ID: 1105623217

View in Genome Browser
Species Human (GRCh38)
Location 13:22088805-22088827
Sequence CCCAGATGTCAGCACTGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105623217_1105623220 16 Left 1105623217 13:22088805-22088827 CCCTTGCAGTGCTGACATCTGGG 0: 1
1: 0
2: 3
3: 30
4: 304
Right 1105623220 13:22088844-22088866 TAAACCACTCTGTAATGTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 167
1105623217_1105623221 17 Left 1105623217 13:22088805-22088827 CCCTTGCAGTGCTGACATCTGGG 0: 1
1: 0
2: 3
3: 30
4: 304
Right 1105623221 13:22088845-22088867 AAACCACTCTGTAATGTTTTGGG 0: 1
1: 0
2: 0
3: 19
4: 255
1105623217_1105623222 18 Left 1105623217 13:22088805-22088827 CCCTTGCAGTGCTGACATCTGGG 0: 1
1: 0
2: 3
3: 30
4: 304
Right 1105623222 13:22088846-22088868 AACCACTCTGTAATGTTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105623217 Original CRISPR CCCAGATGTCAGCACTGCAA GGG (reversed) Intergenic
900407786 1:2500036-2500058 GCCAGATGGCAGCACTGTAGGGG - Intronic
901956288 1:12788044-12788066 CCCAGTGGGCATCACTGCAATGG - Intergenic
902299602 1:15492617-15492639 CCCACATGTCAGTAGTGCAGAGG + Exonic
902547094 1:17196954-17196976 CCGAGATGTGAGCCCTGCATTGG + Intergenic
903016189 1:20363654-20363676 CCAAGATGTCAGACCTGGAAAGG + Intergenic
903534387 1:24057002-24057024 CCCAGATGTCAAAAGTGCCAAGG - Exonic
905093779 1:35451274-35451296 CCCAGGTCTCAGCAATGCAGAGG + Intronic
906644652 1:47465738-47465760 CCCAGCTGTCATAACTGGAAAGG - Intergenic
909585727 1:77285503-77285525 AACAGATGTCAGCCCTTCAAAGG + Intronic
911167435 1:94736717-94736739 CCAAAATGTCAACAGTGCAAAGG - Intergenic
912351670 1:109019650-109019672 CCCAGATGCTAGCAGTGCCAAGG + Intronic
913575859 1:120174088-120174110 CCCAAATGTCAACAGTGCCAAGG + Intronic
914322816 1:146581661-146581683 CCCAAATGTCAACAGTGCCAGGG - Intergenic
914558173 1:148789659-148789681 CCCAAATGTCAACAGTGCCAAGG + Intergenic
914614661 1:149340571-149340593 CCCAAATGTCAACAGTGCCAAGG - Intergenic
915307484 1:154988900-154988922 CCCAGATCTCAGTAATGCAGGGG + Intronic
916199979 1:162261788-162261810 CCCAGATCTCAGCTTTGCGATGG + Intronic
916883172 1:169042394-169042416 CCCAGATGTGGGCTCAGCAAGGG - Intergenic
918569279 1:185969588-185969610 CCCAGATGTCAAGCCTGAAAAGG - Intronic
918837712 1:189489002-189489024 CCCAGATGCCAGCTCTGTTAGGG - Intergenic
919690886 1:200527419-200527441 CCCAGATGTTAGCACTGTTTTGG + Intergenic
920335040 1:205239381-205239403 CCAAGATGTCAACTCTGCCATGG - Intronic
920447773 1:206032621-206032643 CGCAGATGTGTGCACTGCAATGG + Intergenic
921165584 1:212504504-212504526 CCCAAATGTCAGCAGTGCTGAGG + Intergenic
921758113 1:218882450-218882472 CGTAGATGCCACCACTGCAAAGG - Intergenic
921789965 1:219278790-219278812 TCCAAATGTCAGCACTGGAGAGG - Intergenic
921836179 1:219781372-219781394 CCCAGCTTTCAGCACTTCAAAGG + Intronic
921839149 1:219809891-219809913 CCCAGCTGCCAGCTCTGCAGAGG + Intronic
921917469 1:220628297-220628319 GCAAGATGGCAGCACTGAAAGGG - Intronic
922446238 1:225700024-225700046 CCCATATGTCTGCAATGTAAAGG - Intergenic
1063067369 10:2623551-2623573 CCCAAATATCAGCACCCCAAAGG - Intergenic
1064131788 10:12716206-12716228 CCCAGATGTCAACAGCGCCAAGG - Intronic
1065853647 10:29812568-29812590 CCCAAATGTGAGCACTGGCAGGG + Intergenic
1065965149 10:30764885-30764907 CCCTGAGGTCAGCTCTGCCATGG + Intergenic
1066339269 10:34513772-34513794 CCCAGATGTCAGTAGTGCCACGG - Intronic
1066669332 10:37820434-37820456 TTTAGATGGCAGCACTGCAAAGG - Intronic
1067276061 10:44835102-44835124 CTCAGATGTAAGAAATGCAAAGG + Intergenic
1068718205 10:60211676-60211698 CACACATGTGTGCACTGCAAAGG + Intronic
1068719715 10:60231355-60231377 CTCAGAGGACAGCACTGTAAGGG - Intronic
1069064002 10:63923654-63923676 CACAGATGTCAGCTCTACATTGG + Intergenic
1069673074 10:70226506-70226528 CCAAGATCACAGCACTGCATGGG + Intronic
1070645217 10:78196999-78197021 CCAGGATGTCAGCTCTGCAAGGG + Intergenic
1075055085 10:119212177-119212199 CCAAGTTGTCAGTACTGAAAAGG - Intronic
1075501586 10:122980001-122980023 CCCAGATGTGAAGAGTGCAAGGG - Intronic
1075555845 10:123431307-123431329 CCCAGATTGCAGCACTGTTAGGG + Intergenic
1075564472 10:123493535-123493557 GCCTGCTGTCAACACTGCAAAGG - Intergenic
1076154994 10:128197262-128197284 CCAAGATGTCAGCAGTGCTGAGG + Intergenic
1076669573 10:132112105-132112127 CCCAGATGCCACCTCAGCAAAGG - Intronic
1079142523 11:17821913-17821935 CACATATTTCAGCACTGAAAGGG + Intronic
1081722479 11:45300520-45300542 CCCAAATGTCAGTAGTGCCAAGG + Intergenic
1081810274 11:45910431-45910453 CCCAGGAGGCAGCACTGCAGGGG + Intronic
1084477327 11:69396325-69396347 CCCAAATGTCAGAAATGCAGAGG + Intergenic
1085890241 11:80570803-80570825 CACTGATGTCAGTACTGAAATGG - Intergenic
1086045794 11:82529808-82529830 CCCAGATGTCATTCCCGCAAAGG + Intergenic
1088383473 11:109222589-109222611 TCTAGATGTCAGCTCTACAAGGG + Intergenic
1089655453 11:119943865-119943887 AACAGATGTGAGCTCTGCAAGGG - Intergenic
1091008920 11:131980680-131980702 CCCAGAGCTCAGCACAGCATTGG - Intronic
1091713700 12:2760999-2761021 CCCCGATCTCAACACTTCAATGG + Intergenic
1091934375 12:4423553-4423575 CCCAGATGGCAGCAAGGCACCGG + Intergenic
1092968837 12:13672162-13672184 CCCAGAAGTTAGCACTAGAAAGG + Intronic
1094726202 12:33119141-33119163 AACAGATGTGAGCACTGCACTGG - Intergenic
1098043068 12:66371607-66371629 CCGAGATGTAAGCATGGCAATGG - Intronic
1100820270 12:98423175-98423197 CCCAGCTGTGTGCTCTGCAAAGG - Intergenic
1101604021 12:106234210-106234232 TCCTGATATCACCACTGCAACGG - Intergenic
1102303551 12:111788436-111788458 CCCAGATGTCAGCAGTGCCAAGG + Intronic
1102322919 12:111953756-111953778 TTCAGAAGTAAGCACTGCAATGG - Intronic
1102525744 12:113511440-113511462 CCCAGCTGCCAGCCCAGCAATGG + Intergenic
1102791772 12:115652333-115652355 CCCAAATGTCAACAGTGCCAAGG + Intergenic
1103043407 12:117714872-117714894 CCCAAATCTCAGCAGTGCCAAGG + Intronic
1103057867 12:117835784-117835806 CCCAAATGTCAACAGTGCCAAGG + Intronic
1103287759 12:119816972-119816994 CCCAAATGTCAACAGTGCCAAGG + Intronic
1105623217 13:22088805-22088827 CCCAGATGTCAGCACTGCAAGGG - Intergenic
1107459257 13:40585563-40585585 CCCTGAAGTCAGAACTGTAAAGG - Intronic
1107873617 13:44769410-44769432 CCCACATGGCCCCACTGCAAAGG - Intergenic
1108303641 13:49107802-49107824 CTCAGCTGTCAGCACTGCTCAGG - Intronic
1110453951 13:75669066-75669088 CTAAGAGGTCAGCACAGCAAGGG + Intronic
1113341437 13:109429998-109430020 CCCACATGTCAACAATGCCAAGG - Intergenic
1113515074 13:110888074-110888096 CCCAGATTCCAGCAGTGCAGAGG + Intronic
1114721837 14:24890969-24890991 CCCAGATGGCAGCAGTGCACTGG - Intronic
1115183006 14:30651997-30652019 CCCAAATGTCAGCAGTTCTAGGG + Intronic
1116669348 14:47821348-47821370 ACCTGATGTCAGCACAGCACTGG + Intergenic
1119775221 14:77244033-77244055 CTCACATGTCATCACAGCAAAGG + Intronic
1121539593 14:94715206-94715228 CCCAGATGTCAGTAGTTCCAAGG + Intergenic
1121603441 14:95223203-95223225 CCCAAATGTCAACAGTGCCAAGG + Intronic
1123468154 15:20531173-20531195 CACAGATGGCAGCACTCCCAGGG + Intergenic
1124065840 15:26342920-26342942 CCCAACTGTCACCAATGCAATGG - Intergenic
1124913544 15:33946580-33946602 CTCAGATGTCATGACTGCTATGG + Intronic
1124956829 15:34365688-34365710 CCCAGGAGGCAGAACTGCAAAGG + Exonic
1125360356 15:38858124-38858146 CCCAGGTCTCCCCACTGCAAAGG - Intergenic
1125464951 15:39941672-39941694 CCCACATGTCAGTAGTGCCAAGG - Intronic
1127284272 15:57518818-57518840 CCCAAATGTCAGTAATGCGAAGG + Intronic
1128697590 15:69780192-69780214 CCCAAATGTCAGCAGTGCCGAGG + Intergenic
1129831416 15:78673541-78673563 CCCAGCTGTCAGAGCTGCAATGG + Intronic
1129882866 15:79018678-79018700 CTCAGGTGTCAGAACTGGAAGGG - Intronic
1130415377 15:83689358-83689380 CTCAGATGTATGCACAGCAAAGG + Intronic
1132393823 15:101457966-101457988 ACCAGATGTCAGCGCTGGTAGGG - Intronic
1133285459 16:4688634-4688656 CTCAGATGTGAGCACACCAAGGG - Intronic
1133781034 16:8939422-8939444 CCCAGATGTCAGCAAGTGAATGG - Intronic
1133995685 16:10746317-10746339 CCCAAATGTCAGCAGTGCTGAGG - Intronic
1134103961 16:11471993-11472015 CCCAAATGTCAGCAGTGCTGAGG - Intronic
1134510029 16:14838816-14838838 CCCAGATGTCAGTAGTGCCAGGG + Intronic
1134624560 16:15714483-15714505 CCCAGATGGCAGCAGTGCTGAGG + Intronic
1134697677 16:16237310-16237332 CCCAGATGTCAGTAGTGCCAGGG + Intronic
1134831566 16:17327824-17327846 CACAGATGTTAGCACAGAAAAGG - Intronic
1134974166 16:18557360-18557382 CCCAGATGTCAGTAGTGCCAGGG - Intronic
1135078683 16:19415543-19415565 CCCAAATGACAGTACTGCCAAGG + Intronic
1136031323 16:27505348-27505370 CCCAAATGTCAGCACTGGCAAGG - Intronic
1137518775 16:49173756-49173778 CCCACATGGCAGGGCTGCAAGGG + Intergenic
1137758900 16:50924894-50924916 CCCGGATGTCAGAACTGGACAGG - Intergenic
1140010745 16:71129189-71129211 CCCAAATGTCAACAGTGCCAGGG + Intronic
1140789001 16:78372156-78372178 TCCAGATGTGAGAACTGTAATGG - Intronic
1141229413 16:82150744-82150766 CCCAAATGTTAACACTGCCAAGG + Intronic
1141254034 16:82384270-82384292 CCCATGAGTCAGCACTGCACAGG - Intergenic
1141472633 16:84249873-84249895 AGCAGATGCCACCACTGCAAGGG + Intergenic
1141648442 16:85379645-85379667 CCCAGCTGTCTGACCTGCAATGG - Intergenic
1143394132 17:6578603-6578625 CCCAGATGACGGCACTGGACAGG + Exonic
1144049936 17:11489912-11489934 CCCAAATGTCAGTACTGCCCAGG + Intronic
1144514934 17:15910809-15910831 CCCAGATGCCACCTCTGCAAAGG - Intergenic
1144858391 17:18283870-18283892 CCCAGATGGAAGCAATGCACAGG + Intronic
1145127727 17:20315730-20315752 CCCAGTTGCCACCTCTGCAAAGG - Intronic
1146651010 17:34606416-34606438 TCCAGAAGTCAGAACTGGAAAGG + Intronic
1147335030 17:39722425-39722447 CCCAGAGGTCAGGGCTGCAGTGG + Intronic
1149256737 17:54836155-54836177 CCCAGATGTCATGCCTGCCAAGG + Intergenic
1150552855 17:66226575-66226597 CCAAGATGGCACCACTGCACTGG + Intronic
1150644680 17:66970563-66970585 CCCCAATGTCAGCAGTGCAAAGG - Intronic
1151767458 17:76139759-76139781 CCCAGAAGGGAGCCCTGCAAAGG - Intronic
1152065695 17:78111657-78111679 CCCAGATGTCTGCAGAGCACAGG + Exonic
1152371939 17:79893631-79893653 CCCAGCTGGCAGCACAGCACAGG + Intergenic
1153039367 18:796705-796727 CCAAGATGGCACCACTGCACTGG + Intronic
1155800642 18:30098925-30098947 CCTAGATCACAGCACTGCACTGG - Intergenic
1156914026 18:42444309-42444331 CTCAGTTTTCAGCATTGCAATGG - Intergenic
1157286531 18:46380866-46380888 CCCACGTCTCAGCACTGCAGTGG + Intronic
1157425703 18:47582573-47582595 CCCAAATGGCAGCAGTGCCAAGG - Intergenic
1158501427 18:58005600-58005622 CCCAAATGTCAGTAGTGCCAAGG + Intergenic
1160466925 18:79085555-79085577 CCCAGATATCAACAATGCGAAGG - Intronic
1161738224 19:6004673-6004695 CCCAGATATCAACAGTGCCAAGG + Intronic
1162045169 19:7994398-7994420 CCCAAATGTCAGTACTGCCGAGG + Intronic
1162378640 19:10319305-10319327 CCCTGATGACAGCTCTGCCATGG - Intronic
1162780460 19:13004195-13004217 CCCAAATGTCAGTAGTGCCAAGG + Intronic
1162817458 19:13204674-13204696 ACCAGAGGCCAGCTCTGCAATGG + Intergenic
1162994132 19:14323060-14323082 CCCAAATGTCAGCAGTGCTCAGG - Intergenic
1163016638 19:14459835-14459857 CCCAGATGTCAACAGTGCCAAGG - Intronic
1163044188 19:14627064-14627086 CCAAGATGTCAACAGTGCCAAGG - Intronic
1163351493 19:16778890-16778912 CCCAGAAGTCAGCAATGCCATGG - Intronic
1163545262 19:17937635-17937657 CCCAGATGTCAGCAGTGCTGAGG + Intronic
1163637943 19:18446066-18446088 CACAGCTGTCCCCACTGCAAAGG + Intronic
1164955029 19:32375329-32375351 CCCAAATGTCAGGAATGCAGAGG + Intronic
1166741484 19:45117384-45117406 CCCTGATGCCAGCACTCCACCGG - Intronic
1168314416 19:55478192-55478214 CCCACATCTCAGCACTGCTGAGG + Intronic
925184928 2:1840712-1840734 CCCACATGGCAGCCCTGCTATGG + Intronic
925186412 2:1849656-1849678 CCCACTTGCCAGCACTGCAGAGG + Intronic
925186739 2:1852136-1852158 CTCAGACCCCAGCACTGCAAAGG + Intronic
925836555 2:7952211-7952233 GCCAGATTTCAGCCCTGCACAGG + Intergenic
926373322 2:12202665-12202687 CTCAGATGTAAACATTGCAAAGG + Intergenic
926973165 2:18486956-18486978 CCCAAATGTCAACATTGCCAAGG - Intergenic
928875833 2:36038072-36038094 CTCAGGTTTCTGCACTGCAAAGG + Intergenic
929711027 2:44266789-44266811 CCAAGATCGCATCACTGCAATGG + Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930787754 2:55286992-55287014 CTCAGATGCCAGAACTGAAAGGG - Intergenic
931664722 2:64601965-64601987 CCCAGAGGTCAGCCCTGCGGAGG - Intergenic
932244590 2:70185863-70185885 CCTAAATGTCAGCAGTGCCAAGG - Intronic
932985077 2:76716266-76716288 CCCAAATGTCAACAGTGCCAAGG + Intergenic
933006406 2:77001129-77001151 CCTAAAAGTCAGCACTTCAATGG - Intronic
933842576 2:86299278-86299300 CCCAAATGTCAGTAGTGCCAAGG - Intronic
934769839 2:96900645-96900667 CCAAAATGTCACCTCTGCAAGGG - Intronic
934976637 2:98807341-98807363 CCAAAATGTCAGCAGTGCCAAGG - Intronic
936472750 2:112813389-112813411 CCTAGATGACAGCCCTGGAATGG - Intergenic
936934028 2:117820575-117820597 CCCAGATGTCAGCAATGCCAAGG + Intronic
939272431 2:139957557-139957579 CCCAGAAGTTACTACTGCAAAGG - Intergenic
941052183 2:160747585-160747607 CCCAGATGACAGCCCTGGCAGGG - Intergenic
942710747 2:178832420-178832442 CCAAGATGGCACCACTGCACTGG + Exonic
943401795 2:187421674-187421696 CCCAGATGGCAACACAGCAGAGG - Intronic
944607259 2:201363378-201363400 CCCAGATCTCTGCACAGGAAAGG - Intergenic
944916153 2:204362734-204362756 CCAAAATGTCAGCAGTGCCAAGG - Intergenic
945166899 2:206956049-206956071 GCCAGATGTCAGCACAGCCAGGG + Intronic
945689861 2:213020078-213020100 ATCAAATGTCAGAACTGCAATGG + Intronic
945982343 2:216322780-216322802 CCCAGGTGACAGTAGTGCAATGG - Intronic
946014295 2:216591608-216591630 TCAAGATGTCAGCAATGGAAGGG - Intergenic
947117404 2:226786431-226786453 CCCAAATTTCAGCACTTAAAGGG - Intronic
947217903 2:227766412-227766434 CCCAAATGCCAGCTCTGCCAAGG - Intergenic
947446848 2:230170794-230170816 CACAGCTGTCATCACTGGAATGG + Intronic
948055602 2:235007550-235007572 CCCAAATGTCAGCAGTGATAAGG + Intronic
948608776 2:239154010-239154032 CCCAAATGTCAGCACTACCTGGG - Intronic
1169098138 20:2921921-2921943 CCCAAATGTCAACAATGCCAAGG - Intronic
1171254626 20:23680121-23680143 CCAAGATGTCTGCACAGCAATGG + Intergenic
1171261110 20:23735394-23735416 CCAAGATGTCTGCACGGGAATGG + Intergenic
1171270231 20:23811236-23811258 CCAAGATGTCTGCACGGGAATGG + Intergenic
1171310378 20:24140473-24140495 TACAGATGTCTGCAATGCAATGG - Intergenic
1172629910 20:36371134-36371156 CCCAGATGCCTGCCCTGCCAGGG - Intronic
1172838419 20:37887658-37887680 CTGAGCTGTGAGCACTGCAAGGG - Intergenic
1174915347 20:54647904-54647926 CTGAGATTTCAGCACTGCACTGG - Intronic
1175258072 20:57658783-57658805 ACCAGATGTCAGCATAGCACGGG + Intronic
1175726258 20:61320688-61320710 CCCAGGTGTCAGCACTGCTGAGG + Intronic
1175995245 20:62809371-62809393 CACAGATGGCAGCAGGGCAAGGG + Intronic
1177651207 21:23964144-23964166 CCAAGCTGTGTGCACTGCAAGGG + Intergenic
1178528452 21:33353568-33353590 CACAGCTGTCAGCACTGTTAAGG + Intronic
1178945834 21:36946982-36947004 CCCAGAAGTCTGCCCTGCCACGG - Intronic
1178960560 21:37060836-37060858 CTCAGAGGTCAGAAATGCAATGG - Intronic
1179284312 21:39963565-39963587 CCCAAATGTCAGCAGTGCCAAGG + Intergenic
1182656413 22:31893955-31893977 CTCAGATGTCAATACTGCTAAGG - Intronic
1185172533 22:49302144-49302166 CCCAGGCTGCAGCACTGCAAGGG + Intergenic
949539148 3:5018713-5018735 CCCAAATGTCAGTAGTGCCAAGG - Intergenic
949781867 3:7698628-7698650 CCCACATGTCAGTAGTGCCATGG - Intronic
950281160 3:11709082-11709104 TCCAGGTGTCAGCATTTCAATGG - Intronic
950909713 3:16576356-16576378 CACAGAACTCACCACTGCAAAGG + Intergenic
952069906 3:29622213-29622235 CCCAGATGTAAGCCCTATAAGGG - Intronic
952080747 3:29754553-29754575 TCCAGCTGTCAGCAAAGCAAGGG + Intronic
952724037 3:36563259-36563281 CCCAGAGGTCACCACTGTTAGGG - Intergenic
953026121 3:39146262-39146284 CCCGGATGTCATCACTCCCAAGG + Intronic
954480733 3:50797521-50797543 GCTAAATGTCAGCACTGCAGAGG + Intronic
954571209 3:51642522-51642544 CCCAAATGTCAGCAGTGCTGAGG - Intronic
954631331 3:52049337-52049359 ACCAGGTGTCAGGACTGCATGGG - Exonic
955920266 3:63947750-63947772 CTCAGCTGTCACCACTTCAAAGG - Intronic
955932697 3:64073555-64073577 AGCAGATGTCAGCACTGGGATGG + Intergenic
956189606 3:66596225-66596247 TCCAAATGTCAGCCATGCAAAGG - Intergenic
957198581 3:77102248-77102270 CCCAAATGTCAGTAATGCAGAGG - Intronic
958156430 3:89761535-89761557 CCCAGATCTCTGCACAGGAAGGG + Intergenic
959423501 3:106156615-106156637 CCCTGATGTCAGCCCTTCCAGGG - Intergenic
959430605 3:106251072-106251094 CCCAGATCTCTGCACAGGAAGGG - Intergenic
960680890 3:120246519-120246541 CCCAAATGTCAACAGTGCTAAGG + Intronic
960891925 3:122458179-122458201 GCCACATCTCAGCATTGCAAAGG + Intronic
961412600 3:126733522-126733544 CACAGATGTCAGGGCTGCAGTGG + Intronic
961413294 3:126738977-126738999 CCCAGATATCAGGACTGCCTTGG - Intronic
963037782 3:141047585-141047607 CCAAGATATGAGCACTTCAAGGG - Intergenic
963346403 3:144100127-144100149 CCCAGATCCCACAACTGCAAGGG - Intergenic
965250246 3:166333280-166333302 CCCAGATGGCAGTAGTGCTAAGG + Intergenic
965725147 3:171707805-171707827 CCCAAATGTCAACAGGGCAAAGG + Intronic
966303045 3:178499900-178499922 CATAGATGTCAGCACTTCAAGGG + Intronic
966459943 3:180165650-180165672 CCCAGATCTCTGCACAGGAAGGG + Intergenic
969406991 4:7000025-7000047 CCCACATGTCAGCACTGCAGGGG + Intronic
969943679 4:10761107-10761129 CCCAAATGGCAGCAGTGCCAAGG - Intergenic
970977961 4:22062805-22062827 CTCTGATTTCAGCACTGCCAGGG - Intergenic
971252905 4:24988172-24988194 CCCAGATTTAAGCACTGGGATGG + Intergenic
971958384 4:33453540-33453562 ACCAGATCTCTGCACTGGAAGGG - Intergenic
972337144 4:38117305-38117327 CCCAGATCTGAGCAGTGCCACGG - Intronic
974930897 4:68359802-68359824 CCAAGGAGTCACCACTGCAAAGG - Intergenic
976033629 4:80789256-80789278 CCCAGATTTTAGGACTGCAATGG - Intronic
978549621 4:109911493-109911515 CCCAGATGACAGCAATGGAAGGG - Intergenic
978996075 4:115154927-115154949 CCCAAATGTCAGTAGTGCTAAGG - Intergenic
980027949 4:127788814-127788836 CCAAGATGTCAGTAGTGCCAAGG + Intronic
980095167 4:128482463-128482485 CCCAGGTATCAGAAATGCAAAGG - Intergenic
980521696 4:133944820-133944842 CCCTGAGTTCAGCACTGCAGTGG - Intergenic
982023327 4:151226756-151226778 CCAAAATGTCAGCAGTGCAGAGG + Intronic
982648294 4:158051803-158051825 CTCAGATGCCTGCAGTGCAAAGG - Intergenic
984805463 4:183747298-183747320 CACAGGTGTTAACACTGCAAGGG + Intergenic
986485575 5:8232914-8232936 CCCAGAGGCCAGCACTGCATTGG - Intergenic
986637373 5:9836370-9836392 CCCAAATGTCAGTAGTGCCAAGG - Intergenic
987335462 5:16894683-16894705 CCCAGATGCCTGCAGTCCAATGG + Intronic
988473396 5:31562126-31562148 TAAAAATGTCAGCACTGCAACGG - Intergenic
989184470 5:38609927-38609949 CCCAGATGTCAACAGTGCTGAGG + Intergenic
991093798 5:62718555-62718577 TCCAGGGGTCAGCACTGCCAAGG - Intergenic
991124426 5:63053385-63053407 CCAAAATGTCAACACTGCCAAGG - Intergenic
995290164 5:110443028-110443050 ACCTGATGTCAGCACAGCACTGG + Intronic
997768815 5:136533338-136533360 CCAAGATGTCAGCAATAAAAAGG + Intergenic
999829899 5:155308411-155308433 CCCTGATGTCAACAGAGCAAGGG - Intergenic
1001670311 5:173468239-173468261 CCTAGATGTCAGCACAGCCCTGG - Intergenic
1002549355 5:179975434-179975456 CCCAAATGTCAACAGTGCCAAGG + Intronic
1002849529 6:981511-981533 CCTGGAGGTCAGCTCTGCAATGG + Intergenic
1003026412 6:2559104-2559126 CTCAGATCTCAGCACTGGGAGGG + Intergenic
1006716961 6:36126623-36126645 CCCAGATGTCAGGGCTGCTTTGG - Intergenic
1008602835 6:53112480-53112502 TCCAGATGCCAGCAGAGCAAAGG - Intergenic
1010133488 6:72523088-72523110 GCCTGATGCCAGCACTGCCAGGG + Intergenic
1010188015 6:73165323-73165345 CCCAGATGTTAGCTCCCCAAAGG - Intronic
1010231618 6:73540141-73540163 CCCAAATGTCAACAGTGCCAAGG + Intergenic
1010370616 6:75102735-75102757 ACTAAATGTCAGCACTGAAAAGG - Intronic
1010952890 6:82057950-82057972 CCCAGCTGTCAGCTCTCCACTGG + Intergenic
1011449507 6:87477797-87477819 CCCAAATGTCAGTACTGCTGAGG + Intronic
1012010979 6:93785088-93785110 CCCTGAAGTCTCCACTGCAAAGG + Intergenic
1012552773 6:100479312-100479334 CCCAGCTGTCAGCACTCTCAAGG + Intergenic
1013633736 6:112009310-112009332 CACTGATCTCAGCCCTGCAATGG - Intergenic
1015815980 6:137211218-137211240 CCCAAATGCCAGCAGTGCCAAGG + Intronic
1016918606 6:149268152-149268174 CCCAGACGTCATCAGTTCAAGGG + Intronic
1017684507 6:156898478-156898500 CCCAGATGCCAGAACTCAAAAGG + Intronic
1019761767 7:2818230-2818252 CCCAGATGTCAGTACTGATGTGG - Intronic
1020307068 7:6843517-6843539 CCCGGATGTCAGGTCTGCTAGGG + Intergenic
1020749693 7:12124632-12124654 CCATGATGTGAGCACTGCAGTGG - Intergenic
1020970451 7:14931570-14931592 CCAAGATCTCAGCACAGCAATGG - Intronic
1023093461 7:36637631-36637653 CCCAGGTGTCAGCAGTGCTGAGG + Intronic
1023125352 7:36949545-36949567 CCCAAATGTCAGTAGTGCCAAGG - Intronic
1024724298 7:52175257-52175279 CCCAGATGTCATCACAGGACTGG - Intergenic
1025964490 7:66255348-66255370 CCCAAATGTCAGCTGTGCCAAGG + Intronic
1029846016 7:103413084-103413106 CACAGCTGCCAGCATTGCAAAGG + Exonic
1030329007 7:108253205-108253227 CCCAGCTTTGAGCACTTCAAGGG - Intronic
1031095859 7:117419079-117419101 CCCAAATGTCAGTAGTGCCATGG - Intronic
1032928834 7:136641213-136641235 ACCAGATGTCAGCCCAGCAAAGG + Intergenic
1034337584 7:150333437-150333459 CCCAGATGGCAGTAATGCCAGGG + Intronic
1037965042 8:23127741-23127763 CCCAGATCTCAGGACTGCGAGGG - Intergenic
1037973608 8:23192544-23192566 CCCAGATCTCAGGACTACCAGGG + Intronic
1038784721 8:30601565-30601587 CCCAAATGTTAACACTGCCAAGG + Intronic
1039221661 8:35338587-35338609 GCCAGATGCCAGTCCTGCAATGG - Intronic
1039914422 8:41849209-41849231 CCCTGATGTCTGCACTGGAAGGG + Intronic
1040563953 8:48549425-48549447 CCCAAATGTCAGCAGTGCCAAGG - Intergenic
1041646958 8:60262942-60262964 CCCAGTAGTCAGCACTGACATGG - Intronic
1042235671 8:66611591-66611613 CCAAGATGTCAATAGTGCAAAGG + Intronic
1043523541 8:81072374-81072396 CCCAAATGTCAGCAAGGCCAGGG - Intronic
1044308532 8:90665979-90666001 CCCAGATCTCTGCACAGGAAAGG + Intronic
1045411354 8:101923501-101923523 CATAGATGTCAGAACTGGAAGGG - Intronic
1046691378 8:117289198-117289220 CCGAGAAGCAAGCACTGCAAAGG + Intergenic
1047315318 8:123727674-123727696 CCCAAATGTCAGCAGTGCCAAGG + Intronic
1048226329 8:132589989-132590011 CCCACATGAAAGTACTGCAAAGG - Intronic
1049698056 8:143993260-143993282 CCCAGAGGGCAGCACTCCAGGGG - Exonic
1052353993 9:27485478-27485500 CCCAAATGTCAGCATTGCCTTGG + Intronic
1053489773 9:38489587-38489609 CCCTGATGTCAAGCCTGCAAGGG - Intergenic
1054451481 9:65405634-65405656 GCCTGTTGTCAGCACTGCACTGG + Intergenic
1055482858 9:76727047-76727069 CCCAAATGTCAGTAGTGCCAAGG - Intronic
1055534192 9:77219816-77219838 CCCAGATGTTCACACTGCCATGG - Intronic
1057261912 9:93589337-93589359 CCCAGACGTCAGCCGTGCAGAGG - Intronic
1057670109 9:97078896-97078918 CCCTGATGTCAAGCCTGCAACGG - Intergenic
1057977747 9:99624223-99624245 CCCTGAAGTCAGGACTGCCACGG - Intergenic
1058249296 9:102671011-102671033 CCAATATGTCAACACTGCCAAGG - Intergenic
1059427415 9:114229855-114229877 CCCAAATGTCAGTAGTGCCAAGG - Intronic
1059628610 9:116094912-116094934 CCCAGAGATCTGCATTGCAATGG - Intergenic
1060232955 9:121839233-121839255 ACCGGATGTCAGCAGTGCTAGGG + Intronic
1061106363 9:128533807-128533829 CCCGGATGCCACAACTGCAATGG - Exonic
1061757386 9:132824486-132824508 CCCAGATGTCAGTAGTGCTGAGG - Intronic
1061922731 9:133791084-133791106 CCCAGACGTCAGCAGTGCTGAGG + Intronic
1185446006 X:258347-258369 TCCAGCTGCCAACACTGCAATGG + Intergenic
1185543646 X:924167-924189 CCCAAATGTCAGCTGTGCCAGGG - Intergenic
1185871577 X:3669063-3669085 CCCAAATGTCAGCAGTGCTGAGG + Intronic
1185871635 X:3669569-3669591 CCCATGTGTCAGCACTGCTGAGG + Intronic
1186087749 X:6009593-6009615 CCGAAATGTCAGCTCTTCAAGGG - Intronic
1186272185 X:7900995-7901017 CCCAAATGTCAGCAGTACCAAGG - Intronic
1186522356 X:10217336-10217358 CCCAAATGTCAGCAGTGCTGAGG - Intronic
1186572276 X:10727791-10727813 CACAGAAGTCACCCCTGCAAGGG - Intronic
1186852775 X:13596867-13596889 CCCAAATGTCAGTAGTGCCAAGG + Intronic
1186963860 X:14766107-14766129 CCCAAATGTCATCAGTGCCAAGG + Intergenic
1190146720 X:47898387-47898409 CCCAGATGCCAGAACATCAAGGG + Intronic
1190416904 X:50189250-50189272 CTCAAATGTCAGAACTGGAAAGG + Intergenic
1191974849 X:66860953-66860975 CCCCGTTGTAAGCCCTGCAAGGG - Intergenic
1194585772 X:95732398-95732420 CCCAGATGTCAGTAGTACCATGG - Intergenic
1194724765 X:97382417-97382439 CCCAGTTGTCACCACTGGAGTGG + Intronic
1196057393 X:111370509-111370531 CCCAAATGTCAGTAGTGCCAAGG - Intronic
1197155159 X:123262462-123262484 CCAAGATGTCAACAGTGCCAAGG + Intronic
1199342404 X:146696695-146696717 CCCAGAGATGAGCACTTCAAAGG + Intergenic
1200091514 X:153638301-153638323 CCCAGATGCCAGAGCAGCAAGGG + Intergenic
1200743086 Y:6876769-6876791 CCCAGAGGCCAGAACTGAAATGG + Intergenic
1200792353 Y:7310987-7311009 CCCAGATGTCAGCAGTGCTCAGG - Intergenic
1200792612 Y:7313129-7313151 CCCATGTGTCAGCACTGCTGTGG - Intergenic