ID: 1105626004

View in Genome Browser
Species Human (GRCh38)
Location 13:22113214-22113236
Sequence GGTCAAACCCGCATTCGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 21}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105625999_1105626004 10 Left 1105625999 13:22113181-22113203 CCTGACTTAAAGGAATGCGGGCA 0: 1
1: 0
2: 1
3: 0
4: 58
Right 1105626004 13:22113214-22113236 GGTCAAACCCGCATTCGTAAGGG 0: 1
1: 0
2: 4
3: 23
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105626004 Original CRISPR GGTCAAACCCGCATTCGTAA GGG Intergenic
902315889 1:15617932-15617954 GGTCACCCCCGCATCCGGAAAGG + Intronic
1105626004 13:22113214-22113236 GGTCAAACCCGCATTCGTAAGGG + Intergenic
1108586553 13:51875035-51875057 GGTTAAAGCCGCATTGGTTAGGG - Intergenic
1108706147 13:52989974-52989996 GGTCAAACACTCTTTCTTAAAGG + Intergenic
1127350873 15:58150724-58150746 AGTCAAATCCGCATTCATAAGGG - Intronic
1133992871 16:10723643-10723665 GATCAAATCCACATTCATAAGGG + Intergenic
1147933520 17:43997736-43997758 GGTCGAAGCCGCATTCGTAAGGG - Intronic
1149925862 17:60701444-60701466 GTTCAAACCCACATTATTAAAGG - Intronic
1156205917 18:34885510-34885532 GGTGAAACCCGTATTTGAAATGG - Intronic
1158196594 18:54893230-54893252 GGAAAAATCCTCATTCGTAAAGG + Exonic
1202644483 1_KI270706v1_random:128218-128240 GGTCAAATCTGCATTCATAAGGG - Intergenic
932743891 2:74315093-74315115 GGTCAAATCCACAGTCATAATGG + Intronic
934506863 2:94901821-94901843 GATCAAATCCGCATCCGTAAGGG - Intergenic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
938309427 2:130278140-130278162 AGTCAAATCCGCATTTGTAGGGG - Intergenic
938446068 2:131379957-131379979 AGTCAAATCCTCATTCGTAGGGG + Intergenic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
1170423425 20:16214848-16214870 AGGCAAACAGGCATTCGTAAAGG + Intergenic
1171894444 20:30747145-30747167 GGTCAAATCTGCATTCATAAGGG - Intergenic
1176607398 21:8844436-8844458 GGTCAAATCTGCATTCATAAGGG + Intergenic
1179121179 21:38547356-38547378 GGTCAAACACGCATTGGTTGAGG - Intronic
1180357481 22:11854223-11854245 GGTCAAATCTGCATTCATAAGGG + Intergenic
1180380786 22:12138108-12138130 GGTCAAATCTGCATTCATAAGGG - Intergenic
949685198 3:6561691-6561713 GGTCAAACCCAAATTGGAAAAGG - Intergenic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
961738422 3:129016702-129016724 GGTCAAACCCTGACTCGTACAGG + Intronic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
973370720 4:49246777-49246799 GGTCAAATCTGCATTCATAAGGG - Intergenic
973390307 4:49548680-49548702 GGTCAAATCTGCATTCATAAGGG + Intergenic
974639607 4:64611179-64611201 GATCAAACCCGCATTCATAAGGG + Intergenic
984395368 4:179190995-179191017 AGTCAAAACCGCAGTCATAAAGG - Intergenic
985168351 4:187121897-187121919 GGTCAAACCTGCATTGTTCAAGG + Intergenic
994459088 5:100050937-100050959 GGTCGAAGCCACATTCGTAAGGG + Intergenic
1017368037 6:153668281-153668303 GGTGAAACCCACATTCTTAGGGG - Intergenic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1025229495 7:57192095-57192117 GGTCAAATCTGCATTCGTAGGGG - Intergenic
1025730851 7:64105869-64105891 GGTCAAATCTGCATTTGTAGGGG + Intronic
1048337763 8:133515505-133515527 GGTCAAAACCTCATTCGTAGGGG - Intronic
1049253654 8:141602726-141602748 GGACACACCCCCATTCGGAACGG + Intergenic
1054354208 9:64045626-64045648 GGTCAAATCTGCATTCATAAGGG + Intergenic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1202630198 M:10163-10185 GGTCGAAGCCGCACTCGTAAGGG - Intergenic
1203695132 Un_GL000214v1:91578-91600 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203742540 Un_GL000218v1:14738-14760 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203702731 Un_KI270742v1:9325-9347 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203567558 Un_KI270744v1:104681-104703 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203641141 Un_KI270751v1:12485-12507 GGTCAAATCTGCATTCATAAGGG + Intergenic
1201156068 Y:11132215-11132237 GGTCAAATCTGCATTCATAAGGG + Intergenic