ID: 1105616908

View in Genome Browser
Species Human (GRCh38)
Location 13:22027349-22027371
Sequence CTGTCACCCAAGACGGAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10302
Summary {0: 1, 1: 3, 2: 159, 3: 2859, 4: 7280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105616908 Original CRISPR CTGTCACCCAAGACGGAGTG CGG (reversed) Intergenic
Too many off-targets to display for this crispr