032522822 7:132559306-132559328 GTGGGGAGAAACAGGGGGCAGGG - Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034348294 7:150400265-150400287 TTTGGGTCACAAAGGGGGCAGGG + Intronic
1034976747 7:155453645-155453667 TTGGGGAAGCAGAGTGGGCCAGG - Intergenic
1035734250 8:1876311-1876333 CTCGGGGTACAGATGGGGCAGGG + Intronic
1036204106 8:6792875-6792897 TTGGGAATACAGTGGGGGGCAGG + Intergenic
1036558069 8:9877269-9877291 GTCGGGATACAAAGGGGTCAGGG - Intergenic
1036649780 8:10634887-10634909 TTGGGGAGACTGGAGGGGCAAGG - Intronic
1040309672 8:46230281-46230303 ATGAGGCTGCAGAGGGGGCATGG + Intergenic
1042229783 8:66544071-66544093 TGGGGGATACAGAGCGGGCTTGG + Intergenic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043871472 8:85438489-85438511 TTGGGGATGGGGTGGGGGCAGGG - Intronic
1044160354 8:88906040-88906062 TTTGGGATACAGAGAGTACAAGG + Intergenic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1048492144 8:134903559-134903581 TTGGGGATACAGATTTGGCCAGG - Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1049355540 8:142186482-142186504 GTGGGGCTACTGAGGGGGCTGGG + Intergenic
1049442893 8:142617267-142617289 TTGGGGATGCAGGTGGGGGAAGG + Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1051508142 9:17847471-17847493 GTGTGGATCCAGAGGGGGCTGGG - Intergenic
1053514770 9:38721578-38721600 TTGGGAAGACAGAGGCCGCATGG + Intergenic
1055353355 9:75412353-75412375 CTGGGGCTACAGAGGAGGCCTGG + Intergenic
1056171356 9:83988124-83988146 TTGGGGAAACTGAGGTGGGAGGG - Intronic
1056928486 9:90854729-90854751 ATGGGGATTCAGTGGTGGCATGG - Intronic
1057873922 9:98739103-98739125 TTTGGGGGACAGAGGGGGAAAGG + Intronic
1057901822 9:98955061-98955083 TTGGGGATTCCAAGGGGGCCTGG + Intronic
1057955380 9:99403199-99403221 TTGGGTATATGGAGGAGGCAGGG + Intergenic
1058656743 9:107229218-107229240 AAGGGGATACGGAGGGGGCAGGG + Intergenic
1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG + Intergenic
1059447242 9:114346024-114346046 GTGGGGCATCAGAGGGGGCAAGG + Intronic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060234604 9:121853525-121853547 GTGGGGATGCAGAGTGGACAGGG + Intronic
1060235123 9:121857296-121857318 TAAGTGATACAGAGGGGGCAGGG - Intronic
1061238829 9:129357666-129357688 GTGGGGAGACGGAGGGGGAAGGG - Intergenic
1061545877 9:131304018-131304040 ATGGGGAAGCACAGGGGGCAGGG + Intronic
1062003662 9:134228936-134228958 TTGGGCATGCACAGGAGGCAGGG - Intergenic
1062015647 9:134289811-134289833 TTGGGGACAGGGAGGGGGCAGGG + Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062137586 9:134937973-134937995 TTGGAGAGGCAGAGGGGGAAAGG - Intergenic
1062437132 9:136551318-136551340 CTGGGGGTAGTGAGGGGGCATGG - Intergenic
1062691145 9:137842399-137842421 TGGAGGATACGGAGGGGGGACGG - Intronic
1062691189 9:137842529-137842551 TGGATGATACAGAGGGGGGATGG - Intronic
1062691222 9:137842631-137842653 TGGATGATACAGAGGGGGGACGG - Intronic
1186898559 X:14029835-14029857 TTGGAGAGACAGAGGGGGAGTGG + Exonic
1187546684 X:20261143-20261165 TGGGGGTTACAGAGGGGGTGGGG + Intronic
1187558994 X:20382229-20382251 TTGAGGATACAGAGATGACAAGG + Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1192290745 X:69792118-69792140 TTGGGGACTCAGTGGGGGAATGG - Intronic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1195363544 X:104107008-104107030 GTGGGGATATGGATGGGGCAGGG - Intronic
1195618433 X:106930780-106930802 TGGGGGATACAGAGAGGTCTAGG - Exonic
1195713004 X:107790063-107790085 TTGGGCAGACAGAGGAGGAAGGG - Intronic
1195880640 X:109589596-109589618 TTGGGAAGACAAAGTGGGCAGGG + Intergenic
1195902931 X:109817518-109817540 TTGGAGGTGCAGAGGGGACAAGG + Intergenic
1196066182 X:111467243-111467265 TTGGGGATGCAGAGTGGCCTAGG - Intergenic
1196276485 X:113771774-113771796 TTGGGGATACAGAGGTAGTATGG - Intergenic
1196675778 X:118419030-118419052 TTGGGGCTGTTGAGGGGGCATGG - Intronic
1198108971 X:133485800-133485822 AAGGGGAAACTGAGGGGGCAGGG + Intergenic
1198524862 X:137490981-137491003 GGGGGGATACAGAAGAGGCAAGG - Intergenic
1198530365 X:137546144-137546166 TTGAAGATATAGATGGGGCAGGG + Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1198806434 X:140499730-140499752 TTTGGGATGGGGAGGGGGCAGGG - Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199874632 X:151920582-151920604 ATGGGGGTACAGATGGGGTAGGG - Intronic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic