ID: 1105607668

View in Genome Browser
Species Human (GRCh38)
Location 13:21940150-21940172
Sequence GCATGGAGTGGCTGCTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105607658_1105607668 8 Left 1105607658 13:21940119-21940141 CCTTCCAATCAGCCTTGGGGATA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1105607668 13:21940150-21940172 GCATGGAGTGGCTGCTCTCAGGG 0: 1
1: 0
2: 0
3: 42
4: 249
1105607659_1105607668 4 Left 1105607659 13:21940123-21940145 CCAATCAGCCTTGGGGATACAGA 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1105607668 13:21940150-21940172 GCATGGAGTGGCTGCTCTCAGGG 0: 1
1: 0
2: 0
3: 42
4: 249
1105607664_1105607668 -4 Left 1105607664 13:21940131-21940153 CCTTGGGGATACAGAGGGGGCAT 0: 1
1: 0
2: 0
3: 16
4: 169
Right 1105607668 13:21940150-21940172 GCATGGAGTGGCTGCTCTCAGGG 0: 1
1: 0
2: 0
3: 42
4: 249
1105607654_1105607668 13 Left 1105607654 13:21940114-21940136 CCAGGCCTTCCAATCAGCCTTGG 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1105607668 13:21940150-21940172 GCATGGAGTGGCTGCTCTCAGGG 0: 1
1: 0
2: 0
3: 42
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105607668 Original CRISPR GCATGGAGTGGCTGCTCTCA GGG Intergenic