ID: 1105607666

View in Genome Browser
Species Human (GRCh38)
Location 13:21940138-21940160
Sequence GATACAGAGGGGGCATGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 374}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105607654_1105607666 1 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607666 13:21940138-21940160 GATACAGAGGGGGCATGGAGTGG 0: 1
1: 0
2: 3
3: 27
4: 374
1105607659_1105607666 -8 Left 1105607659 13:21940123-21940145 CCAATCAGCCTTGGGGATACAGA 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1105607666 13:21940138-21940160 GATACAGAGGGGGCATGGAGTGG 0: 1
1: 0
2: 3
3: 27
4: 374
1105607658_1105607666 -4 Left 1105607658 13:21940119-21940141 CCTTCCAATCAGCCTTGGGGATA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1105607666 13:21940138-21940160 GATACAGAGGGGGCATGGAGTGG 0: 1
1: 0
2: 3
3: 27
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105607666 Original CRISPR GATACAGAGGGGGCATGGAG TGG Intergenic