ID: 1105627510

View in Genome Browser
Species Human (GRCh38)
Location 13:22127084-22127106
Sequence CTCGAAAGTGGCAGGTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105627503_1105627510 5 Left 1105627503 13:22127056-22127078 CCATCCCAGAAAGCCTTCGAGGA 0: 1
1: 0
2: 1
3: 13
4: 135
Right 1105627510 13:22127084-22127106 CTCGAAAGTGGCAGGTATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1105627504_1105627510 1 Left 1105627504 13:22127060-22127082 CCCAGAAAGCCTTCGAGGAACCT 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1105627510 13:22127084-22127106 CTCGAAAGTGGCAGGTATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1105627506_1105627510 -8 Left 1105627506 13:22127069-22127091 CCTTCGAGGAACCTGCTCGAAAG 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1105627510 13:22127084-22127106 CTCGAAAGTGGCAGGTATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1105627501_1105627510 22 Left 1105627501 13:22127039-22127061 CCAGCACATTTCTTTCTCCATCC 0: 1
1: 0
2: 1
3: 29
4: 421
Right 1105627510 13:22127084-22127106 CTCGAAAGTGGCAGGTATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1105627505_1105627510 0 Left 1105627505 13:22127061-22127083 CCAGAAAGCCTTCGAGGAACCTG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1105627510 13:22127084-22127106 CTCGAAAGTGGCAGGTATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105627510 Original CRISPR CTCGAAAGTGGCAGGTATCC AGG Intergenic
900243126 1:1626178-1626200 CTCAAAGGTGCCTGGTATCCAGG - Intronic
901134658 1:6985126-6985148 CTCCAAATGGGCAGGTTTCCCGG - Intronic
902413603 1:16226335-16226357 CTGGCAAGTGGCAGAAATCCTGG - Intergenic
902565266 1:17307228-17307250 CTGGCAAGAGGCAGGTATCCTGG + Intergenic
906534134 1:46542403-46542425 CTAGGAAGTGGGAGGTTTCCCGG - Intergenic
907811126 1:57871082-57871104 CTCCAAAGAGGCAGGGATCCTGG - Intronic
909544126 1:76825122-76825144 CACCAAAGTGGCAGGCATGCTGG + Intergenic
910099621 1:83562146-83562168 CTCTAAACTGGCAGGTAGCTAGG + Intergenic
910755249 1:90683040-90683062 CTTGAAAGTGGTAGGTGTCATGG + Intergenic
920870344 1:209789036-209789058 CTGGAAAGGGCCAGGTATCGTGG + Intronic
1073866130 10:107806291-107806313 CTTGACAGTTGCAGGAATCCAGG + Intergenic
1075255485 10:120923226-120923248 CTAGAAAGAGGCAGGGATTCGGG - Intergenic
1086190262 11:84070731-84070753 CTGGAAAGTGGCAGAAACCCAGG - Intronic
1086717811 11:90084757-90084779 ATGGAAAATGGCAGGTATTCTGG + Intergenic
1105627510 13:22127084-22127106 CTCGAAAGTGGCAGGTATCCAGG + Intergenic
1106548367 13:30750179-30750201 GTCGAAGGTGGCAGTTCTCCAGG - Intronic
1107876641 13:44796600-44796622 TTTTAAAGTAGCAGGTATCCAGG + Intergenic
1113437300 13:110303294-110303316 CTCGGAGGTGGCAGGTAGGCAGG - Intronic
1113948026 13:114055790-114055812 CTCCAGAGTGGCAGGTGCCCAGG + Intronic
1118394255 14:65322282-65322304 CAAGAAAGGTGCAGGTATCCAGG - Intergenic
1121164214 14:91776214-91776236 ATCATAAGTGGCAGGTCTCCAGG - Intronic
1129046247 15:72736868-72736890 CTGGAAACTGGCAGGTTTGCTGG - Exonic
1133443131 16:5837146-5837168 CATGAAAGTGGCAGGATTCCAGG - Intergenic
1133783675 16:8958660-8958682 CTAGATAGTGGCAGGAAACCAGG - Intronic
1139483954 16:67246075-67246097 CTGGAGAGTGGCACGTGTCCAGG - Intronic
1154331149 18:13429944-13429966 CTGGAAGGAGGCCGGTATCCTGG + Intronic
1157806939 18:50665311-50665333 CCCTAAAGTGGCAGGAACCCGGG - Intronic
1158548160 18:58413356-58413378 CCAGAGGGTGGCAGGTATCCAGG + Intergenic
1165267580 19:34674253-34674275 TTCCAAAGTGGCAGGGATCCTGG + Intronic
928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG + Intronic
948868618 2:240787363-240787385 ATCGCAAGGGGCAGGGATCCAGG - Intronic
1172435989 20:34929300-34929322 CTGGAAAGAGTCAGGAATCCTGG - Intronic
1172768475 20:37363485-37363507 CTCGGATCTGGCTGGTATCCTGG + Intronic
954747492 3:52795379-52795401 CCAGAGAGGGGCAGGTATCCAGG - Intronic
957584459 3:82115347-82115369 CTAGAAAGGGACATGTATCCAGG - Intergenic
961122040 3:124381059-124381081 CTAGAAAGTAGCAGGTACCATGG + Intronic
961695917 3:128704365-128704387 CAGGAGAGTGGCAGGAATCCGGG + Intergenic
962497913 3:135961492-135961514 CTAGTAAATGGAAGGTATCCTGG + Intergenic
966651229 3:182303338-182303360 CTCCAAGGTGGCAAGTAGCCAGG + Intergenic
978379115 4:108108000-108108022 CTAGAAAGGGACAGGTCTCCTGG + Intronic
978916752 4:114134860-114134882 CTCTAAAGTGCCAGGAATTCTGG - Intergenic
979444870 4:120800587-120800609 ATCCAAAGTAGCAGGTATGCAGG + Intronic
985037999 4:185860729-185860751 CTCGAAGGTGGGAGGCTTCCAGG + Intronic
988970099 5:36458165-36458187 CTTGAAAATGTCAGCTATCCAGG - Intergenic
998205138 5:140152499-140152521 CCCAAAAGTGGCAGGCACCCTGG - Intergenic
998922374 5:147083851-147083873 CTCAAAAGTGGCAGGAATGAAGG + Intronic
1017525839 6:155240796-155240818 CTGGGGAGTGGCAGGTGTCCTGG - Intronic
1030640597 7:112001805-112001827 ATCCAAGGTTGCAGGTATCCTGG + Intronic
1044150770 8:88772828-88772850 CTCAAAATTGGCAGGCTTCCAGG - Intergenic
1044625515 8:94232563-94232585 CTCCAAAGAGGCAGGAAACCAGG + Intergenic
1049407142 8:142456831-142456853 CTCCAAAGTGGCTGGTCTCCTGG - Intronic
1054858110 9:69923169-69923191 CAGGAAAATGGCAGGAATCCGGG + Intergenic
1057944258 9:99310860-99310882 ATTGAAAGTGGCAGATATACAGG + Intergenic
1057996862 9:99827058-99827080 CCCCAAAGTGGCTGGTATCCAGG - Intronic
1060538178 9:124409069-124409091 CTCGTGGGTGGCAGGAATCCAGG + Intronic
1061887604 9:133600461-133600483 CTCGTAAGTGCCAGGTGACCTGG - Intergenic
1062182664 9:135199008-135199030 CTGGAGAGGGGCAGGTCTCCAGG + Intergenic
1185880540 X:3736165-3736187 CTCAAAGGTGGTAGGTACCCAGG - Intergenic
1186654946 X:11602441-11602463 AGAGAAAGTGTCAGGTATCCCGG - Intronic
1194946297 X:100072434-100072456 CTAGAAAGTGGCATATAGCCTGG - Intergenic
1200784616 Y:7249187-7249209 CTCAAAGGTGGTAGGTACCCAGG + Intergenic