ID: 1105619693

View in Genome Browser
Species Human (GRCh38)
Location 13:22054951-22054973
Sequence CTGAGGAAACGGCCTTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105619693_1105619699 0 Left 1105619693 13:22054951-22054973 CCTTAATAAGGCCGTTTCCTCAG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1105619699 13:22054974-22054996 TGAATCATGGGAGCTTGGACAGG 0: 1
1: 0
2: 1
3: 14
4: 105
1105619693_1105619700 6 Left 1105619693 13:22054951-22054973 CCTTAATAAGGCCGTTTCCTCAG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1105619700 13:22054980-22055002 ATGGGAGCTTGGACAGGCTGAGG 0: 1
1: 0
2: 1
3: 28
4: 314
1105619693_1105619698 -5 Left 1105619693 13:22054951-22054973 CCTTAATAAGGCCGTTTCCTCAG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1105619698 13:22054969-22054991 CTCAGTGAATCATGGGAGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 149
1105619693_1105619701 18 Left 1105619693 13:22054951-22054973 CCTTAATAAGGCCGTTTCCTCAG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1105619701 13:22054992-22055014 ACAGGCTGAGGAAAAACCAAAGG 0: 1
1: 0
2: 1
3: 24
4: 334
1105619693_1105619702 19 Left 1105619693 13:22054951-22054973 CCTTAATAAGGCCGTTTCCTCAG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1105619702 13:22054993-22055015 CAGGCTGAGGAAAAACCAAAGGG 0: 1
1: 0
2: 4
3: 34
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105619693 Original CRISPR CTGAGGAAACGGCCTTATTA AGG (reversed) Intergenic
900748764 1:4380104-4380126 CTGAGGATGTGGCCTTATTTGGG - Intergenic
902211737 1:14909507-14909529 CAGAGGAAACGGCCTAACTCTGG - Intronic
906375864 1:45296187-45296209 TTCAGCAAACGTCCTTATTATGG + Intronic
907097571 1:51795667-51795689 CTGAGGAAAAGGCCTTAGTCAGG + Intronic
910435613 1:87202520-87202542 AGGAGGAAACGGCTCTATTAGGG - Intergenic
914256436 1:145963819-145963841 ATGAGGAAACAGACTTAATAAGG + Intronic
921785120 1:219220599-219220621 CTGACCAAACTGCCTTACTAAGG + Intergenic
1073352680 10:102831092-102831114 CTGAGGATGTAGCCTTATTATGG + Intronic
1080623402 11:34006754-34006776 ATGAGGAAACAGCCTTAGTGAGG - Intergenic
1083319139 11:61834713-61834735 CTCAGGAAACTGCCTTACCAGGG + Intronic
1085792462 11:79507844-79507866 CTGAGGAAACTGCCTTAGAGAGG + Intergenic
1088864869 11:113838083-113838105 CTGAGGAGTCGGCCTTAACAAGG - Intronic
1090869060 11:130726699-130726721 CTGAGGAGACGGCCAGATTGAGG + Intergenic
1095348959 12:41187715-41187737 CTCAGGACACTGCCTTCTTAGGG - Intergenic
1101835929 12:108295461-108295483 ATGAGGACATGGCCTTACTAGGG + Intronic
1105619693 13:22054951-22054973 CTGAGGAAACGGCCTTATTAAGG - Intergenic
1111949699 13:94701102-94701124 CTGAGGAAAAGCAGTTATTAGGG + Intergenic
1113148274 13:107233316-107233338 CTGAGAAAACTGCCTTGCTATGG - Intronic
1118912364 14:70072274-70072296 CTGAGGTAACTGCATGATTATGG + Intronic
1119966228 14:78918592-78918614 CTGAAGGAAGGGCCTTTTTATGG - Intronic
1125001496 15:34775441-34775463 CTGAGGAGATGGGCTTTTTAGGG - Intergenic
1131731458 15:95286426-95286448 CTAATGAATTGGCCTTATTAGGG - Intergenic
1132010875 15:98275752-98275774 ATGAAGACACGGCCTTATGATGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1138244875 16:55460056-55460078 CTGAAAAAACGGCCTTGTTTGGG + Intronic
1146481325 17:33207130-33207152 CTGAGGAGAAGGGCTTATAAAGG + Intronic
1147944109 17:44070693-44070715 CTGAGGAAACGCCTTTACAAAGG + Intergenic
1158242694 18:55394968-55394990 CTGAAGTAATGGACTTATTAAGG - Intronic
932672695 2:73752150-73752172 CAGAGGAAACTGCCCTACTAAGG - Intergenic
947543549 2:230994816-230994838 CTGAGGAAAGGTCATCATTAAGG + Intergenic
1173670707 20:44796718-44796740 CTGAGGAAATGGCCTAAGTGAGG + Intronic
1175489208 20:59367687-59367709 CTGGGGGAAAGGCCTGATTAGGG + Intergenic
1178920566 21:36735741-36735763 GTGAGGATACGGACATATTAAGG - Intronic
1183724568 22:39581259-39581281 CTGAGGAAGCAGCCTGATCAAGG + Intronic
950388940 3:12681234-12681256 CTGGGATAAGGGCCTTATTATGG + Intergenic
954813781 3:53264668-53264690 ATGAGGACACGGCCCTATGATGG - Intergenic
962152586 3:132908495-132908517 CTGTGGAAACGGCTTGATTTAGG + Intergenic
964654104 3:159047527-159047549 CAGAGGAAGCGGCATTATAAAGG + Intronic
979970527 4:127129491-127129513 CTTAAGAAACATCCTTATTAAGG - Intergenic
986062695 5:4206782-4206804 CTGATGTAATGGCCTTTTTAAGG + Intergenic
999229270 5:150052230-150052252 CTCAGGCAAGGGCCTTACTATGG - Exonic
1001204969 5:169753840-169753862 CAAAGGAAACTGCCTTCTTATGG + Intronic
1001290330 5:170452822-170452844 CAGAGGAAACAGCGTGATTAAGG + Intronic
1003353234 6:5340664-5340686 CTCAGGAAATGGCTATATTAAGG + Intronic
1014467967 6:121780075-121780097 GTGAGGAAAAGGCTTTATTCAGG + Intergenic
1017669001 6:156752277-156752299 CTGTGCAAACAGCCTTATTGGGG - Intergenic
1018863139 6:167726702-167726724 CTGAGGACACGTCCTTGCTAGGG + Intergenic
1019946965 7:4337704-4337726 TTGAGGAAACGGGACTATTATGG - Intergenic
1020271944 7:6602132-6602154 CTGAGGATACTTACTTATTATGG - Exonic
1023784791 7:43695201-43695223 CAGAGGAAACAGTCTTATTTAGG - Intronic
1027759546 7:82260662-82260684 CTGAAGAAATGGCCTTAGAAAGG + Intronic
1027801333 7:82754039-82754061 CTGAGGCAACAGCCTTTATACGG + Exonic
1030061426 7:105624349-105624371 CTCAGAAAACAGCCTGATTAAGG + Intronic
1030645134 7:112052686-112052708 ATGAGGAAACAGCATTATTGCGG - Intronic
1040774236 8:51020038-51020060 ATGTGGAAAATGCCTTATTAAGG - Intergenic
1042214947 8:66421714-66421736 CTGAGGAAGCTGACTTCTTATGG - Intergenic
1046488944 8:114922055-114922077 CTGAGGCATCTGCCTTATTTGGG - Intergenic
1058896474 9:109404994-109405016 CTGAGGAAATGCCCATTTTAGGG - Intronic
1187121173 X:16407789-16407811 CTGAGGAAAGAGTGTTATTATGG + Intergenic
1194610408 X:96036149-96036171 CTGAGGAAGCGGCCTTTAAAGGG - Intergenic
1194940256 X:100000802-100000824 CAGATGAAACAGCCTTCTTATGG + Intergenic