ID: 1105629879

View in Genome Browser
Species Human (GRCh38)
Location 13:22152556-22152578
Sequence TTGTCCCTCTAGGAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105629879_1105629886 14 Left 1105629879 13:22152556-22152578 CCCTCCCTCTCCTAGAGGGACAA 0: 1
1: 0
2: 4
3: 15
4: 216
Right 1105629886 13:22152593-22152615 AGAAAAGTCACAGATATTAATGG 0: 1
1: 0
2: 1
3: 49
4: 590
1105629879_1105629887 20 Left 1105629879 13:22152556-22152578 CCCTCCCTCTCCTAGAGGGACAA 0: 1
1: 0
2: 4
3: 15
4: 216
Right 1105629887 13:22152599-22152621 GTCACAGATATTAATGGAGATGG 0: 1
1: 0
2: 2
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105629879 Original CRISPR TTGTCCCTCTAGGAGAGGGA GGG (reversed) Intergenic
904228075 1:29041305-29041327 TTGTACCTTTAGTAGAGGCAGGG - Intronic
904364185 1:29999977-29999999 TTGTCCCTTGAGGAGATGCATGG + Intergenic
904821182 1:33245632-33245654 GTGTCCCTATAAGAGATGGAAGG + Intergenic
905268786 1:36773118-36773140 TGGTCCCTGTGGCAGAGGGAAGG - Intergenic
905503615 1:38459027-38459049 TTGCCCCTCTAGGAAAGTAAAGG - Intergenic
906006394 1:42476164-42476186 TTTTCCTTCTAGCAAAGGGAGGG + Intronic
910258826 1:85276601-85276623 CTGAGCCTCTACGAGAGGGAAGG - Exonic
913057237 1:115174005-115174027 TTCTATCTGTAGGAGAGGGATGG + Intergenic
913059965 1:115195721-115195743 TTGTCCATCTGGGAAACGGACGG - Intergenic
916776040 1:167965495-167965517 TTGTACATCCAGCAGAGGGAGGG - Intronic
917670711 1:177270801-177270823 TTGCCCCTCTAGGGTAGGGTGGG - Intronic
918232663 1:182550378-182550400 CTGTCCCTCAAGGAGAGGGGAGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919787017 1:201264742-201264764 TTGACCCTCTCCGACAGGGATGG - Intergenic
920788618 1:209066856-209066878 TTGTATTTCAAGGAGAGGGAAGG - Intergenic
921406106 1:214781227-214781249 TTGTCCCCCAAGGAGAGAGATGG - Intergenic
922052987 1:222012045-222012067 TTGTCACTCTAGTACAGGGAGGG + Intergenic
923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG + Intronic
924568593 1:245218339-245218361 TTGTCACTCTGAGGGAGGGAAGG + Intronic
1062777811 10:169003-169025 TTGTGCTTCTTGGAGCGGGAGGG + Intronic
1066350708 10:34634409-34634431 TTTTCCCTCCAGGGGAGGGAAGG + Intronic
1071021402 10:81061208-81061230 TGGTCCTTCTTGGGGAGGGAAGG + Intergenic
1074249333 10:111728721-111728743 GTGTCCGTGTATGAGAGGGAGGG - Intergenic
1074708254 10:116155345-116155367 TTCCCCCTCTAGCAGAGGGAAGG + Intronic
1075472186 10:122699463-122699485 TTTTCCCTCCTGGAGTGGGAAGG + Intronic
1077955438 11:7014611-7014633 CTGCCCCTTTAGGAGAGGGGTGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079515181 11:21259078-21259100 TTGTTCCTATAGAAGCGGGAGGG + Intronic
1080410148 11:32015603-32015625 TTTTCCATTTATGAGAGGGATGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083106598 11:60364321-60364343 CTGTCACTATAGGAGAAGGAAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088086518 11:105987262-105987284 TTTTCCTTCCAGGAGATGGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG + Intronic
1092108821 12:5944950-5944972 TTTTAACTCAAGGAGAGGGAAGG - Intronic
1096593409 12:52677735-52677757 TTGTTCCTCTAGGATGTGGATGG - Exonic
1096779825 12:53985410-53985432 TCGTCCCTCTTGGAGAGCGAGGG - Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097872246 12:64610920-64610942 TTGTGCGTGTAGGCGAGGGAAGG + Intronic
1098964533 12:76772858-76772880 TTGTTTCTTTGGGAGAGGGATGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102028601 12:109727307-109727329 GTGTGCCTCTCGGAGGGGGAGGG + Intronic
1103178713 12:118888811-118888833 TTTTCCTTCTGAGAGAGGGAGGG + Intergenic
1103314069 12:120037940-120037962 TTGTTTCTCTAGGATAGTGAGGG - Intronic
1104969039 12:132522918-132522940 TTGTCACTCTAGGGGGGGCAGGG + Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1105698405 13:22914355-22914377 TTCTCTCTCTAGGAGTGGAATGG - Intergenic
1105850064 13:24326594-24326616 TTCTCTCTCTAGGAGTGGAATGG - Intergenic
1111062369 13:83039030-83039052 TTGTCCATCTAGGAAACAGATGG - Intergenic
1111886320 13:94026427-94026449 TTGGCCCTCTTGGAGAGTGGTGG - Intronic
1113013863 13:105805146-105805168 CTGTCCCTCTAGATGGGGGAAGG + Intergenic
1113777109 13:112954134-112954156 TTGTCACCCGAGGAGAGGGGAGG + Intronic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1118043504 14:61941716-61941738 TTGTCCATTTGGGAAAGGGATGG - Intergenic
1118096868 14:62546778-62546800 TTTCCCCTCAAGCAGAGGGAAGG - Intergenic
1121718333 14:96091762-96091784 TGGTCACTCACGGAGAGGGATGG + Exonic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1124691743 15:31829187-31829209 CTGTCCTCCAAGGAGAGGGAGGG - Intronic
1126543954 15:49852398-49852420 TTGACCACCTAGGAGAAGGAGGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128983496 15:72202678-72202700 TTGTCACAAAAGGAGAGGGAGGG + Intronic
1129029429 15:72607716-72607738 GGGTCCCTCTAGGTGAGGCATGG - Intergenic
1130017248 15:80196997-80197019 TTGTCTCTCTAGGCAAGAGATGG + Intergenic
1130469730 15:84215718-84215740 TTGAGCCTCTAGGAAAGGAAAGG + Intergenic
1130477218 15:84330280-84330302 TTGAGCCTCTAGGAAAGGAAAGG + Intergenic
1130494547 15:84457850-84457872 TTGAGCCTCTAGGAAAGGAAAGG - Intergenic
1130592020 15:85220346-85220368 TTGAGCCTCTAGGAAAGGAAAGG + Intergenic
1130967957 15:88711079-88711101 TTGTACCTTTAGTAGAGGTAGGG + Intergenic
1131597586 15:93813649-93813671 TTGTCCAGCTAGGAGAGGTGGGG - Intergenic
1132270623 15:100520760-100520782 CTGTCCCACTAGGAGTGGGCAGG + Intronic
1132612732 16:825302-825324 TTGTCCCTCTCCGAGCGGGAGGG + Intergenic
1134402044 16:13919441-13919463 GTGTCCCTCTAGTGGAAGGAGGG + Intergenic
1135127979 16:19827330-19827352 TTGTCCCTGTGGGAGAGAAATGG - Intronic
1136013613 16:27381236-27381258 TTGTCTCTCTAGGGCTGGGATGG - Intergenic
1139090553 16:63641351-63641373 TTGTCCCTGTATGAAAGGGGAGG - Intergenic
1139599370 16:67977344-67977366 TTATCCCTCTAGAAGAAGAACGG - Exonic
1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG + Intergenic
1141151792 16:81569435-81569457 ATGTCCCTCTGGGAGAGCCAGGG - Intronic
1141914443 16:87085445-87085467 TTCTCTCCCCAGGAGAGGGATGG + Intronic
1142113209 16:88342913-88342935 GTGCCCCTCCAGGTGAGGGAGGG - Intergenic
1142233580 16:88911074-88911096 TTGTCCCTGTGGGGGCGGGAGGG - Intronic
1143592655 17:7894905-7894927 TTGGCCCCCTAGGAGAAGGAGGG + Exonic
1145228584 17:21152608-21152630 TTGTGCTTCCAGCAGAGGGAGGG + Intronic
1147626056 17:41900882-41900904 TGGTGACTCTTGGAGAGGGAAGG - Intronic
1148334856 17:46834360-46834382 TTCTGCCTCTGGGAGAGGGCAGG + Intronic
1148741833 17:49897481-49897503 GTTTCCCTCTTGGGGAGGGAGGG - Intergenic
1151909697 17:77073924-77073946 CTGTCATTCTAGTAGAGGGAGGG - Intergenic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155108461 18:22690038-22690060 TTGTAACTCTGGGGGAGGGAGGG - Intergenic
1156023564 18:32626733-32626755 TTTAACCTCTAGGAAAGGGAAGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1159034170 18:63261303-63261325 TTCTTCCTCCAGGAGAGGAAGGG - Intronic
1161621058 19:5297350-5297372 GTTTCTCTCTAGGCGAGGGATGG - Intronic
1167521562 19:49958851-49958873 TTGGCCCTCCAGGACCGGGAGGG + Exonic
1167772478 19:51529932-51529954 CTGGCCCTCCAGGACAGGGAGGG + Exonic
1168152379 19:54456027-54456049 CTGCCCCTCTAGGAGGGTGAAGG - Exonic
925381872 2:3433909-3433931 TTCTCCCTGCAGGAGAGAGACGG + Intronic
926511429 2:13785090-13785112 TAGTTGCTTTAGGAGAGGGATGG - Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
926590129 2:14732001-14732023 CTGTCCCTGCAAGAGAGGGAAGG - Intergenic
926700114 2:15797848-15797870 TTGTGACTCTAGGAGAGCAAAGG - Intergenic
929278449 2:40050927-40050949 ATGCCACTCTAGTAGAGGGAGGG + Intergenic
929993496 2:46810242-46810264 TGTTACCTCTAGGAGAAGGAAGG + Intergenic
929999916 2:46854392-46854414 TTGTGCCTACAGGAAAGGGAGGG - Intronic
930104941 2:47632229-47632251 CAGCCTCTCTAGGAGAGGGAAGG + Intergenic
930174806 2:48290833-48290855 TTGCCTCTGAAGGAGAGGGAGGG + Intergenic
934692657 2:96373570-96373592 GTGACCATCTAGGAGAGGGGAGG + Exonic
937092928 2:119218446-119218468 TTGGCCTTCAAGGGGAGGGAAGG - Intergenic
937094471 2:119226463-119226485 TCCTCCCTCTAGGAGTTGGAAGG + Intronic
941961524 2:171258504-171258526 TTGTCCCTAAAGTAGCGGGAGGG + Intergenic
942236415 2:173911988-173912010 TTGTCTTTCTAGGAGAGACACGG + Intronic
944675240 2:202030000-202030022 CTCTCCCTCTGAGAGAGGGAGGG - Intergenic
947004971 2:225500754-225500776 TTGACCTTCTAGCAGAGAGATGG - Intronic
947031167 2:225797489-225797511 TTGTACCTCCAGAACAGGGAAGG - Intergenic
948212332 2:236203985-236204007 GTGTCCATCTAGGGGAGAGATGG + Intronic
948874693 2:240820330-240820352 TTGTCGCGCGGGGAGAGGGACGG + Intergenic
948877102 2:240835410-240835432 TTGTTCTTCTAGCAGAGGAATGG - Intergenic
1168836126 20:878488-878510 TTTTCCCTCTAGCAGGTGGAGGG - Intronic
1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG + Intronic
1173761918 20:45569214-45569236 TTCTCCCTTTAGGAGAGGGAGGG + Intronic
1173874323 20:46360396-46360418 TGGACCCTCTAGGAGTGTGATGG - Intronic
1176120030 20:63450178-63450200 TCGTCCCTTTGGGTGAGGGAGGG - Intronic
1176243778 20:64087809-64087831 TGGTCCCTCCAGAAGGGGGAAGG - Intronic
1177785605 21:25668129-25668151 GTGTCCCTGGAGCAGAGGGAGGG + Intronic
1179028415 21:37699514-37699536 TTGTTCCTCTGGCAGAGGGGAGG + Intronic
1181389545 22:22570244-22570266 TTTTCCTTCTAGCATAGGGAGGG + Intergenic
1182427525 22:30282827-30282849 CGGTCCCTCAGGGAGAGGGAGGG - Intergenic
1184638651 22:45856769-45856791 TTCTCTCTCTGGGAGAGAGAGGG + Intergenic
1184796436 22:46736069-46736091 TGGTCCCTCTTGGAGAGGGAGGG - Intronic
950898320 3:16473825-16473847 TCGTGCTTCTAGGACAGGGAAGG - Intronic
951071413 3:18332973-18332995 TTGCCCTTCTAGGAATGGGAAGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
954785337 3:53088440-53088462 TTGTCCCTTTTGGAGGGAGAAGG + Intronic
955397290 3:58566359-58566381 TTATCCCTCTTGGAGCAGGAGGG + Exonic
956901952 3:73726191-73726213 TTGAGCCTCCAGGGGAGGGATGG + Intergenic
958019088 3:87976915-87976937 TTATTACTCAAGGAGAGGGAAGG + Intergenic
959882230 3:111456925-111456947 ATGTCCCTATAGGAAAGGGTTGG - Intronic
960639172 3:119810371-119810393 TCGGCCCTCTGGGAGATGGAGGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
966483989 3:180447230-180447252 TTTTCCCCCAAGGAGAGTGAGGG + Intergenic
966495248 3:180572831-180572853 TTGTCCATCTAGCAGAAGTAGGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
968480444 4:830792-830814 GTGTCACTGGAGGAGAGGGAGGG - Intergenic
968513747 4:1006941-1006963 CTGTCCCTCAAGCAGAAGGAAGG - Intergenic
968681416 4:1923112-1923134 TTGTCACCATGGGAGAGGGAAGG + Intronic
971712741 4:30137833-30137855 TTGTCCTTTTAAGAAAGGGAAGG - Intergenic
972871769 4:43309231-43309253 CTGTACCTCTAGGACAAGGAAGG - Intergenic
972896673 4:43630266-43630288 TTGTCCCTCTCGGATATGCATGG + Intergenic
973138464 4:46735677-46735699 TTTTGCCTGTAGGAGGGGGAAGG - Intronic
975109473 4:70607754-70607776 TTCTTCCTCTTGGAGAGTGAGGG - Intergenic
979459405 4:120963905-120963927 TTTTCCCTCTAAGGGTGGGAGGG - Intergenic
979484506 4:121255198-121255220 TTGTCCCTCTAGAAGATCCAAGG + Intergenic
982230530 4:153204670-153204692 TTTTCCCTGCAGAAGAGGGAAGG + Intronic
983435839 4:167714014-167714036 TTGTCCCTCTAGAAGCAGGCTGG + Intergenic
985971999 5:3385569-3385591 TTGTCCATTTATGAAAGGGAGGG + Intergenic
987728952 5:21742717-21742739 TTGTCACTGTTGGAGTGGGAGGG + Intergenic
987852838 5:23379321-23379343 TTTTCCATCTAGTAAAGGGATGG - Intergenic
987898335 5:23978212-23978234 TTGAGCCTCTAGGAAAGGAAAGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992501844 5:77351053-77351075 TTGTCCATGTAGGAGTGGCAGGG + Exonic
992832377 5:80606689-80606711 TGGACTCTCTAGGATAGGGAGGG + Intergenic
994172070 5:96668885-96668907 GTGTCCCTCTAGACTAGGGATGG - Intronic
997619172 5:135273561-135273583 TTGTCCTTATAGGTGAGGAAAGG - Intronic
998161917 5:139817778-139817800 TTGTGACTCTAGGAGAGGAAGGG + Intronic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
999360741 5:150984548-150984570 TTGGCCATCTGGGAGAGAGATGG - Intergenic
999373365 5:151069576-151069598 TTTTCCCTCTGGGCCAGGGAGGG - Intronic
1000164547 5:158635138-158635160 TTCTCCCTCTTGCACAGGGAAGG + Intergenic
1001480691 5:172087193-172087215 TTCTCCCTCTAGGAGACAGAGGG - Intronic
1001514086 5:172342846-172342868 TGGCCCTTCTGGGAGAGGGATGG + Intronic
1001608535 5:172981585-172981607 TTGGCCCTCTAGTAGAGGGTTGG + Intergenic
1002458676 5:179361463-179361485 TTCTCCCTCTAGGACAGGCTGGG - Intergenic
1002789737 6:428274-428296 TTGTCCCAGTTGGAGAGGGGTGG + Intergenic
1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG + Intergenic
1005128882 6:22480096-22480118 TAGTGCTTCTAGCAGAGGGAGGG + Intergenic
1007243541 6:40443836-40443858 TTGTCCCTTTAGGCTAGGGGTGG - Intronic
1008324168 6:50156733-50156755 TGGTACCTCTGTGAGAGGGAAGG + Intergenic
1008851915 6:56032739-56032761 TTGTGCTTCCAGCAGAGGGAGGG - Intergenic
1012807387 6:103911658-103911680 CTTTCCTTCTAGTAGAGGGAGGG + Intergenic
1014129092 6:117810840-117810862 TGGTCCAGCTAGGTGAGGGAGGG - Intergenic
1014258441 6:119187700-119187722 TTATTCCTCAAGGAGTGGGAGGG - Intronic
1017926478 6:158915405-158915427 TTATCCCTCTTGTTGAGGGAGGG + Intergenic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020748708 7:12111940-12111962 TTCTCCCTCTTGGGCAGGGAAGG - Intergenic
1021168316 7:17367982-17368004 TTCTCCTTCTAGGAGGTGGAAGG + Intergenic
1023683548 7:42713171-42713193 TTGTCTCTCTAGGAGCCAGATGG + Intergenic
1024569015 7:50709206-50709228 GGGTCACCCTAGGAGAGGGAGGG - Intronic
1024767814 7:52681980-52682002 CTGTCCCTCTAGGTGACAGAGGG - Intergenic
1027933321 7:84568689-84568711 TTGTCCTGCTAGGCCAGGGATGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031340436 7:120593843-120593865 TTATCCCTCAAGGATAGAGAGGG + Intronic
1032130780 7:129225454-129225476 CTGCCTCTCTAGGAGAGGAAGGG + Intronic
1033807694 7:144973311-144973333 TTCTCCCTCTTGGGGAGTGAGGG + Intergenic
1034434062 7:151054766-151054788 GTGTCCCTCCAGGTGAGAGATGG - Intronic
1035397165 7:158542602-158542624 TTGCTCCGCTGGGAGAGGGATGG - Intronic
1035620197 8:1030839-1030861 TCTTTCCTCCAGGAGAGGGAAGG - Intergenic
1037871893 8:22505869-22505891 TTTTCCTTCTAGTACAGGGAGGG + Intronic
1037946197 8:22991066-22991088 TTGTCACTCTGGGAGGGGGTGGG + Intronic
1038577705 8:28718969-28718991 TTGGCATTCTAGGAGAGAGATGG + Intronic
1038662751 8:29511330-29511352 TTGTTGCTTTAGGAAAGGGATGG + Intergenic
1041140272 8:54810731-54810753 TTGTTCCTGGAGAAGAGGGAAGG + Intergenic
1047822672 8:128538697-128538719 TTGTTCCTCTCCTAGAGGGAAGG - Intergenic
1047913602 8:129557924-129557946 TTGACCCTTTAGGAAAGGCATGG - Intergenic
1048412140 8:134186138-134186160 ATATCCCCCAAGGAGAGGGAGGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1054770911 9:69083060-69083082 TTCTCTTTCTAGTAGAGGGAGGG - Intronic
1055287053 9:74739880-74739902 TTGTCCCGAGAGGAGATGGATGG - Exonic
1055464774 9:76553703-76553725 TTCTCCCTCCATGATAGGGATGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057042905 9:91860166-91860188 TTCGCCATCTGGGAGAGGGAAGG + Intronic
1058365712 9:104206144-104206166 TTGTGCTTCCAGCAGAGGGAGGG + Intergenic
1058688399 9:107498792-107498814 TTCTCCCTCCAGGAAAAGGAGGG + Intergenic
1059290766 9:113221724-113221746 TTGTCCCGCTGGGAAAAGGACGG - Intronic
1059373321 9:113861510-113861532 TTGTCCTGCTATGGGAGGGAAGG + Intergenic
1060626336 9:125115763-125115785 TTCTTCCAATAGGAGAGGGAAGG + Intronic
1061591973 9:131603583-131603605 CTGTCCCTCATGCAGAGGGAGGG - Intronic
1189009895 X:37036551-37036573 TTATCCCTCCAAGAGAAGGAAGG + Intergenic
1189038678 X:37519164-37519186 TTATCCCTCCAAGAGAAGGAAGG - Intronic
1190125931 X:47705454-47705476 TAGTGCCTTTAGGAGAGTGAGGG + Intergenic
1190797084 X:53755915-53755937 TTGTCCCTCCAGGTGAGGTATGG + Intergenic
1194041806 X:88950736-88950758 TGGTACCTCTAGGAGGGGGAAGG + Intergenic
1195128903 X:101836076-101836098 CTGTGCTCCTAGGAGAGGGAGGG + Intronic
1195258467 X:103110808-103110830 TTGTCCCTCCAGGCCAGGCATGG - Intergenic
1196942830 X:120794481-120794503 CAGCCCCTCCAGGAGAGGGAGGG + Intergenic
1197539186 X:127733898-127733920 TTGTGCCTCTGGAAGAGGGGAGG + Intergenic
1201059221 Y:10029510-10029532 TTGTACCTTTAGGAGAGACAGGG + Intergenic
1202173671 Y:22077786-22077808 TACTCACTCTAGGAGAGAGAAGG + Intronic
1202217690 Y:22508596-22508618 TACTCACTCTAGGAGAGAGAAGG - Intronic
1202325495 Y:23687463-23687485 TACTCACTCTAGGAGAGAGAAGG + Intergenic
1202545276 Y:25982591-25982613 TACTCACTCTAGGAGAGAGAAGG - Intergenic