ID: 1105624442

View in Genome Browser
Species Human (GRCh38)
Location 13:22099328-22099350
Sequence GAGGCACTGAATGTGAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105624442_1105624444 -2 Left 1105624442 13:22099328-22099350 CCTGTATTCACATTCAGTGCCTC 0: 1
1: 1
2: 0
3: 14
4: 183
Right 1105624444 13:22099349-22099371 TCCCAGATTATAGCAGCCACTGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105624442 Original CRISPR GAGGCACTGAATGTGAATAC AGG (reversed) Intergenic
901292758 1:8137107-8137129 GAGGCACTGAGTTTGAAAAGGGG + Intergenic
903653537 1:24935207-24935229 GAGGCACTGAATGTGGCATCAGG - Intronic
904004350 1:27356039-27356061 CAGGAACTGAATGTGGATTCAGG - Exonic
906218295 1:44057528-44057550 AATGCAGTGAATGGGAATACTGG - Intergenic
907091246 1:51728447-51728469 GATGCACTGAATGTGAAATGGGG + Intronic
907185659 1:52607216-52607238 GAGCCCCTGAATGTGAAAACAGG - Intronic
907631546 1:56088222-56088244 GAGTCACTGAATTTGAAGGCAGG - Intergenic
910048342 1:82945441-82945463 GAGGAAATGATTGTGAATACTGG + Intergenic
910566509 1:88649529-88649551 CAGGTAGTGAATGTGAATAGAGG - Intergenic
913074307 1:115328467-115328489 AAGGCTCTTAATGTGAATGCTGG - Intronic
914436351 1:147663689-147663711 GAGGCAGTGAAGCTGAGTACAGG - Intronic
917367356 1:174247287-174247309 AAAGCACTGTATGTGAAAACAGG - Intronic
918646931 1:186916396-186916418 GTGGAAATGAATGTGGATACTGG - Intronic
920196304 1:204229353-204229375 GTAGCACAGAATGAGAATACAGG - Intronic
920202410 1:204267743-204267765 GAGGCACTGAATGACAGAACTGG - Intronic
921972497 1:221165499-221165521 GAAGCACAGAATGTTAGTACTGG + Intergenic
923669315 1:236026479-236026501 GTGGTACTGAGTGTGAATTCAGG - Intronic
924005195 1:239601261-239601283 GAGGCACAGAATGTGAGTGATGG + Intronic
924755256 1:246934758-246934780 GAGACACTGAAAGAGAAAACAGG - Intergenic
924791452 1:247253698-247253720 AAGGCCCTGAATGTGAAAAGGGG + Intergenic
1064825237 10:19391543-19391565 GAGGGAGCGAATGTGTATACTGG - Intronic
1066375280 10:34852562-34852584 GAAAAACTAAATGTGAATACAGG + Intergenic
1068343934 10:55746698-55746720 GTTACACTGAATGTGTATACAGG - Intergenic
1071282478 10:84115151-84115173 GTGGAAATGAATGTGGATACTGG + Intergenic
1071582482 10:86785644-86785666 GAGACACAGAATTTGAACACTGG - Intronic
1072335060 10:94390583-94390605 GTGGAAATGAATGTGGATACTGG + Intergenic
1074059098 10:109948778-109948800 GAAGCCCTGAATGTGAGTTCTGG - Intronic
1074388425 10:113036012-113036034 GAGTCACTGAAAGGAAATACTGG + Intronic
1074886922 10:117701129-117701151 GAGGGCCTGAATGTTAATATGGG + Intergenic
1079078669 11:17398742-17398764 AAGGGGCTGAATGTGAATCCAGG - Intronic
1079334236 11:19557521-19557543 TAGGCTCTGAATGAGAAAACTGG + Intronic
1080042893 11:27777618-27777640 GAAGCATTTAATGTGAATTCTGG - Intergenic
1080313678 11:30924364-30924386 GAGGCCCTGAACCTAAATACTGG - Intronic
1082172883 11:49027119-49027141 GAGGTACAGAATGTGCATACAGG + Intergenic
1083512046 11:63218534-63218556 GGTGCACTGTATGTTAATACAGG - Intronic
1085235337 11:75010094-75010116 GAGGCCCAGACTGTGAATTCTGG - Exonic
1085285211 11:75355205-75355227 GAGGGACTGGCTGTGAATAATGG + Intergenic
1085707316 11:78798429-78798451 GAGGATCTGAGTGTGAATTCTGG + Intronic
1086692887 11:89808939-89808961 GAGGTACAGAATGTGCATACAGG - Intergenic
1086712913 11:90030720-90030742 GAGGTACAGAATGTGCATACAGG + Intergenic
1086973203 11:93105543-93105565 GTGGAAATGAATGTGGATACTGG - Intergenic
1089055403 11:115581004-115581026 GAGGTACTGAATGTGGAGCCAGG - Intergenic
1089917596 11:122173521-122173543 GAGTAACCGAAGGTGAATACAGG + Intergenic
1090473689 11:127001486-127001508 GAGGCTCTGAATGCAAAGACAGG - Intronic
1091375474 12:22295-22317 GAAGCAGTGAATGTGAATCTGGG - Intergenic
1092856962 12:12683247-12683269 GGGGTACAGAATGTGACTACAGG + Intronic
1093593859 12:20939041-20939063 GTGGAAATGAATGTGGATACTGG - Intergenic
1094757624 12:33490295-33490317 GAGGCAATGCATGGGAATCCAGG + Intergenic
1097524609 12:60715916-60715938 GAATCAGTGAATGTGAAGACAGG - Intergenic
1098248643 12:68545933-68545955 GTGGAAATGAATGTGGATACTGG + Intergenic
1098748896 12:74271017-74271039 GTGGAAATGAATGTGGATACTGG + Intergenic
1099163208 12:79271391-79271413 GAAGCACTAAATTTGTATACAGG + Intronic
1101028262 12:100635063-100635085 GTGGAAATGAATGTGGATACTGG - Intergenic
1102927875 12:116840380-116840402 GAGGCTCTGGATTTGAATCCTGG - Intronic
1105624321 13:22098494-22098516 GAGGCACTGAGTGTGAATACGGG + Intergenic
1105624442 13:22099328-22099350 GAGGCACTGAATGTGAATACAGG - Intergenic
1105664666 13:22540334-22540356 GAGGCAATGAAAGTGAAGTCTGG + Intergenic
1108876116 13:55053276-55053298 GAGGAACAGAATGAGAGTACAGG + Intergenic
1109803242 13:67403876-67403898 GTGGAAGTGAATGTGGATACTGG + Intergenic
1112671603 13:101645674-101645696 GAGACAGGGAATCTGAATACGGG + Intronic
1115405199 14:33007185-33007207 GAGCCACAGAATGTGAGGACTGG + Intronic
1117996831 14:61485675-61485697 GAGGCAGTGAATTAGAAGACAGG - Intronic
1120712915 14:87811441-87811463 CAGTGACTGAATGTGAAGACCGG + Intergenic
1121747488 14:96309840-96309862 GAGGCAATGCATTTGAAAACAGG + Intronic
1122333668 14:100949862-100949884 GAGTCATTGACGGTGAATACAGG + Intergenic
1124107495 15:26753735-26753757 GAGACAGTGAATGTGGGTACAGG + Intronic
1125124739 15:36207030-36207052 GAGGCAATGAATTTCATTACAGG - Intergenic
1125169412 15:36749381-36749403 AAGGCACTGCAGGTGAATCCAGG - Intronic
1126371579 15:47952833-47952855 GAAGGACTGAATTTGCATACTGG - Intergenic
1127096024 15:55513040-55513062 GTGGAAATGAATGTGAACACTGG - Intergenic
1128292208 15:66486604-66486626 GCCTCTCTGAATGTGAATACTGG + Intronic
1130421250 15:83749151-83749173 GAGTCACTGAATGTGTCCACAGG + Intronic
1130750189 15:86703265-86703287 GATACACTGAGTTTGAATACTGG + Intronic
1130901666 15:88211671-88211693 CAGGCACTGAATGTGGCCACAGG + Intronic
1131956403 15:97740609-97740631 GAGGCACTGGCTGTAAAGACAGG - Intergenic
1132200482 15:99951011-99951033 GAGGGAATGAATGTGAAGACAGG - Intergenic
1134901172 16:17939377-17939399 GAGGCTCTGAGTTTGAATAGAGG - Intergenic
1135465904 16:22684542-22684564 TAGGCACTGAATGTGATTTGGGG + Intergenic
1138260106 16:55612993-55613015 AAGGCAGAGAATGTCAATACTGG - Intergenic
1139485867 16:67256269-67256291 GAGACACTGAATGGGAAGCCTGG + Intronic
1140097211 16:71884639-71884661 GAGGCTTTGAATGTGACCACGGG + Intronic
1140192675 16:72831341-72831363 GAGGCAGTCACTGGGAATACAGG + Intronic
1145275883 17:21430035-21430057 GAGGCACTTACTCTGAATATGGG + Intergenic
1145313731 17:21715948-21715970 GAGGCACTTACTCTGAATATGGG + Intergenic
1145406816 17:22606831-22606853 GTTACACTGAATGTGCATACAGG - Intergenic
1145712170 17:26987921-26987943 GAGGCACTTACTCTGAATATGGG + Intergenic
1147521638 17:41178861-41178883 GAGGCCCTGAATCTGAATTTTGG - Intergenic
1149056940 17:52377984-52378006 CATTCATTGAATGTGAATACTGG + Intergenic
1152135516 17:78501036-78501058 GTAGAACTGAATGTGAACACAGG + Intronic
1153830630 18:8919326-8919348 GTGGAAATGAATGTGGATACTGG + Intergenic
1154187325 18:12196852-12196874 CAGGCACTGGCTGTGATTACAGG + Intergenic
1155520136 18:26659130-26659152 ATGGCACTAAATGTTAATACAGG + Intergenic
1156512843 18:37655551-37655573 GAGGTTCTGAATGTTAATTCTGG + Intergenic
1156846837 18:41675472-41675494 GAGTCACAGAATGTGAAAACTGG + Intergenic
1157245921 18:46055231-46055253 GAGGCACTGGATGTGTATGAGGG - Intronic
1162969305 19:14170497-14170519 CAGGCACTGAGTGTGGACACTGG + Intronic
1163942956 19:20511887-20511909 GTGGCAATGAATGTGGATATTGG - Intergenic
1164713716 19:30376752-30376774 GAGTGACTGAATGGGAATACTGG - Intronic
1165164609 19:33842962-33842984 GAGGCAGTGAATTAGAACACAGG + Intergenic
1166804220 19:45475392-45475414 GAGGCACTGCCTGCGAGTACAGG - Intronic
1166902103 19:46072581-46072603 GAGGCACAGAATGTGAAGCAGGG + Intronic
927981415 2:27377331-27377353 GGGGCAGTGGAGGTGAATACAGG + Exonic
928193539 2:29195820-29195842 GAGGGAAAGAAAGTGAATACAGG + Intronic
929212913 2:39378104-39378126 TAGGCACGGAATGTTAACACTGG - Exonic
929630263 2:43452861-43452883 GAGTCTCTTAATTTGAATACAGG - Intronic
931522917 2:63119071-63119093 GAGGCATGGAATGTGAACAAAGG - Intergenic
933808092 2:86014641-86014663 AAGGCACTGAATGAGACTTCGGG - Intergenic
934052002 2:88219069-88219091 CAGACACTGGATGTGCATACTGG - Intergenic
934973794 2:98786224-98786246 GGGACCCTGAATGTGACTACAGG - Intergenic
935357998 2:102222506-102222528 GAGGCCCTGAATGTCAAGCCGGG - Intronic
936650272 2:114417958-114417980 GAAACACTGAATATGAAAACTGG + Intergenic
938242600 2:129754926-129754948 GAGGCAATGGCTGTGAATAAGGG + Intergenic
941253888 2:163203100-163203122 GAGGCTCTGAATGTGAGACCTGG - Intergenic
941542347 2:166802381-166802403 GAGGCTCTGATTGTGAGTAGTGG + Intergenic
941677545 2:168360025-168360047 CAGGCACTGAATGTGACTTATGG - Intergenic
946713097 2:222526250-222526272 GAGGCACAGCATGCAAATACAGG - Intronic
1172945539 20:38685425-38685447 GAGGCACTGAGTGGGAAGAGAGG + Intergenic
1174746547 20:53068896-53068918 GAGGCAATGACTGTGAGAACTGG + Intronic
1177345196 21:19858350-19858372 GAATCACTGAATTTGCATACAGG - Intergenic
1178148060 21:29762708-29762730 GAGGCTCCCAATTTGAATACAGG - Intronic
1180890947 22:19288602-19288624 AAGGCACTGAATGTGGACTCAGG - Intronic
1181499233 22:23306388-23306410 GAGGCACTGCATTTGATTATTGG + Intronic
1182660631 22:31922596-31922618 AGGGCACTGAATGTGAAAAGTGG - Intergenic
954930497 3:54276990-54277012 CAGGCCCTGAATTTGAAAACTGG - Intronic
957371700 3:79302116-79302138 CAGGAACTGAATGTTAGTACAGG + Intronic
957406465 3:79778958-79778980 GTGGAAATGAATGTGGATACTGG + Intergenic
961514536 3:127424503-127424525 GAGGCAGTTCATGTGAATGCAGG - Intergenic
961615541 3:128176688-128176710 GAGAAACTGAATTTGAATCCTGG + Intronic
962097625 3:132308393-132308415 GTGGAAATGAATGTGGATACTGG + Intergenic
962737402 3:138338194-138338216 CACTCACTGAATGTGAATTCTGG + Intergenic
963783153 3:149507463-149507485 CAGGCACTGAAGGAGAATCCTGG + Intergenic
964522148 3:157581233-157581255 GTGGAAATGAATGTGGATACCGG - Intronic
966538821 3:181066079-181066101 GAGGCACTGAATTTTCATCCAGG - Intergenic
967577486 3:191111090-191111112 GAGGCACTGAGTGAAAACACAGG + Intergenic
968459464 4:717156-717178 TAGACACTGAATGTGAGAACTGG + Intronic
968459481 4:717285-717307 TAGACACTGAATGTGAGAACTGG + Intronic
969664811 4:8551162-8551184 GAGTCACTGAATGTGGCTACTGG + Intergenic
972244751 4:37234028-37234050 GAGGCTTTAAATGTGAACACTGG - Intergenic
972318829 4:37953388-37953410 GAGGCACTGCATGTCATTACTGG + Intronic
975205904 4:71643953-71643975 GTGGAAATGAATGTGGATACTGG + Intergenic
976130598 4:81879802-81879824 CAGGCACTGAATGAGCATATTGG - Intronic
976524057 4:86065980-86066002 GAGGCAATGACTGTGATTATTGG + Intronic
977972638 4:103229428-103229450 GTGGAAATGAATGTGGATACTGG + Intergenic
980780401 4:137485007-137485029 GTGGAAATGAATGTGGATACTGG + Intergenic
982486843 4:155976508-155976530 GAGGCACTGCAGGGGAACACTGG - Intergenic
983989134 4:174097015-174097037 CAGGCCCTGAATGGGGATACAGG + Intergenic
985533939 5:452264-452286 GAATCAGTGAATGTGAAGACAGG - Intronic
986126085 5:4883464-4883486 CATGCACTGAATGTGAATCCAGG - Intergenic
986147992 5:5098306-5098328 GTGGCACAGAATTTAAATACAGG + Intergenic
986212122 5:5683815-5683837 GAGGCACTGACTGGTAATTCAGG - Intergenic
993641717 5:90413922-90413944 GAGGAACTGAAGATAAATACAGG + Intergenic
994186817 5:96824205-96824227 CAGGCATTGGGTGTGAATACAGG - Intronic
994734868 5:103540229-103540251 GAGAAGCTGAATGTGAACACAGG - Intergenic
995474083 5:112530612-112530634 GTGGAAATGAATGTGGATACTGG + Intergenic
998211348 5:140201177-140201199 GAGGAATGGCATGTGAATACAGG + Intronic
1003891125 6:10564609-10564631 GATGGCCTGAATGTGAATCCCGG + Intronic
1005083424 6:21980400-21980422 AAAGCACTGAATGTGAGTACAGG - Intergenic
1005489632 6:26335510-26335532 GAGTCACTGAATGTGAAGTTGGG + Intergenic
1005895264 6:30172257-30172279 GAGGCAGTGAAGGTGAAGATGGG - Exonic
1006570331 6:34998064-34998086 GAGACACTGAATATGAAAATGGG + Intronic
1007272012 6:40645036-40645058 GAGGCACTGGATGTGTAGAAAGG + Intergenic
1007605070 6:43112062-43112084 GAGGGAGTGTATTTGAATACAGG + Intronic
1012070034 6:94602985-94603007 GAATCACTGAATTTGAAGACAGG + Intergenic
1014521281 6:122445461-122445483 GAGGAACTGAATGTGACCTCTGG + Intronic
1022143469 7:27513875-27513897 GAGTGACTGCATCTGAATACTGG - Intergenic
1022247793 7:28577218-28577240 GAGGCAGTGAATGAGAATTCTGG - Intronic
1022315729 7:29243915-29243937 GAGGCACTGAATGTTCAGATCGG - Intronic
1024260181 7:47568424-47568446 GAGGCTCAGAAGGTGAATGCAGG - Intronic
1025814486 7:64898707-64898729 AAGTGACTCAATGTGAATACTGG - Intronic
1025818004 7:64936430-64936452 GAGTGACTCAAGGTGAATACTGG + Intergenic
1027947742 7:84770648-84770670 AAGGCAATGAAAGTGATTACAGG - Intergenic
1028453585 7:91014102-91014124 GATAAACTGAATGTGAATTCTGG - Intronic
1028881613 7:95886538-95886560 GAAGCACTGAGTGTGAATTCTGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1029975827 7:104832350-104832372 GAGCCACTGAATGTGTATCTGGG - Intronic
1033401472 7:141029332-141029354 GAGTCAATGAATGTGAAGATGGG - Intergenic
1033816109 7:145075434-145075456 GAGACAATGAATTGGAATACAGG + Intergenic
1035133730 7:156679076-156679098 GATGAACTGGATGTAAATACAGG - Exonic
1035901917 8:3465841-3465863 GAGGGACTGACTGTGACTCCAGG + Intronic
1036685447 8:10906354-10906376 TAGGCACTGAATTTGGAGACAGG - Intronic
1037373714 8:18206305-18206327 AAGGCACTGAAAGTGAACAGAGG - Intronic
1038549419 8:28453215-28453237 GAGGGCCAGAATTTGAATACAGG + Intronic
1041197548 8:55416158-55416180 GAGGCACTGGAAGTGATTAAAGG + Intronic
1045327847 8:101129908-101129930 GAGGAATAGCATGTGAATACAGG - Intergenic
1046112465 8:109741904-109741926 GAGGAACTGTATGTGAAAAGAGG - Intergenic
1046808462 8:118506062-118506084 GAGACAATGAATGTGACTGCAGG - Intronic
1051797070 9:20884002-20884024 GAGTGAGTGTATGTGAATACAGG + Intronic
1053316102 9:37052983-37053005 GAGGCATTGAATGTTAAAGCTGG - Intergenic
1056138281 9:83649804-83649826 GAGGCACAGGATGTGAGCACTGG - Intergenic
1056239069 9:84625679-84625701 GATGCACTGAATCAGAATTCTGG + Intergenic
1058034909 9:100240507-100240529 TAGGCGCTGAATGTGAAAAGAGG - Intronic
1058172575 9:101700489-101700511 GAGGCACTGGCTGGAAATACAGG + Intronic
1061936791 9:133862279-133862301 GAGGCTCTGCAGATGAATACGGG + Intronic
1185910219 X:3974148-3974170 GTGGAAATGAATGTGGATACTGG + Intergenic
1186542695 X:10417057-10417079 GAGGCCATGAAAGTGATTACAGG + Intergenic
1186723496 X:12330824-12330846 GATGCACAGAGGGTGAATACAGG - Intronic
1194648213 X:96483832-96483854 GAGGCACTGAATATCACCACAGG + Intergenic
1194915105 X:99696988-99697010 AAGGCAATGAAGGTAAATACAGG + Intergenic
1197850088 X:130849301-130849323 GATGGACTGAGTGTGAAAACTGG - Intronic