ID: 1105631987

View in Genome Browser
Species Human (GRCh38)
Location 13:22178587-22178609
Sequence CTGTCTTGACAGAGGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105631981_1105631987 18 Left 1105631981 13:22178546-22178568 CCCTCATTTTACAGATGAGGAAA 0: 54
1: 436
2: 1474
3: 3163
4: 5615
Right 1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG 0: 1
1: 0
2: 3
3: 21
4: 245
1105631982_1105631987 17 Left 1105631982 13:22178547-22178569 CCTCATTTTACAGATGAGGAAAC 0: 447
1: 2399
2: 5818
3: 10422
4: 14829
Right 1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG 0: 1
1: 0
2: 3
3: 21
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105631987 Original CRISPR CTGTCTTGACAGAGGGGAGC TGG Intergenic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
902179567 1:14677718-14677740 CTCTCTTCACAGATGGGAGCAGG - Intronic
904197805 1:28798986-28799008 CTGTCTTAACAGATGGCAGCAGG - Intergenic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
905522791 1:38613366-38613388 CTGCCTTGACAAAGGGGCGTGGG + Intergenic
906523771 1:46482333-46482355 CAGTCTTGATTGATGGGAGCTGG - Intergenic
906588421 1:47001282-47001304 CTGTCCTGACAGAGTGGTTCAGG - Intergenic
906603381 1:47148332-47148354 CTGTCTTGATAGAGGGTTTCAGG + Intronic
908383867 1:63621909-63621931 CATTCTTGACAGAGGGCAGTTGG + Intronic
909331110 1:74412133-74412155 TTGTCATAACAGTGGGGAGCTGG + Intronic
909425596 1:75520994-75521016 TTGTCCTGACACAGGGTAGCAGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
912696727 1:111847782-111847804 CTGCCCTGCCAGAGGGAAGCTGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916007913 1:160678629-160678651 CTGTGTTGACACACAGGAGCCGG + Intergenic
917106209 1:171494774-171494796 CTTTCTTGAGGGAGGGGGGCAGG - Intronic
917371433 1:174298134-174298156 CCATCTAGAAAGAGGGGAGCAGG + Intronic
917647000 1:177039111-177039133 GTCTCTTGACAGATGGTAGCTGG - Intronic
920508951 1:206536595-206536617 CTATCTTGGCAGAGGGGTGATGG - Intronic
922567833 1:226612433-226612455 CCATCTGGAAAGAGGGGAGCAGG + Intergenic
1065151420 10:22826668-22826690 CCATCTAGAAAGAGGGGAGCAGG + Intergenic
1066204078 10:33170491-33170513 CTTTCCTGACTGAGGAGAGCTGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1070855581 10:79605917-79605939 TGGTCTTGTCAGAGGGGACCAGG - Intergenic
1071926495 10:90415619-90415641 CCATCTAGAAAGAGGGGAGCAGG - Intergenic
1073500169 10:103929741-103929763 CGGTCTTGGCTGAGGGGAGGCGG - Intergenic
1073574628 10:104612223-104612245 CTATCTAGAAAGAGGGGAGCAGG - Intergenic
1075701323 10:124470930-124470952 TTGTCTTCAGAGATGGGAGCCGG + Intronic
1075768892 10:124917063-124917085 ATGTCCTGACTGAGGGGAGAGGG + Intergenic
1079086162 11:17446664-17446686 CTGTCTTGGCAGAATGGAGCGGG + Intronic
1080638541 11:34144441-34144463 CTGGCTTAACAGAAGGCAGCCGG + Intronic
1081191188 11:40104600-40104622 CCATCTGGAAAGAGGGGAGCAGG - Intergenic
1081628059 11:44667171-44667193 GGCTCTTGACAGAGGGGTGCTGG + Intergenic
1081872972 11:46391632-46391654 CTGTCTGGCGCGAGGGGAGCTGG - Intergenic
1084543664 11:69802815-69802837 ATTTCTTGTCTGAGGGGAGCAGG + Intergenic
1084879952 11:72163787-72163809 CCATCTAGAAAGAGGGGAGCAGG + Intergenic
1084946306 11:72640658-72640680 GTGTCTTGTCAGAGAGGAGTTGG - Intronic
1085678515 11:78548718-78548740 CTGTCATGTCAGAAGGGAGGAGG - Intronic
1085816465 11:79742393-79742415 CTGGCTTCACAGAGGGGAAGGGG - Intergenic
1086002538 11:81999838-81999860 TGGTCTTGTCAGAGGGGACCAGG - Intergenic
1087626483 11:100602797-100602819 CTTTATTGACACAGGGGAGGAGG - Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088287185 11:108201190-108201212 TAGTCTTGTCAGAGGGGACCAGG + Intronic
1089081082 11:115776727-115776749 CTGCCTGGACAGAGGGTATCTGG - Intergenic
1090228766 11:125087030-125087052 CTGCCCTGGAAGAGGGGAGCAGG + Intronic
1091332190 11:134738234-134738256 CTGGCTTGAAAGTGGGGAGGAGG - Intergenic
1091554447 12:1561735-1561757 CTGTCTTGACTGAGGTGCACAGG - Intronic
1092540847 12:9419069-9419091 CTGGGTGGACAGATGGGAGCTGG - Intergenic
1094452592 12:30598358-30598380 CTGTCTAGCCAGAAGGGAGATGG - Intergenic
1099519556 12:83643315-83643337 CTGTCTTGACAGGTGTGAGGTGG + Intergenic
1099599150 12:84709844-84709866 CTGTCATGAAAGAGAGGAGTAGG + Intergenic
1101252875 12:102952444-102952466 GTGCCTAGACAGAGAGGAGCTGG + Intronic
1102538444 12:113600190-113600212 CTGCCTTGAAGGAGGGGAGATGG - Intergenic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1106035173 13:26037636-26037658 CTGCCATGCCAGAGGGCAGCTGG - Intergenic
1106186545 13:27414828-27414850 CTGTCTTGAAAGAGGGGAGAAGG + Intergenic
1108934129 13:55865567-55865589 TAGTCTTGTCAGAGGGGACCAGG - Intergenic
1110990618 13:82038764-82038786 CCATCTAGAAAGAGGGGAGCAGG + Intergenic
1111132917 13:83999642-83999664 CCATCTAGACCGAGGGGAGCAGG - Intergenic
1112549291 13:100404547-100404569 CTATCTAGAAAGAGGGGAGCAGG + Intronic
1114775148 14:25473352-25473374 CTGGCATGCCAGAGGGGAGAGGG + Intergenic
1116607854 14:47025602-47025624 TTGTCATGACATAGGGGAGAAGG + Intronic
1117135280 14:52729877-52729899 CTGTCTGGAAAGGGCGGAGCTGG + Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1119539781 14:75430262-75430284 CTTTCTTTCCAGAGTGGAGCTGG - Intronic
1121334476 14:93069091-93069113 CTGCAGTGACAGAGGGCAGCAGG - Intronic
1121603178 14:95221172-95221194 CATTCTTCACAGAGGGGAGGGGG - Intronic
1121849429 14:97206552-97206574 CTGTCCTGAAAGTGAGGAGCTGG + Intergenic
1121952262 14:98181878-98181900 CTGGATTGACAGAGGGGGCCTGG - Intergenic
1122383954 14:101331331-101331353 GTGGCTTGACAGAGAGGAGGAGG + Intergenic
1202833096 14_GL000009v2_random:57859-57881 CTGTCTTGTCAATGGGGACCAGG + Intergenic
1123631802 15:22266278-22266300 CTGTCTGCAAAGAGGGGAACTGG - Intergenic
1125509499 15:40285172-40285194 CTCACGTGACAGAGGGGAGTGGG - Intronic
1125711822 15:41793081-41793103 CTGGCTTAACAGAAGGGAGCTGG - Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1127233007 15:57016982-57017004 CTGTCATGACAGTGGGGATAAGG + Intronic
1127465008 15:59235299-59235321 TTGTCTTGAGGGAGGGGAGCTGG - Intronic
1129144391 15:73633589-73633611 CTCTCTGGGCAGTGGGGAGCTGG + Intronic
1129814939 15:78543497-78543519 CTGGCTTGACAGAGGTGACAGGG - Intronic
1130323951 15:82863717-82863739 CTGTCTTAACAGAGGAGATCCGG - Intronic
1132283146 15:100637857-100637879 CTGGCTTCACAGAAGGCAGCTGG - Intronic
1132371719 15:101304062-101304084 CTGTCGTCAAACAGGGGAGCAGG + Exonic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1134154080 16:11828381-11828403 TTGTCTTGACAGAGGGTGTCTGG - Intergenic
1134189859 16:12112635-12112657 CTGTCTTGCCAGAAGAGACCTGG - Intronic
1134220398 16:12348952-12348974 CTGTCTTCCCAGAGGGGCGATGG - Intronic
1135414409 16:22257832-22257854 CTGTCACCACACAGGGGAGCAGG - Intronic
1136297900 16:29314094-29314116 CAGCCTGGACAGAGAGGAGCGGG + Intergenic
1137541450 16:49364968-49364990 CTGTCTCCACAGAAGGCAGCTGG - Intergenic
1138216799 16:55211623-55211645 CTTTCTTAACAGAGGGCAGCTGG - Intergenic
1141146331 16:81532841-81532863 CTGTCTGGGCAGAGAGGCGCAGG - Intronic
1142225072 16:88873246-88873268 CTGTCTTGACAGTGGCTGGCGGG + Intergenic
1142787487 17:2235528-2235550 GTTTCTTGACAGAGTGGCGCTGG - Intronic
1142889367 17:2933017-2933039 CTTGCTTGGCAGAGGGGAGGAGG + Intronic
1143861932 17:9897439-9897461 CTGACTTGTCAGGGGGGATCAGG - Exonic
1144702720 17:17349384-17349406 CTGTCCACAAAGAGGGGAGCAGG + Intergenic
1144711314 17:17403462-17403484 AGGTCTGGACAGAGGGGAGGAGG + Intergenic
1147177957 17:38668530-38668552 CTCCATAGACAGAGGGGAGCGGG + Intergenic
1148384257 17:47222896-47222918 CAGTCTGGAGAAAGGGGAGCAGG + Intronic
1148909772 17:50935198-50935220 CTGTTTTCACAGTGGGAAGCAGG - Intergenic
1149018532 17:51936516-51936538 CAGTCTTGGCAGAGAAGAGCTGG + Intronic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1150291660 17:63985784-63985806 CCGACTTGAGACAGGGGAGCTGG + Intergenic
1151711220 17:75808057-75808079 CTTTCCTGAAAGAGGGAAGCTGG - Intronic
1155784561 18:29880491-29880513 CCATCTAGAAAGAGGGGAGCAGG + Intergenic
1156646312 18:39166148-39166170 CTATCTTCAGAGAGGGGAGAAGG + Intergenic
1158151892 18:54383033-54383055 CCATCTAGAAAGAGGGGAGCAGG + Intronic
1158700711 18:59743363-59743385 CGGCCTTGACAGAGGTGAGAGGG - Intergenic
1160533420 18:79578277-79578299 GTGTCTGGACAGAGGGAACCAGG - Intergenic
1161082876 19:2320177-2320199 CTGTCTTCCCAGAGGAGGGCAGG - Intronic
1161152399 19:2716616-2716638 CTGTCTTCACAGTGGGGTGTGGG - Exonic
1161338891 19:3730010-3730032 CTGTCCTGAGAGAGGAGGGCGGG - Exonic
1163091740 19:15024777-15024799 CTGTCTTGACATAAGGGAGCTGG - Intergenic
1165040704 19:33065528-33065550 CTGCCCTGAGAGAGGGGACCAGG + Intergenic
1165233133 19:34399889-34399911 CCTTCTTGGCAGAGTGGAGCTGG + Exonic
1165680090 19:37766743-37766765 CTGTCTGGTATGAGGGGAGCAGG + Intronic
925094122 2:1181348-1181370 CTTTCTTGAAAGAGGTGAGTTGG + Intronic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926633406 2:15157713-15157735 CTGTCATGACAACTGGGAGCAGG + Intergenic
927383573 2:22506820-22506842 CTGCCTGCACAGAGGTGAGCAGG - Intergenic
929057912 2:37894454-37894476 CTGTCTTGATGGAGGAAAGCTGG - Intergenic
933352659 2:81175186-81175208 ATCTCTTGACAGCTGGGAGCTGG + Intergenic
936755989 2:115713203-115713225 CAGTCATGAGAGAGGGCAGCTGG + Intronic
937223678 2:120356325-120356347 CTGTCATGGCAGAGGGGACCTGG + Intergenic
939320785 2:140618776-140618798 CTGTCCTGAATGAGGGGACCAGG - Intronic
939552708 2:143635464-143635486 TTGTATTGACAGAGGAGGGCTGG - Intronic
942539181 2:176997524-176997546 CTGTGTTGACAGTGGGGACAAGG + Intergenic
944207065 2:197168157-197168179 GTGACTTGACAGATGGGGGCTGG - Intronic
944665237 2:201954071-201954093 CGGTCTTGACAGAGCAGGGCTGG - Intergenic
946247874 2:218397693-218397715 CTGTAGAGACAGAGGGCAGCTGG + Intergenic
946324473 2:218977684-218977706 CTGTCCTGAGAGAGAGGACCTGG - Intergenic
946758913 2:222973808-222973830 GTGTATTGACAGAGAGTAGCTGG + Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948290082 2:236818170-236818192 CTGTCCTGGCAGATGGGACCGGG + Intergenic
949073177 2:242039048-242039070 CTGGCTTCACAGATGGGATCTGG + Intergenic
1169698476 20:8418896-8418918 CTGCCTACACAGAGGGGAGAGGG + Intronic
1172021956 20:31920774-31920796 CTGTCTTGACACAGCTGAGTGGG + Intronic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1175112418 20:56657951-56657973 CTGGAGTGGCAGAGGGGAGCCGG + Intergenic
1175458271 20:59131449-59131471 CTGACTTGACAGAGGGGAGGTGG + Intergenic
1176189451 20:63800964-63800986 CTGTCTTCACCGAGTGGATCCGG - Intronic
1176647907 21:9367450-9367472 CTGTCTTGTCAATGGGGACCAGG - Intergenic
1179277031 21:39901072-39901094 CTGGTTTGACAGAGGACAGCTGG + Intronic
1179435682 21:41360602-41360624 CTGCCTTGACAGAGGGTGGAGGG + Intergenic
1180037573 21:45257619-45257641 CTGTCCTGGGACAGGGGAGCCGG + Intergenic
1181329000 22:22074819-22074841 CAGTCTGGACAGAGAGCAGCAGG + Intergenic
1184477724 22:44730415-44730437 CTGCCTGGACTGAGCGGAGCTGG - Intronic
1184669097 22:46003499-46003521 AAGCCTAGACAGAGGGGAGCAGG - Intergenic
1184734579 22:46390628-46390650 CTGACATGAAAGAGGGGCGCTGG - Intronic
952064591 3:29553440-29553462 CAGTTTAGACAGAGGGGATCAGG + Intronic
952400306 3:32957292-32957314 CTGTCTTGCCATAGGGGACTTGG + Intergenic
952959177 3:38579156-38579178 CTGTCCTGACAGGGGAGAGACGG - Intronic
953348576 3:42197130-42197152 CTGGATTGCCAGAGGGGAGAGGG + Intronic
953470825 3:43164376-43164398 CTGGCTTGTCCGAGGGGTGCAGG - Intergenic
953786487 3:45915371-45915393 CTGGCTTGAGAGAGGAAAGCTGG - Intronic
954186125 3:48918503-48918525 CTATCTGGTCAGAGGGGAGCTGG - Exonic
955613289 3:60780130-60780152 CCATCTAGAAAGAGGGGAGCAGG - Intronic
958744283 3:98113927-98113949 CCATCTAGAAAGAGGGGAGCAGG - Intergenic
960166101 3:114403229-114403251 CTTTCTTCACAGAAGGGAGCTGG + Intronic
961028635 3:123583790-123583812 CTGCCTCGAGGGAGGGGAGCTGG + Intronic
961415564 3:126754134-126754156 CTGCCTTGAGAGAAGGTAGCAGG + Intronic
961530170 3:127535855-127535877 CTGTGGTGAGAGAGAGGAGCAGG - Intergenic
962416260 3:135184777-135184799 GTATCTTCACAGAGGGCAGCAGG + Intronic
963642931 3:147880724-147880746 CAGTCTTGTTAGAGGGGACCAGG - Intergenic
963704148 3:148665071-148665093 CTGTCTGGTGAGAGGGGAGAAGG - Intergenic
965300149 3:166998254-166998276 TGGTCTTGTCAGAGGGGACCAGG - Intergenic
965702447 3:171472026-171472048 CTGACATCAAAGAGGGGAGCAGG + Intergenic
966944064 3:184765253-184765275 CTTTCTGGACACAGAGGAGCTGG - Intergenic
1202738978 3_GL000221v1_random:37537-37559 CTGTCTTGTCAATGGGGACCAGG + Intergenic
968813443 4:2810211-2810233 CTATCTTCCCAGAGGGAAGCTGG - Intronic
971142615 4:23941135-23941157 ATGGCTTGAGAGAGGGGAGTTGG - Intergenic
971302963 4:25456916-25456938 CAGTGTTGACAGAGAGGAGGGGG - Intergenic
972639903 4:40915916-40915938 CTGCCTTGAGGGAGTGGAGCTGG + Intronic
973369826 4:49236204-49236226 CGGTCTTGTCAGTGGGGACCAGG - Intergenic
973391206 4:49559208-49559230 CGGTCTTGTCAGTGGGGACCAGG + Intergenic
974675112 4:65079074-65079096 CTATTTAGAAAGAGGGGAGCAGG - Intergenic
976081378 4:81358963-81358985 CTGTCTTCACAGGGAGGAGAAGG - Intergenic
978328624 4:107587201-107587223 CCATCTAGAAAGAGGGGAGCAGG + Intergenic
978491623 4:109316748-109316770 TAGTCTTGTCAGAGGGGACCAGG + Intergenic
979136366 4:117116709-117116731 TAGTCTTGTCAGAGGGGACCAGG - Intergenic
979500756 4:121437099-121437121 CTATCTAGAAAGAGGGGAGCAGG - Intergenic
979763159 4:124432229-124432251 CTATCTTAACAGAGAGAAGCAGG - Intergenic
980851439 4:138387950-138387972 ATGTCTTGAAAGCGGGGAACTGG - Intergenic
981487580 4:145303172-145303194 GTGACTTGACAGCTGGGAGCTGG - Intergenic
983321606 4:166202505-166202527 CCATCTAGAAAGAGGGGAGCAGG - Intergenic
1202766937 4_GL000008v2_random:155706-155728 CTGTCTTGTCAATGGGGACCAGG - Intergenic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
985492524 5:187911-187933 CTGTCAGGTCAGAGGGCAGCAGG + Exonic
985829216 5:2215618-2215640 CTGTGTTGGCAGAGGTGGGCAGG + Intergenic
985936469 5:3101502-3101524 CTGGGTTGGGAGAGGGGAGCAGG - Intergenic
988899654 5:35718435-35718457 CCATCTAGAAAGAGGGGAGCAGG + Intronic
991659540 5:68936245-68936267 CTGTCTTGCCTCAGGGGAGAGGG + Intergenic
995006677 5:107205207-107205229 GTGTCCTGAGAGAGGGGAGAGGG + Intergenic
995751017 5:115453377-115453399 CTGTTAGGAGAGAGGGGAGCTGG + Intergenic
999008208 5:148005698-148005720 CTATCTAGAAAGAGGGGAGCAGG - Intergenic
1000011775 5:157239902-157239924 CTGTCTTGACAGATTGGGCCTGG - Intronic
1000015566 5:157272679-157272701 CTATCTTGAGAGACGGGGGCAGG - Intronic
1000684321 5:164228475-164228497 ATGTCTAGACAGATAGGAGCAGG + Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002494019 5:179599654-179599676 CTGTTTTCCCAGAGGGGAGGAGG + Intronic
1003325918 6:5090666-5090688 CTGCCTTGACCGAGGGGTGAGGG + Intergenic
1004553559 6:16673463-16673485 CTGCCTTGACAAAGGTGAGGAGG - Intronic
1006905643 6:37531655-37531677 TTGTCTTCAGAGAGGGAAGCTGG + Intergenic
1008979343 6:57465188-57465210 CTGTCTTCACGGAAGGGAGAAGG - Intronic
1010356019 6:74934601-74934623 CTGTTTTGAGATAGGGGAGAGGG + Intergenic
1011599879 6:89050095-89050117 ATCTCTTGACAGAAGGGAGCTGG + Intergenic
1014276757 6:119397435-119397457 TGGTCTTGTCAGAGGGGACCAGG - Intergenic
1014954642 6:127599900-127599922 CTCTCTAGAAAGAGGGGAGCAGG + Intergenic
1017262822 6:152406982-152407004 CTGTGTTGACATATGGCAGCTGG - Intronic
1018316539 6:162562210-162562232 CTGCCTTGAAAGAAAGGAGCTGG + Intronic
1018753777 6:166830894-166830916 CTAGCTTGATAGGGGGGAGCTGG - Intronic
1019405794 7:883352-883374 CTCTCTTGGCAGACGGAAGCTGG - Intronic
1019917172 7:4141037-4141059 CTGACTAGACAGCAGGGAGCCGG - Intronic
1020555471 7:9664512-9664534 CCATCTAGAAAGAGGGGAGCAGG + Intergenic
1020677221 7:11196875-11196897 CCATCTAGAAAGAGGGGAGCAGG - Intergenic
1021511169 7:21433997-21434019 CTGTCTTGACAAGGGGGAGAAGG + Intronic
1022322220 7:29297935-29297957 CCGTCTAGAAAGAGGAGAGCAGG + Intronic
1024119852 7:46225717-46225739 CTGTTTGGACAGAAGAGAGCAGG + Intergenic
1026502278 7:70952845-70952867 CTGTCTTAACAGTGGGGTCCTGG + Intergenic
1026902598 7:74045302-74045324 CTGTCTGGACAGAGGGCTGATGG + Intronic
1028338029 7:89681856-89681878 CAGTTTTGAGAGAGGGTAGCAGG + Intergenic
1031528603 7:122850576-122850598 TTGTCTGGAAAGAAGGGAGCTGG + Intronic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032037190 7:128530252-128530274 CTGTCCTGGCTCAGGGGAGCCGG + Intergenic
1032977456 7:137241938-137241960 CTGTGTTGAGAGAGGTGAGGGGG - Intronic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1034689968 7:153006530-153006552 CTTTCATGTCAGAGGGGACCAGG + Intergenic
1034733122 7:153405129-153405151 CTGTCACGACAGAGGGAGGCAGG + Intergenic
1034824514 7:154249600-154249622 TTGTCTTGGCAGTGGGGAGGAGG + Intronic
1036135858 8:6160987-6161009 CAGGCTTGGGAGAGGGGAGCAGG - Intergenic
1036694476 8:10965583-10965605 CTGTCTGGAAAGAGGGGAATCGG - Intronic
1036748745 8:11429694-11429716 CTGTCTGCTCAGAGGCGAGCTGG + Intronic
1038286008 8:26207026-26207048 CTGTCAGTAGAGAGGGGAGCTGG - Intergenic
1040718027 8:50282148-50282170 TTCTCTGGCCAGAGGGGAGCTGG - Intronic
1042415091 8:68509693-68509715 CCATCTAGAAAGAGGGGAGCAGG + Intronic
1042484668 8:69336905-69336927 CTGGCTTCACAGATGGGATCTGG + Intergenic
1044551928 8:93522062-93522084 CTTTCTTGACAGAGAGGGCCAGG - Intergenic
1046068447 8:109222834-109222856 CTATCTAGAAAGAAGGGAGCAGG - Intergenic
1047298332 8:123590597-123590619 AGGTATTGAAAGAGGGGAGCTGG + Intergenic
1049194349 8:141307577-141307599 CGGTCCAGACAGAGGGGAGAGGG + Intronic
1050259675 9:3828280-3828302 CGGTGTAGACAGAGGAGAGCTGG + Exonic
1050939709 9:11443343-11443365 CTGTCAGCAGAGAGGGGAGCTGG - Intergenic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1053147633 9:35722711-35722733 CTTTCTTGGCAGAGGTGAGGTGG + Intronic
1053307795 9:36996172-36996194 CCGTCATGGCAGAGGGCAGCAGG - Intronic
1055828240 9:80352375-80352397 CTGTCTTTGGAGAGGGGAACTGG + Intergenic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1057039911 9:91840516-91840538 CAGGCCTGAAAGAGGGGAGCTGG - Intronic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1061327564 9:129873606-129873628 CTGCCTTCCCAGAAGGGAGCCGG + Intronic
1062629173 9:137455991-137456013 ATGTCAAGACAGAGAGGAGCAGG + Intronic
1062652750 9:137586695-137586717 CTGGCATGACAGTGGGGAGAAGG - Intronic
1203707706 Un_KI270742v1:67981-68003 CTGTCTTGTCAATGGGGACCAGG + Intergenic
1187247705 X:17567793-17567815 ATATCTAGACAGAGGGGAGGAGG + Intronic
1188763229 X:34057635-34057657 CCATCTAGAAAGAGGGGAGCAGG - Intergenic
1188811263 X:34656735-34656757 CTGTCCTGGCAGTGGGGCGCGGG + Intronic
1188862438 X:35272963-35272985 CTGTCTAGAAAGAAGGGAGCAGG + Intergenic
1188885643 X:35546514-35546536 CAGTCTTGAGAGGGGGCAGCAGG - Intergenic
1189006309 X:36999058-36999080 CCATCTAGAAAGAGGGGAGCAGG - Intergenic
1189042285 X:37554747-37554769 CCATCTAGAAAGAGGGGAGCAGG + Intronic
1190105293 X:47556346-47556368 CTGGGTTGGCAGAGAGGAGCTGG + Intergenic
1191644681 X:63467403-63467425 CCATCTAGAAAGAGGGGAGCAGG + Intergenic
1193553666 X:82929146-82929168 TAGTCTTGTCAGAGGGGACCAGG + Intergenic
1196123942 X:112080325-112080347 CTTTTGTAACAGAGGGGAGCAGG - Intronic
1196520336 X:116664179-116664201 CCCTCTAGAAAGAGGGGAGCAGG + Intergenic
1197318000 X:124992213-124992235 CAGTCTTGGCAGTGGGGAGCAGG - Intergenic
1197750719 X:129961789-129961811 CTGTCTTGGCAGTTGCGAGCAGG - Intergenic
1199234185 X:145471783-145471805 CCATCTAGAAAGAGGGGAGCAGG - Intergenic