ID: 1105626967

View in Genome Browser
Species Human (GRCh38)
Location 13:22122022-22122044
Sequence GGGAAGATTCTCTCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105626964_1105626967 -8 Left 1105626964 13:22122007-22122029 CCTGAACAGCCCAAAGGGAAGAT 0: 1
1: 0
2: 1
3: 15
4: 162
Right 1105626967 13:22122022-22122044 GGGAAGATTCTCTCTGATGAAGG 0: 1
1: 0
2: 0
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105626967 Original CRISPR GGGAAGATTCTCTCTGATGA AGG Intergenic
906813377 1:48851945-48851967 GGGAAGTTCTTCTCTGAGGATGG - Intronic
908830845 1:68176941-68176963 GGGAACATTCTTTTGGATGAAGG - Intronic
909165946 1:72224401-72224423 AGGAAAATTCTTTCTGATGAAGG + Intronic
909571929 1:77123540-77123562 CTGAAGATTCTCACTAATGATGG + Intronic
910912229 1:92248465-92248487 GTGAAGATTTTATCTGTTGAGGG + Intronic
915905192 1:159872228-159872250 GGGAAGATGCTCTTTTATGATGG - Intronic
916648801 1:166816377-166816399 GGGTAGCTCCTCTCTGATGCTGG + Intergenic
920365847 1:205448074-205448096 AGGGAGATTCCCTCTGAGGAAGG - Intronic
920834020 1:209491113-209491135 TTGAAGATTCTCTCTCTTGAGGG - Intergenic
922771735 1:228188694-228188716 GGGAAGATATTCCCTGATGATGG - Intergenic
923358371 1:233182941-233182963 GGGCAGGTGCTCTCTGCTGAGGG - Intronic
924633861 1:245766607-245766629 GGGCAGTTACCCTCTGATGATGG - Intronic
1064153211 10:12882467-12882489 TGGAAGATTCGATCTGGTGAGGG - Intergenic
1064923601 10:20545671-20545693 AGTAAAATTATCTCTGATGAAGG + Intergenic
1065654725 10:27936728-27936750 GGTAACATTCTCTTTGCTGATGG + Exonic
1067398396 10:45946270-45946292 GAAAAGACTCTCTCTGCTGATGG + Intergenic
1069200946 10:65615761-65615783 GGTAAGATCCTCTCAAATGAAGG + Intergenic
1070397622 10:76025206-76025228 GGAAAGATTCGCTTTGAGGAGGG + Intronic
1070989080 10:80715575-80715597 GGGGAGATTCTCTCTCAGCAAGG + Intergenic
1071941085 10:90592590-90592612 GGAAATGTTCTCTCTAATGAGGG + Intergenic
1073739780 10:106393254-106393276 GGGCAGATTCACACTGTTGAGGG - Intergenic
1074238077 10:111606494-111606516 GGGAAGAATCTTTCTGAGAATGG + Intergenic
1074352669 10:112753454-112753476 GGGAAAATTCTCTCTTTTTAAGG - Intronic
1074388452 10:113036277-113036299 TGGAAGATTCTCAAGGATGAAGG + Intronic
1076596657 10:131626476-131626498 GGGAGGCTTCTCTGTGTTGAGGG - Intergenic
1078363062 11:10684981-10685003 TGGAAGAGTCTCTCTGCTGTAGG + Intronic
1078659075 11:13270974-13270996 TGGGAGGTTTTCTCTGATGAGGG + Intergenic
1079395504 11:20059385-20059407 CTGCAGATTCTCTGTGATGAGGG + Intronic
1081968263 11:47182582-47182604 AGGAAGCTTCTCCCTGGTGATGG - Intronic
1082809287 11:57468963-57468985 GGGAAGATTTTCTCTCAGGGTGG - Intronic
1085752769 11:79176496-79176518 GGAAAGTTTCTCTCAGAAGATGG - Intronic
1086111726 11:83206663-83206685 TGGCAGATTCTGTCTGGTGAGGG - Intronic
1089396487 11:118139271-118139293 GGGAAGATTCTTCCAGATGGAGG - Intronic
1089417116 11:118301554-118301576 GGAAAGATTCACTCTGCTGGGGG - Intergenic
1091271076 11:134312368-134312390 GGGAAGGTTCTCCATGTTGACGG - Exonic
1091332693 11:134743035-134743057 GAGAAGATAATCTATGATGAAGG + Intergenic
1092175770 12:6405434-6405456 GTGAAAATTCTCACTGATCATGG + Intergenic
1096485612 12:51978888-51978910 GGGAAGAGTCTCACAGAGGAGGG + Intronic
1098242591 12:68483701-68483723 GGGAAAATACTTTCTAATGAAGG - Intergenic
1098579510 12:72082593-72082615 GAAGAGATTCTCTCTGATGCAGG + Intronic
1100672807 12:96835220-96835242 GGGTAGCTTCTCTCTGCTGTTGG + Intronic
1100911722 12:99371651-99371673 TGGAAGGTTCTCACAGATGAGGG - Intronic
1103143204 12:118570454-118570476 GGGAAGATACTCCCTGAAAAAGG - Intergenic
1104738076 12:131152181-131152203 GGGTAGATCCTCTCTGAAGCTGG - Intergenic
1105626967 13:22122022-22122044 GGGAAGATTCTCTCTGATGAAGG + Intergenic
1105687379 13:22797982-22798004 AGCAAGATTCTCCCTGATGCTGG - Intergenic
1106396538 13:29386138-29386160 GGAAAGATTTTTCCTGATGAGGG - Intronic
1107718099 13:43220407-43220429 GGGAAGATACTCTCTGAACTAGG - Intronic
1108182475 13:47854733-47854755 GGGAACATTCTGACTAATGAAGG - Intergenic
1111274892 13:85935681-85935703 GGGTAGCTCCTCTCTGATGCTGG - Intergenic
1112190977 13:97176931-97176953 GAGAAAATTCTCTCTCTTGAAGG + Intergenic
1112434442 13:99381679-99381701 AGGAAAACTCTCTCTGATCAAGG - Intronic
1112610812 13:100952965-100952987 GGAAAGATACTCACAGATGAGGG - Intergenic
1114004357 14:18296118-18296140 GGGAAGATTATATCTGAGCATGG - Intergenic
1114363495 14:22002252-22002274 GGCAAAATTATCTTTGATGAAGG - Intergenic
1119234099 14:73005258-73005280 AAGAAGATTCCCTTTGATGAGGG + Intronic
1119803451 14:77465791-77465813 GGAAAAATTCACTTTGATGAAGG - Intronic
1120023154 14:79552916-79552938 GAGAAGATTAACTCTGATGCAGG - Intronic
1120130149 14:80796922-80796944 GGAAAGTGGCTCTCTGATGAGGG + Intronic
1126359445 15:47831168-47831190 GGGAAAATTCTTCCTTATGATGG + Intergenic
1127291888 15:57578833-57578855 GTGAAGATAATGTCTGATGAAGG + Intergenic
1127798766 15:62459886-62459908 GGGAAAATCCTCTCTGAGGTAGG - Intronic
1127806906 15:62529656-62529678 GGGAAGGTTCCCTGTGAGGAAGG - Intronic
1134342512 16:13358089-13358111 AGGAAGATTCTCTCTTTTCAAGG - Intergenic
1135501313 16:22998390-22998412 GGGAAGATTCCTTCAGCTGAAGG - Intergenic
1135655916 16:24249441-24249463 AGGAAGTTTCTCTCTGAAAAGGG - Intergenic
1138477899 16:57283067-57283089 GAGAAGATTCTGTCTTCTGAGGG - Intronic
1141325047 16:83048978-83049000 GTGAAAATTCTCTCTTTTGAAGG + Intronic
1141784479 16:86189589-86189611 GGGAATATTCGCTCTAAGGAGGG - Intergenic
1143343456 17:6232189-6232211 GTGAATATTCTCCCTGAGGAGGG + Intergenic
1143675956 17:8432828-8432850 TGGAAAGGTCTCTCTGATGAAGG + Intronic
1144948989 17:18984018-18984040 GGGGGGATTCACTCTGCTGAGGG - Intronic
1145819050 17:27817306-27817328 GGGAAGATTCCTTCTGATCTTGG + Intronic
1146454319 17:32997222-32997244 GGGAGGATTGTTTCTGATGGAGG + Intronic
1147986373 17:44309562-44309584 GGGAAGATTCTCCGTGATTGCGG + Intronic
1153456744 18:5291339-5291361 GGGAAGACGTTTTCTGATGAAGG - Exonic
1153508018 18:5823146-5823168 AGAAAAATTCTCTGTGATGATGG - Intergenic
1156409044 18:36810448-36810470 GGGAAGAAGCCCTCTGATGTGGG - Intronic
1156520586 18:37719574-37719596 GGGAAGATCCTCTCTCATGTAGG + Intergenic
1159305712 18:66639757-66639779 GGGAATATTCTTTTTTATGACGG + Intergenic
1159382009 18:67672117-67672139 GGGAAGTATATCTCTGATGAAGG + Intergenic
1159740229 18:72158659-72158681 GGGAAGATGCTATCTCATTATGG - Intergenic
1161885408 19:6990813-6990835 GGGAACAATCTCTCTGAAGCAGG + Intergenic
1165718384 19:38061914-38061936 TGGAAGATTCACCCTGTTGATGG + Intronic
1168717879 19:58539731-58539753 GGGAAAATCCTGTCTGAGGAGGG - Intergenic
1168718119 19:58540700-58540722 GGGAAAATCCTGTCTGAGGAGGG - Intergenic
1168718380 19:58541782-58541804 GGGAAAATCCTGTCTGAGGAGGG - Intergenic
929465983 2:42144373-42144395 GGCAGAAATCTCTCTGATGAAGG - Intergenic
930714730 2:54582587-54582609 TGGAGGATTCTTTCTGATGAGGG + Intronic
932326898 2:70869209-70869231 TGGCAGATTCTGTCTGGTGAGGG - Intergenic
932963833 2:76447119-76447141 GGGGAAAGTCTCTCTGATGAAGG - Intergenic
936240596 2:110785469-110785491 CGGAAGTTTCTTTCTGATGATGG - Intronic
936554741 2:113485413-113485435 GGGAAGATACTGTGTGATAAGGG + Intronic
937183379 2:120015480-120015502 GTTGAGATTCTCTCTGAAGAGGG - Intronic
943023451 2:182601796-182601818 GGGAAGCTTCTCTCTGCTGCTGG + Intergenic
946442059 2:219704874-219704896 GGAAAAATTGTCTTTGATGAGGG - Intergenic
1170856027 20:20056008-20056030 GGGAAGAGAATCTCTAATGACGG - Exonic
1173609930 20:44359618-44359640 TGGAAGATTCTCTGTGGTGAGGG + Intronic
1173875280 20:46366546-46366568 GGGAGATTTCTCTCTGAGGAAGG + Exonic
1175387787 20:58608391-58608413 AGGAAGCTTCCCTATGATGATGG - Intergenic
1176082434 20:63280729-63280751 GGGAAGCTGCTCTCTGGGGAAGG + Intronic
1177668902 21:24199787-24199809 GAAAAGATTCTCTCTTATTAGGG + Intergenic
1178771521 21:35509129-35509151 GGGAAAATTGTGTCTGACGATGG - Intronic
1180428874 22:15226915-15226937 GGGAAGATTATATCTGAGCATGG - Intergenic
1181395341 22:22617516-22617538 GGGAACATTTTCTCTTGTGATGG - Intergenic
1182104169 22:27677347-27677369 GGGAAGTTTTTGTCTGAAGAAGG - Intergenic
1182848454 22:33451048-33451070 GGGAGAATTCTCTCCGAAGAGGG - Intronic
1183192532 22:36330993-36331015 GGGAAGATTTTATCTGAGGAAGG - Intronic
1183341208 22:37282937-37282959 GAGGAGATGCTGTCTGATGAGGG + Intronic
1184303551 22:43578488-43578510 GGGAAGATGCTTTCTGCAGAGGG - Intronic
950936902 3:16848160-16848182 GGGACTATTCTCCCAGATGATGG - Intronic
951320640 3:21240363-21240385 GGGAAGATAAGCTATGATGAGGG - Intergenic
951599926 3:24362378-24362400 GGGAAGAGCATCTCTTATGAAGG - Intronic
953730132 3:45440158-45440180 CAGATGATTCTCACTGATGATGG - Intronic
955953455 3:64264844-64264866 GGGAAGATGCTTTGTGAAGAGGG + Intronic
957081972 3:75644045-75644067 GGGAAGATCATCTCTTATTAAGG + Intergenic
958519623 3:95168251-95168273 GGGAGGATTCTTTCTGAAAAAGG + Intergenic
959830979 3:110862206-110862228 GGCATTATTCTCACTGATGAAGG + Intergenic
962454014 3:135548354-135548376 AGGAAAATTCTCTATGAGGAGGG - Intergenic
964777248 3:160292041-160292063 GGGCAGATTCCCTCAGAGGAAGG + Intronic
965866486 3:173211105-173211127 GGGAAGGTGCACTCTGAGGAAGG + Intergenic
967649850 3:191973309-191973331 GGGAAGCTCCTCTCTGCTGCTGG + Intergenic
969286995 4:6208814-6208836 GGGAAGATTCTCTGCCATGAAGG - Intergenic
969996598 4:11318864-11318886 GAGAAAATCCTCCCTGATGAAGG + Intergenic
971271073 4:25146409-25146431 GGTGAGATTTTCTCTGATCATGG - Intronic
973872960 4:55185218-55185240 TGGAAAATCCTCTCTCATGAGGG + Intergenic
974157635 4:58094725-58094747 GGGGAGATTATTTCTGGTGAGGG - Intergenic
974198087 4:58602826-58602848 GGGAAGCTACTCCCTGATAATGG - Intergenic
976715799 4:88121436-88121458 GGGAAGGATGTCTGTGATGAGGG - Intronic
981451756 4:144906329-144906351 GGTCAGGTTCTCTCTGGTGAAGG - Intergenic
982848154 4:160276844-160276866 GGGAAGATCCACTTTGATGTGGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984653999 4:182298050-182298072 GGGATGATGCTCTCTGAAGGAGG - Intronic
985012825 4:185601468-185601490 CGGAAGCTTCTCTCTGAGGATGG + Intronic
985101724 4:186464586-186464608 GGGAACCTTTTCTCTAATGATGG + Intronic
985721546 5:1492202-1492224 GGGAAGATTATCTCTGAGCTGGG + Intronic
987177556 5:15331067-15331089 GAGAAGATTCATTCTTATGATGG + Intergenic
999598980 5:153239165-153239187 TGGAATATTCTATCTGATAAGGG - Intergenic
1001685943 5:173595242-173595264 GGGAAAATACTCTCTGAAGGAGG - Intergenic
1004761996 6:18677473-18677495 TGGAGGAGTCTATCTGATGAAGG + Intergenic
1007375771 6:41455692-41455714 GGGAAAATGCTATGTGATGATGG + Intergenic
1007649979 6:43413236-43413258 GGGAAGCTCCTCTCTGCTGCTGG - Intergenic
1015409247 6:132873441-132873463 GGGAACATTCTCTCTGAGAAAGG + Intergenic
1015562135 6:134527314-134527336 GTGAGGAAACTCTCTGATGAAGG - Intergenic
1016120442 6:140337036-140337058 GGGTATATTGTCTCTGATTAGGG + Intergenic
1016131655 6:140480575-140480597 GGGAAAATGCTCTATTATGATGG - Intergenic
1016273619 6:142321712-142321734 GGTAAGATTCTCTGTGTTGATGG + Intronic
1019550177 7:1598277-1598299 GGGAAGCTTCTCTCAGATTTTGG - Intergenic
1021232027 7:18096994-18097016 AGTAAGATTTTCTGTGATGATGG + Intronic
1028829546 7:95312583-95312605 AGGCATGTTCTCTCTGATGAGGG + Intronic
1028972316 7:96872546-96872568 GGGAAGAAGCTATGTGATGATGG - Intergenic
1031743696 7:125468008-125468030 GGGAAGTTTCTCTCTGCAGCCGG + Intergenic
1033226457 7:139566880-139566902 GGGAAGACCCTCTCTGGTGCTGG + Exonic
1033261698 7:139849621-139849643 GGGAAGGGTCTGACTGATGACGG + Intronic
1039989165 8:42473469-42473491 GGGAAGATTCTTCCTGCAGAGGG - Intronic
1040892180 8:52328851-52328873 GGGAAGTTTCTGTCTGCTGGGGG + Intronic
1041153277 8:54957955-54957977 GGGAAGACTCACTGTGATGGAGG - Intergenic
1041635843 8:60142937-60142959 AAGGAGATTCTTTCTGATGAAGG + Intergenic
1042148485 8:65757126-65757148 GGCAAGACTCTCTCTGGGGAAGG + Intronic
1047796657 8:128263717-128263739 GGGGATTTACTCTCTGATGAAGG + Intergenic
1049898270 9:131770-131792 GGGAAGATACTGTGTGATAAGGG - Intronic
1054346547 9:63971553-63971575 GGGAAGATACTGTGTGATAAGGG - Intergenic
1054444324 9:65298202-65298224 GGGAAGATACTGTGTGATAAGGG - Intergenic
1054485949 9:65723303-65723325 GGGAAGATACTGTGTGATAAGGG + Intronic
1054687014 9:68289244-68289266 GGGAAGATACTGTGTGATAAGGG + Intronic
1056763684 9:89431794-89431816 AGCAAGATTCTCTCTTTTGATGG + Intronic
1057035894 9:91811406-91811428 GGGGAGGGTCTCTCTGAGGAAGG + Intronic
1059315710 9:113424222-113424244 GGGAAGATTCTTTTTCATCATGG - Exonic
1061526840 9:131172544-131172566 AGGAAGATTTTCTGTGATGATGG + Intronic
1062008546 9:134254527-134254549 GAGAAGATTCTGTGTGAAGACGG + Intergenic
1062213573 9:135377432-135377454 GGGAAGAGACCCTCTGGTGAGGG - Intergenic
1185765723 X:2724416-2724438 GAGAAGATTCTATCTGGAGAAGG + Intronic
1185872797 X:3678428-3678450 TGGAGAATTCTCTCTGTTGAGGG - Intronic
1186380095 X:9048875-9048897 AGGAAGCTTCTCTCTGAAGAGGG - Intronic
1187127906 X:16470982-16471004 GGGCAGGTTCTGTTTGATGAAGG + Intergenic
1189575412 X:42347495-42347517 ATGAAGATGTTCTCTGATGAAGG - Intergenic
1191307147 X:59014022-59014044 GAGAATATTCTTTGTGATGATGG + Intergenic
1191410960 X:60402733-60402755 GAGAATATTCTTTGTGATGATGG + Intergenic
1191430776 X:60668146-60668168 CGGAATATTCTTTGTGATGATGG + Intergenic
1191518834 X:61846541-61846563 CAGAATATTCTTTCTGATGATGG + Intergenic
1191526933 X:61954890-61954912 CGGAATATTCTTTGTGATGATGG + Intergenic
1191530380 X:62001016-62001038 CAGAATATTCTTTCTGATGATGG + Intergenic
1191977053 X:66884725-66884747 GGGAGGTCTCTCTTTGATGAAGG - Intergenic
1193553577 X:82928501-82928523 GGGAATATTGTCTCTGGTTAGGG - Intergenic
1194663610 X:96653585-96653607 GTGAAGATTCTATATGAGGAAGG + Intergenic
1194832874 X:98646498-98646520 GCCAAGATTCTCTCTGCTAATGG - Intergenic
1196627321 X:117891210-117891232 GGGGATTTTCTCTCTGATGGAGG + Intergenic
1198936011 X:141903465-141903487 GGGGAGATTTTCTCTGAGGAGGG + Intergenic
1199971085 X:152862086-152862108 AGGAAGATATTCTCTTATGAGGG - Intronic
1200231658 X:154446734-154446756 GGGCACATTTTCTGTGATGATGG + Intronic
1201064344 Y:10078934-10078956 GAGAAAATTCTTTGTGATGAGGG + Intergenic