ID: 1105610481

View in Genome Browser
Species Human (GRCh38)
Location 13:21965022-21965044
Sequence TGCCTATGGTGTCCAAGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105610481 Original CRISPR TGCCTATGGTGTCCAAGTGC GGG Intergenic
900018080 1:168514-168536 TGCCTCTGCTGCCAAAGTGCTGG - Intergenic
900048338 1:527110-527132 TGCCTCTGCTGCCAAAGTGCTGG - Intergenic
900070563 1:768962-768984 TGCCTCTGCTGCCAAAGTGCTGG - Intergenic
903453794 1:23473093-23473115 TGCCTGTGGTGTACAAAGGCAGG - Intronic
905268207 1:36769520-36769542 TGCCTCTCTTGTCCAAATGCAGG + Intergenic
906252210 1:44319363-44319385 TGCTCCTGGTCTCCAAGTGCCGG + Intronic
907473511 1:54690031-54690053 TGGCTCTGGTGTCCCAGTGCAGG + Intronic
907680133 1:56555285-56555307 TCCTTACGGTGTCCATGTGCAGG - Intronic
912178870 1:107193639-107193661 TGCCTAAGAGGTCCAAGTGAAGG + Intronic
913579370 1:120210773-120210795 TGCATATGGTGACCAAATGGTGG + Intergenic
913628802 1:120687615-120687637 TGCATATGGTGACCAAATGGTGG - Intergenic
914561305 1:148822200-148822222 TGCATATGGTGACCAAATGGTGG + Intronic
914611529 1:149308008-149308030 TGCATATGGTGACCAAATGGTGG - Intergenic
922105923 1:222514378-222514400 TGCCTCTGCTGCCAAAGTGCTGG - Intergenic
922266262 1:223986989-223987011 TGCCTCTGCTGCCAAAGTGCTGG - Intergenic
923733142 1:236573268-236573290 TACCGATTGTTTCCAAGTGCCGG + Intronic
923800997 1:237208114-237208136 TGCATATGGTGTGCCGGTGCTGG - Intronic
924348108 1:243091945-243091967 TGCCTCTGCTGCCAAAGTGCTGG - Intergenic
1063569345 10:7200411-7200433 TACCTGTGGTGTCCAGGTGAGGG + Exonic
1066728251 10:38412956-38412978 TGCCTCTGCTGCCGAAGTGCTGG + Intergenic
1071467952 10:85958045-85958067 TGCCTTTGTTGTCCACTTGCTGG - Intronic
1071726214 10:88200406-88200428 TACCTATGAGGTCCAAGTGATGG + Intergenic
1072016978 10:91357692-91357714 CGCCTGTGGTGTCCATGTACAGG - Intergenic
1074085836 10:110208509-110208531 TGCCTATGGTTTCCAACTTTCGG - Intronic
1076974682 11:163710-163732 TGCCTCTGCTGCCAAAGTGCTGG - Intergenic
1077418025 11:2434731-2434753 TGTCTGTGGTGTGCAGGTGCTGG + Intergenic
1084783384 11:71426101-71426123 TCCATATGGTGGCCAAGAGCAGG - Intergenic
1085013556 11:73157846-73157868 GGCCTATGGTGTGCAAGCTCTGG + Intergenic
1088297689 11:108318439-108318461 TGCCTCAGCTCTCCAAGTGCTGG - Intronic
1092662396 12:10753054-10753076 TGCCTACGGTGTTCTAGTGGAGG + Intergenic
1092915529 12:13185947-13185969 TACCTAAGGTGTCCAGGTACTGG + Intergenic
1100702829 12:97166030-97166052 TGCCTCTGATTTCTAAGTGCTGG + Intergenic
1103123041 12:118396666-118396688 TGCCTATAGTGTACAACGGCAGG - Intronic
1105447504 13:20470376-20470398 TCCCTGTGGTTTCCCAGTGCTGG - Intronic
1105610481 13:21965022-21965044 TGCCTATGGTGTCCAAGTGCGGG + Intergenic
1105778493 13:23685108-23685130 TGCCTATGCAGTCCCTGTGCAGG + Intergenic
1113077395 13:106480561-106480583 TGCCTTTGCTGTCCAGATGCAGG - Intergenic
1114194466 14:20465039-20465061 TTGCTTTGGTGTCCAAATGCTGG + Intergenic
1126279040 15:46921497-46921519 TGCCTATGTTGTCTATGTACAGG + Intergenic
1131813052 15:96192962-96192984 TGCCCATGGTCTCCAACTCCTGG + Intergenic
1134020210 16:10916237-10916259 TGCCTATGGTGTATTAGAGCTGG + Intronic
1134058819 16:11186792-11186814 GGCCTCTGATGTCCAAGGGCAGG - Intergenic
1138433971 16:56986734-56986756 AGCCCATGGTGGCCAAGAGCAGG + Intergenic
1141534607 16:84670362-84670384 TACCCCTGGTGTCCTAGTGCAGG - Intergenic
1142445584 16:90133948-90133970 TGCCTCTGCTGCCAAAGTGCTGG + Intergenic
1142461930 17:101523-101545 TGCCTGTGCTGCCAAAGTGCTGG - Intergenic
1145877701 17:28332064-28332086 TGGCATTGGTGTCCAAGGGCAGG - Intronic
1151334976 17:73434410-73434432 TGCTTCTGGCTTCCAAGTGCAGG - Intronic
1153056605 18:951736-951758 TGTCTATGGAATCCAAGTCCGGG - Intergenic
1156018530 18:32574180-32574202 TGCCTGTGCTGTCCACCTGCTGG + Intergenic
1157324682 18:46660221-46660243 AGCCTATGGTTGCCAAGGGCTGG + Intergenic
1157327569 18:46680080-46680102 TGCCTCGGCTGTGCAAGTGCAGG + Exonic
1157883281 18:51342211-51342233 TGCCCCTGGAGTCCAAGTGTGGG + Intergenic
1160651634 19:233891-233913 TGCCTCTGCTGCCAAAGTGCTGG - Intergenic
1163630207 19:18414581-18414603 TGACTCTGGAGTTCAAGTGCAGG + Intergenic
1167227532 19:48257510-48257532 TGCCTCAGGTTCCCAAGTGCTGG - Intronic
926886874 2:17606109-17606131 TGGCAATGGAGTCCAACTGCTGG - Intronic
938737333 2:134198256-134198278 TGCCTATGATGGCAAAGTTCAGG - Intronic
940279320 2:151973317-151973339 TGCCTATGTTTTCCAATAGCAGG - Intronic
943893850 2:193327756-193327778 TTCCTATGGTGTCTTAGTGATGG + Intergenic
1169335937 20:4757312-4757334 TGCTTTTGGTGTCCATTTGCAGG + Intergenic
1169479515 20:5965745-5965767 TTCCTAAGGTTTCTAAGTGCTGG + Intronic
1173830497 20:46082699-46082721 TATCTATAGTGTCCAAGTGGTGG + Intronic
1175846245 20:62060446-62060468 TGCCTTTGGTGTCTCAGAGCTGG - Intronic
1175971859 20:62690356-62690378 AGCCTATGGTGACCTTGTGCAGG - Intergenic
1178123761 21:29495773-29495795 AGCACATGGTGTCCAAGGGCAGG - Intronic
1178606247 21:34038481-34038503 TGCCTATGGTGATCAACTGTGGG - Intergenic
950572017 3:13807144-13807166 TGCCTGTAGTGTCCCAGGGCTGG - Intergenic
955140053 3:56259994-56260016 AGCTTATGGAATCCAAGTGCTGG - Intronic
957827161 3:85462592-85462614 TGTCTTTGGAGTCCAAGTGTTGG - Intronic
961676453 3:128570015-128570037 TGCCTAGGCTGGCCAACTGCTGG - Intergenic
962943471 3:140146705-140146727 TGCCTAGGATGGCCAAGTGCAGG + Intronic
968366198 3:198186078-198186100 TGCCTCTGCTGCCAAAGTGCTGG + Intergenic
973852672 4:54976843-54976865 TCCCTCTGGTGTGCAGGTGCTGG - Intergenic
976520904 4:86025074-86025096 TGTCTATGGTGTCCTGGAGCTGG + Intronic
977568829 4:98609596-98609618 AGCCTCTCGTGTCCAGGTGCAGG + Intronic
979333719 4:119444778-119444800 TGCCTCTGCTGCCAAAGTGCTGG - Intergenic
980106296 4:128591679-128591701 TGCCTGTCTGGTCCAAGTGCAGG + Intergenic
987267204 5:16268824-16268846 TTCTTATGCTGTCCAAGTTCAGG + Intergenic
989231796 5:39095517-39095539 TGCCTAGGCTGGTCAAGTGCTGG + Intergenic
990842628 5:60100771-60100793 TGCCCATGGTGTCTCACTGCAGG - Intronic
990846592 5:60147344-60147366 TCACAATGGTGACCAAGTGCTGG + Intronic
992170069 5:74092749-74092771 TGCCAACGGAGTCCAGGTGCTGG - Intergenic
992694550 5:79273215-79273237 TTCTTATGGTGTCCATCTGCTGG + Intronic
997234838 5:132266783-132266805 TGCCTATGATGTCCAGGATCTGG + Intronic
997398362 5:133582293-133582315 TGTATATGGTGACCCAGTGCCGG - Intronic
1002725423 5:181291303-181291325 TGCCTCTGCTGCCAAAGTGCTGG + Intergenic
1003386856 6:5676452-5676474 TGCCTGTGGTGTCCGAGTCTGGG + Intronic
1004935618 6:20505315-20505337 TGCCTCAGCTGCCCAAGTGCTGG - Intergenic
1009555280 6:65156280-65156302 TTCCTATGCTGTCCAATTTCTGG + Intronic
1015784676 6:136909955-136909977 TGCCTATTTTTTTCAAGTGCTGG - Intronic
1017650439 6:156576486-156576508 CGCCTATGGTGGCCAAGGGAGGG + Intergenic
1018038376 6:159900829-159900851 TGCCTACTGTGTGCAAGTGTTGG + Intergenic
1019604434 7:1901473-1901495 TGCCTATGTGGTCCCAGGGCTGG - Intronic
1024070325 7:45778904-45778926 TGCCTCTGCTGCCAAAGTGCTGG + Intergenic
1029099523 7:98117116-98117138 TCCCCATGGTGTACGAGTGCAGG + Intronic
1032047731 7:128623206-128623228 TGCCTCTGCTGCCAAAGTGCTGG + Intergenic
1034007809 7:147493436-147493458 TGACTATGGGATCCAACTGCAGG + Intronic
1034313394 7:150109942-150109964 TGCCTATGGTGTTATAGTGTGGG - Intergenic
1034793467 7:153990722-153990744 TGCCTATGGTGTTATAGTGTGGG + Intronic
1036034489 8:5004232-5004254 TGCCTGGGGTGTCCAGTTGCTGG - Intergenic
1036569123 8:9964416-9964438 TGACAAAGGTGTCCAAATGCTGG + Intergenic
1036693032 8:10956694-10956716 TGCCAATGGTTTCAAAGGGCTGG + Intronic
1042762660 8:72287648-72287670 TGCCTATGGATACCAAGTGCCGG - Intergenic
1045382051 8:101636993-101637015 TGCCTAGGGTTACCAAGTGCTGG - Intronic
1047074229 8:121381926-121381948 TGCCTAGGGAGTCAGAGTGCTGG + Intergenic
1048101131 8:131352593-131352615 TGCCAATGTTGCCCGAGTGCTGG - Intergenic
1055388287 9:75788590-75788612 TGCCAATGGTGGGCATGTGCAGG - Intergenic
1055814473 9:80188138-80188160 TGCCTCAGCTTTCCAAGTGCTGG + Intergenic
1058340298 9:103887201-103887223 TGAGTATGATGTCCAAGGGCAGG + Intergenic
1060224411 9:121782536-121782558 GGACTATGGTGGCCAAGGGCAGG + Intronic
1061324057 9:129852035-129852057 AGCCTCTGGAGGCCAAGTGCTGG - Intronic
1062750566 9:138248944-138248966 TGCCTCTGCTGCCAAAGTGCTGG + Intergenic
1185456072 X:311487-311509 AGCCGATGGTGTCCACGTACAGG + Exonic
1185457360 X:317785-317807 GGCCTATGGGGTAAAAGTGCGGG - Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1196121996 X:112061310-112061332 TCCCTGTGGTGTACAAGTCCTGG + Intronic
1199977039 X:152900215-152900237 TGCCTATCGTGGCCAGGTCCTGG - Intergenic
1200109932 X:153735803-153735825 TGCTTTTGGTGTCCTAGTGAAGG + Intronic