ID: 1105607667

View in Genome Browser
Species Human (GRCh38)
Location 13:21940149-21940171
Sequence GGCATGGAGTGGCTGCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105607658_1105607667 7 Left 1105607658 13:21940119-21940141 CCTTCCAATCAGCCTTGGGGATA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1105607667 13:21940149-21940171 GGCATGGAGTGGCTGCTCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 273
1105607654_1105607667 12 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607667 13:21940149-21940171 GGCATGGAGTGGCTGCTCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 273
1105607659_1105607667 3 Left 1105607659 13:21940123-21940145 CCAATCAGCCTTGGGGATACAGA 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1105607667 13:21940149-21940171 GGCATGGAGTGGCTGCTCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 273
1105607664_1105607667 -5 Left 1105607664 13:21940131-21940153 CCTTGGGGATACAGAGGGGGCAT 0: 1
1: 0
2: 0
3: 16
4: 169
Right 1105607667 13:21940149-21940171 GGCATGGAGTGGCTGCTCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105607667 Original CRISPR GGCATGGAGTGGCTGCTCTC AGG Intergenic