ID: 1105633757

View in Genome Browser
Species Human (GRCh38)
Location 13:22197485-22197507
Sequence CATTATGAAAAGGTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 203}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105633750_1105633757 3 Left 1105633750 13:22197459-22197481 CCGACCTCCTGCCAGTGGATATA 0: 1
1: 0
2: 0
3: 3
4: 121
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633747_1105633757 13 Left 1105633747 13:22197449-22197471 CCCATACGGGCCGACCTCCTGCC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633741_1105633757 28 Left 1105633741 13:22197434-22197456 CCAAGCCCATCAATCCCCATACG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633746_1105633757 14 Left 1105633746 13:22197448-22197470 CCCCATACGGGCCGACCTCCTGC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633744_1105633757 23 Left 1105633744 13:22197439-22197461 CCCATCAATCCCCATACGGGCCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633740_1105633757 29 Left 1105633740 13:22197433-22197455 CCCAAGCCCATCAATCCCCATAC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633748_1105633757 12 Left 1105633748 13:22197450-22197472 CCATACGGGCCGACCTCCTGCCA 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633753_1105633757 -8 Left 1105633753 13:22197470-22197492 CCAGTGGATATACAGCATTATGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633752_1105633757 -4 Left 1105633752 13:22197466-22197488 CCTGCCAGTGGATATACAGCATT 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633751_1105633757 -1 Left 1105633751 13:22197463-22197485 CCTCCTGCCAGTGGATATACAGC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1105633745_1105633757 22 Left 1105633745 13:22197440-22197462 CCATCAATCCCCATACGGGCCGA 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105633757 Original CRISPR CATTATGAAAAGGTGGAGCA GGG Intergenic
904520407 1:31090792-31090814 CATTTTTAAAAGGTGAGGCATGG + Intergenic
906256082 1:44351496-44351518 CAGTATGAAAAGGAAGAGCATGG - Intronic
907421578 1:54351274-54351296 CATTTTGAAAAGTAGGAGGAAGG - Intronic
910655566 1:89614850-89614872 AATTTTTAAAAGGCGGAGCAGGG - Intergenic
911249679 1:95560521-95560543 CATTATATGAAGGTGGAGCAAGG - Intergenic
913527472 1:119707866-119707888 CTTCCTGAAAAGGTGGAGCTTGG - Intronic
915211796 1:154315011-154315033 CATTATGAAAAGAGAAAGCATGG - Intergenic
917101518 1:171450739-171450761 GAGGATGAAAAGGTGGAGCAAGG + Intergenic
917391087 1:174537934-174537956 CATTTTTAAAAGGTGGACTAAGG - Intronic
919087316 1:192935930-192935952 CATTATTAAAAGGAGATGCAGGG - Intergenic
919760132 1:201092518-201092540 CATTATCAAAAAGTGCAGCCAGG - Intronic
921026731 1:211290896-211290918 CTTTAAGGAAAGGTGGACCATGG + Intronic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
921744064 1:218717725-218717747 CATTTTGAAAAGAATGAGCATGG + Intergenic
922979663 1:229814832-229814854 CATTATAAAAAGGTAGAAAATGG - Intergenic
924541718 1:244986776-244986798 CACTGTGGAAGGGTGGAGCACGG + Intronic
924689345 1:246330841-246330863 CAATAGGAAAAGGTGGGGCATGG + Intronic
1062873391 10:926457-926479 CCTGATTAAAAGGTGGGGCAGGG + Intronic
1064811652 10:19206735-19206757 TTTTATGGAAAGGTGGAGCTAGG + Intronic
1069514145 10:69064347-69064369 CATTATGAAAATGTTCAGCCCGG + Intergenic
1071133063 10:82418096-82418118 CCTTCTGGAAAGGTGCAGCATGG - Intronic
1071902693 10:90137829-90137851 CTTTATGGAAAGGCTGAGCAAGG + Intergenic
1072653698 10:97315760-97315782 CCTTTGGAAAAGGTAGAGCAGGG - Intergenic
1072680598 10:97503465-97503487 CATTCTCAAAGGGTGGAGCTGGG - Intronic
1073219323 10:101856842-101856864 CATTATGGGAAGGAGAAGCAAGG - Intronic
1073611226 10:104945982-104946004 CATTAATAAGAGGTGGAGCCAGG - Intronic
1074195331 10:111179399-111179421 CATTAGGGACAGGTGGAGTAGGG + Intergenic
1074841467 10:117356868-117356890 TATCATGGAAAGGGGGAGCAGGG - Intronic
1075830967 10:125410586-125410608 CATTAGGAAATGGCAGAGCAAGG - Intergenic
1077722422 11:4642164-4642186 GCCTGTGAAAAGGTGGAGCAAGG - Intergenic
1078600151 11:12723277-12723299 GATTATGACAAGGTTGAGTATGG + Intronic
1079385377 11:19974293-19974315 AAGGATGAATAGGTGGAGCATGG + Intronic
1080443428 11:32315702-32315724 CATTATGAAAATGTGGTCAAAGG - Intergenic
1080600487 11:33817423-33817445 CATTGTGTAGAGGTGGTGCATGG + Intergenic
1081266574 11:41031486-41031508 CATGATGAAAAAGTGGCTCAGGG + Intronic
1081645589 11:44788032-44788054 GATGAAGAAAAGGTTGAGCATGG + Intronic
1085326247 11:75608784-75608806 CATTATGAAAAAGGGGGGAAGGG - Intronic
1088103361 11:106178275-106178297 CATTATGAAACAGTGTAGTAAGG + Intergenic
1089789441 11:120932089-120932111 CACCATGAGAAGGTGGAACAGGG - Intronic
1089871372 11:121675229-121675251 CCATATGAAAACGTGGAACAGGG + Intergenic
1091609536 12:1993342-1993364 CATTATGAATAGGCTGAGCATGG - Exonic
1092682310 12:10998240-10998262 AATTATGGAAAGGTGAAACAAGG - Intronic
1095328810 12:40932046-40932068 CATTTTTAAAGGATGGAGCATGG - Intronic
1095410822 12:41919877-41919899 CATTATGAAAAAGAAGAGAAGGG + Intergenic
1097939988 12:65293687-65293709 CATTATGAACAAGTGCAGTAAGG - Intronic
1100218734 12:92480972-92480994 CATTATGAAAACGTTTAACAGGG - Intergenic
1100680577 12:96915776-96915798 CATTCTATAAAGATGGAGCATGG + Intronic
1102540577 12:113616380-113616402 CTCTGTGTAAAGGTGGAGCAGGG + Intergenic
1103639169 12:122335309-122335331 GATTATGAAAAGATGGTGCAGGG + Intronic
1104123130 12:125818374-125818396 GATAATGAAAAGGTGGCTCAAGG - Intergenic
1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG + Intergenic
1108295138 13:49009112-49009134 AAGAATGAAAAGGTGAAGCACGG - Intronic
1108840728 13:54611319-54611341 CACTATGCAAATGTGGAGGAAGG + Intergenic
1108909814 13:55533588-55533610 CATTAAGAAATGGTGGATCCAGG + Intergenic
1108918639 13:55648920-55648942 CAAAATGAAATGGTGAAGCAGGG - Intergenic
1109558972 13:64022029-64022051 CATTATGAAAAGTTATTGCAAGG - Intergenic
1109923395 13:69101193-69101215 CAATATGCAGAGGTGGAACATGG + Intergenic
1110696773 13:78500175-78500197 CATAATGAAGAGGTGGAAGAGGG + Intergenic
1111847523 13:93530239-93530261 CATCATGACAAGGTGAACCAAGG - Intronic
1111944886 13:94654587-94654609 CATTATGAAATGATGATGCATGG + Intergenic
1112127974 13:96491008-96491030 CATTATGAAAATGTTCAGAATGG - Intronic
1115539426 14:34405597-34405619 CATTCTGAAAAGTTGAAACATGG - Intronic
1115913057 14:38277680-38277702 AATTATGAAAAGGTAAATCATGG - Intergenic
1116487163 14:45463894-45463916 CATTATGAAAAGTAGGATAAAGG - Intergenic
1116799220 14:49425802-49425824 CATTATAGAAAGATGGAGGAAGG - Intergenic
1117879704 14:60300982-60301004 TATTTAGAAAAGGTGCAGCATGG - Intergenic
1118191620 14:63585788-63585810 TATTCAGAAAAGGTGGGGCATGG - Intergenic
1119118671 14:72052378-72052400 CATTATGAAAAGTGGGAGGGGGG - Intronic
1119952198 14:78756633-78756655 AATTTTTAAAAGTTGGAGCAAGG - Intronic
1120721267 14:87891928-87891950 CATTAGGAAATGGTGGAGGTTGG + Intronic
1121275612 14:92665731-92665753 CATTAAGAAAAGGTGGGGCTGGG - Intronic
1122723918 14:103738039-103738061 CATTTTGAAAAGGGGGCACAGGG + Intronic
1123434341 15:20244243-20244265 AATAATGAAAAGGTCAAGCACGG - Intergenic
1124214686 15:27796814-27796836 GATGAGGAAAAGGGGGAGCATGG - Intronic
1126798484 15:52279838-52279860 AATAATGAAAAGTAGGAGCAGGG + Intronic
1128009364 15:64277517-64277539 CAATATGAAAACTTGTAGCAGGG - Intronic
1129883152 15:79020101-79020123 CATTCTGAAAAAGAGCAGCAGGG + Exonic
1131450196 15:92532944-92532966 CACTATGGCAAGGAGGAGCAGGG + Intergenic
1136850272 16:33606852-33606874 AATAATGAAAAGGTCAAGCACGG + Intergenic
1138058517 16:53862436-53862458 CACTATAAAATGGTTGAGCAAGG - Intronic
1138750909 16:59420099-59420121 GAATTGGAAAAGGTGGAGCAAGG - Intergenic
1141293070 16:82738545-82738567 CATTAAGAAAAGGTAGCGGAGGG - Intronic
1141809331 16:86364374-86364396 CATCATGATAAGGAGGGGCAGGG + Intergenic
1203111885 16_KI270728v1_random:1455305-1455327 AATAATGAAAAGGTCAAGCACGG + Intergenic
1147460300 17:40564036-40564058 CAGTATGAAAGGCTGGAGCAGGG + Intronic
1150351280 17:64446800-64446822 CTATATGAAAATGTGGAGCCGGG + Intergenic
1150850728 17:68701467-68701489 CATTATGAGCTGGTGGAGCTGGG + Intergenic
1153232188 18:2949091-2949113 CATTATTAAAAGGCCGGGCACGG - Intronic
1153763453 18:8353381-8353403 CATTAAGAAAAGGCTGAGAAAGG + Intronic
1153866835 18:9277915-9277937 CATTAAGAAAATCTGGGGCAGGG - Intronic
1158525267 18:58207595-58207617 AATTTTAAAAAGGTGGAACAGGG - Intronic
1159868593 18:73735219-73735241 GATGATGAAAAGGTAGAGCAAGG + Intergenic
1160188643 18:76696392-76696414 GATCAGGAAAAGGTGGAGAATGG + Intergenic
1164580325 19:29430759-29430781 CATTAAGAAAAAGTGGGACAGGG + Intergenic
1165030572 19:32995365-32995387 AATAATGAAAAGGTCAAGCACGG - Intronic
925822816 2:7817094-7817116 CATTGTAAAGAGGTGGAGCATGG + Intergenic
926301736 2:11609697-11609719 CATGAAGAAAAGGAGGAGGATGG + Intronic
927203093 2:20590562-20590584 CATGAGGAAGAGGTGGAGTACGG - Intronic
931924003 2:67051385-67051407 TTTCATGAAAAGGTGAAGCAAGG + Intergenic
931968896 2:67564508-67564530 CATGATGGAAAGGAGGAGCTGGG - Intergenic
932470745 2:71953811-71953833 GATGATGAACAGGTGTAGCATGG - Intergenic
934991936 2:98927878-98927900 CATTTTGAAAAGGTAGCTCATGG + Intronic
936684919 2:114816454-114816476 CATTATGAAAAGGTCTAGGGAGG - Intronic
940294061 2:152104283-152104305 CAGGTTGAATAGGTGGAGCATGG + Intergenic
942006326 2:171703647-171703669 CATTATGAAGAGAAAGAGCAAGG + Intronic
942699695 2:178691620-178691642 CATTATGAAGAGGTGGAGACAGG - Intronic
944030399 2:195228415-195228437 CATTAAGAAAAGGTGGCACATGG + Intergenic
944374138 2:199021079-199021101 CACTAAGGAAATGTGGAGCAGGG + Intergenic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
945790324 2:214296050-214296072 GATTCTGAAAAGGGGGAGTATGG - Intronic
946446092 2:219740887-219740909 CATAAAGAAAATGAGGAGCAGGG + Intergenic
1169203167 20:3725023-3725045 AAGGATGAATAGGTGGAGCACGG + Intergenic
1169457001 20:5760718-5760740 GATTATGAAAAAGAGGAGGAAGG + Intronic
1169691009 20:8332120-8332142 CATTATGAAAGATGGGAGCAAGG - Intronic
1172959776 20:38790414-38790436 AATTTGGAAAAGGTGAAGCAGGG - Intergenic
1174723174 20:52835380-52835402 AAATATGGCAAGGTGGAGCATGG + Intergenic
1177091652 21:16776910-16776932 CAATATAAAAAGGAGAAGCAAGG + Intergenic
1178382223 21:32120355-32120377 CATAAGGAAACAGTGGAGCAGGG + Intergenic
1178797750 21:35760834-35760856 TATTATGAAAAGGTAGAGGAAGG - Intronic
1180862553 22:19094135-19094157 AAGCATGAAAAGGTGGGGCACGG + Intronic
1182644146 22:31794077-31794099 CAATATTAAGTGGTGGAGCATGG + Intronic
1183031720 22:35111353-35111375 CATTATGAAAAACTCGAGGAAGG - Intergenic
1183918001 22:41138666-41138688 CATCATAAAAAGGTAGAGCTTGG + Intronic
1184108547 22:42382505-42382527 CACTATGAATGGGTGGAGGAGGG - Exonic
1184869074 22:47222133-47222155 CATGAAGCAAAGGTGGAGGAGGG - Intergenic
1184945189 22:47797601-47797623 AATTATTTAAAGATGGAGCAGGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
953411800 3:42694628-42694650 CATGATGAACTGGGGGAGCATGG - Intronic
953696173 3:45161412-45161434 CACTATGAGAAGAGGGAGCAAGG - Intergenic
953793131 3:45963637-45963659 GATTTTAAAAAGGTGTAGCAGGG - Intronic
956576089 3:70754281-70754303 CCTCATGAAAAGGTGCAGCTAGG + Intergenic
957096431 3:75780927-75780949 AGTTTTGAAAAGGTGGACCAAGG - Intronic
958427150 3:93992262-93992284 TTTCATGAAAAGGTGGATCAGGG + Intronic
959502923 3:107127247-107127269 CAGAATGAAAGGGTGGAGAAAGG - Intergenic
959770877 3:110094246-110094268 AATGATGAATAAGTGGAGCATGG - Intergenic
960932120 3:122863291-122863313 CAGTCTGAAAATCTGGAGCATGG + Intronic
961595772 3:128015057-128015079 CATTATGAAAAGGGAAAGCATGG - Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
964153552 3:153557957-153557979 CCTTATGAAAAAGTGGATAAAGG - Intergenic
966120288 3:176512674-176512696 CTTTATGGAAAGGTGGAGAGAGG - Intergenic
968837443 4:2975460-2975482 CTTTTAGAAAAGGAGGAGCAGGG + Intronic
969883126 4:10192036-10192058 CTTGATTAAAAGGTGGACCAAGG - Intergenic
970145209 4:13028846-13028868 ACTTATGAAAAGGTAGAACAAGG + Intergenic
971230148 4:24795024-24795046 GATGATGAAAAGGAGGTGCAGGG + Intronic
973255949 4:48113728-48113750 CACTATGAAATGGTGGAGCTGGG - Intronic
974033776 4:56799483-56799505 CTTTCTGAAAAGGAAGAGCAAGG - Intergenic
975359497 4:73451418-73451440 CATTATGAAAAAGAGGAAAAAGG - Intronic
975421776 4:74173063-74173085 TATTATGAAAAGGAGGAAAAGGG - Intronic
975496372 4:75039938-75039960 CAGTATGGAAAGGTGGATGAAGG - Intronic
976826463 4:89265762-89265784 CAACATAAAAAGGAGGAGCAAGG - Intronic
977030873 4:91881377-91881399 CATTTTGAAAAAGTCGAGTATGG - Intergenic
980533895 4:134090087-134090109 CATTAAGAAAAGGTGGAGTTGGG - Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
983830188 4:172317002-172317024 AACTCTGAAAAGGTGGAGAAAGG + Intronic
986112920 5:4738289-4738311 CATTGTGAATTGGAGGAGCATGG - Intergenic
988097097 5:26629698-26629720 TATTATATAAAGGTGGAACATGG + Intergenic
988359655 5:30219202-30219224 CTTTCTGAAAACTTGGAGCAAGG - Intergenic
990267299 5:54091498-54091520 CAGTAAGCAAAGGTGGGGCATGG + Intronic
990390782 5:55317938-55317960 CCTTATTAAAAGGTGGACAAAGG + Intronic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
996201225 5:120676842-120676864 CATTATGAAAAAGTCGCTCAGGG - Intronic
996491391 5:124101916-124101938 CTTTATGAAAAGGTATATCAGGG + Intergenic
997117374 5:131139560-131139582 CATTGTGGAAAGCTGGAGAATGG + Intergenic
997892966 5:137691554-137691576 CAGTGTGGAAAGGTGGAGCAGGG + Intronic
998028811 5:138845634-138845656 GTTTATGAAAAGGGGGACCAAGG - Intronic
998835911 5:146203000-146203022 CATTTTTAAAACGTGGCGCACGG - Intergenic
998965935 5:147540212-147540234 CATTTTGGGAAGCTGGAGCAGGG + Intergenic
999233233 5:150074954-150074976 TATAATGAAAAGGAGGAGGATGG - Intronic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1001268141 5:170290121-170290143 CTTTTGGAAAAGGTGGAGGAGGG - Intronic
1002771973 6:297739-297761 AGTTATCAAAAGGTGGAGTAGGG + Intronic
1004588889 6:17029864-17029886 CAGAATGGAAAGGTGGAGGAAGG + Intergenic
1006233681 6:32608264-32608286 CCCTGTGAAAAGGTGGAGTAGGG + Intergenic
1007841071 6:44716098-44716120 CATTCTGAAAAGGTGGGGCGGGG - Intergenic
1008302240 6:49855240-49855262 CATTATGAAAGAATGGATCACGG - Intronic
1010049229 6:71483598-71483620 GATTGTGAAAAGGTTGAGGAAGG - Intergenic
1010984623 6:82409799-82409821 CACTAGAAAGAGGTGGAGCAGGG - Intergenic
1013330183 6:109093251-109093273 CATGTTGAAAAGGTGGACCCAGG - Intronic
1013694118 6:112681227-112681249 CATTATGTAAAGGAGGAGGATGG - Intergenic
1014274575 6:119373238-119373260 GATTATTACAAGGTGGAGAAAGG + Intergenic
1015296924 6:131605844-131605866 CACTATGAAAAGGTGGTTAAGGG + Intronic
1017556732 6:155579767-155579789 CATTCTGAAAAGGCGATGCATGG + Intergenic
1017993099 6:159506921-159506943 CATTATTAAAAGGTGAATCCAGG + Intergenic
1018188093 6:161285572-161285594 CTTAGTGAGAAGGTGGAGCAGGG - Intergenic
1018645435 6:165943645-165943667 TAGAATGAAAAGGTGGAGGAAGG - Intronic
1020719836 7:11728309-11728331 GTATATGAAAAGGTTGAGCATGG - Intronic
1023878341 7:44305084-44305106 CATTAGGAAAAGGTGTTTCAGGG + Intronic
1024644679 7:51361192-51361214 CATGACAAAAAGGTGGAGTAGGG - Intergenic
1031143961 7:117977155-117977177 CATAATGAAAAGTGGGGGCAGGG - Intergenic
1032484458 7:132274375-132274397 CATTAGGAAAAGCTGGGGGAAGG - Intronic
1033808550 7:144982544-144982566 CAATATGGAAAGATGGGGCAGGG - Intergenic
1033834108 7:145288113-145288135 GATTATGAAAAGGGGGCTCAAGG + Intergenic
1033911634 7:146270118-146270140 CATCGTGAAAATGTGGAGGATGG - Intronic
1036227430 8:6971525-6971547 CACTATGAGAAGGAGGAGGAGGG - Intergenic
1036284584 8:7432711-7432733 CATTTTGATTAGGTTGAGCAAGG + Intergenic
1036336891 8:7878819-7878841 CATTTTGATTAGGTTGAGCAAGG - Intergenic
1037403697 8:18519494-18519516 CTTTATGGAAAGGTGGGGGAAGG + Intergenic
1037839719 8:22235314-22235336 CATTTTAAAAAGGTGGAGGGTGG + Intergenic
1038461104 8:27717844-27717866 CATTAGGAAGAGGAGGGGCATGG - Intergenic
1038722035 8:30045950-30045972 AATTTTGAAAGGGTGGAACAAGG - Intergenic
1038929900 8:32182114-32182136 CATTATGAAAAAGAGGAGCTGGG + Intronic
1039216120 8:35273415-35273437 CAAAATGAAAAGTTGGGGCAAGG - Intronic
1039628264 8:39078907-39078929 TATTTTGAAAAGGTACAGCAGGG - Intronic
1039795067 8:40905923-40905945 CATCATAAAAAGGGGGAGGAGGG + Intergenic
1044324272 8:90842207-90842229 AATAATAAAAAGGTGGAGCCTGG + Intronic
1044753754 8:95440713-95440735 CAGTATGAAAAGGATCAGCAGGG - Intergenic
1046350577 8:113005634-113005656 CATAATGAAAATGAGGAGGATGG - Intronic
1047690005 8:127342286-127342308 CATTCAGAAAAGGTGGCCCAGGG - Intergenic
1047797010 8:128267869-128267891 CATTATGCAAATGAGCAGCAGGG - Intergenic
1050135511 9:2459469-2459491 CAATTTAAAAAGGTGGAGGAGGG + Intergenic
1050830579 9:10006850-10006872 CCTTATGAAAATATGGAACAAGG + Intronic
1052945750 9:34166900-34166922 CATAAGGCAAAGGGGGAGCAGGG + Intergenic
1056870315 9:90271347-90271369 TATTATGAAACTGTGGAACATGG + Intergenic
1058932569 9:109735779-109735801 CATGATGAAAAGGTGCATGAAGG - Intronic
1061373910 9:130213016-130213038 CATCATCAGAAGGTGGAGGAGGG - Intronic
1186893329 X:13981694-13981716 CAGTATGAAAAGGTGGTTAATGG + Intergenic
1188870564 X:35365801-35365823 CAATCTGAAAAGCTGGAGCATGG + Intergenic
1189322036 X:40092556-40092578 CAATTTGCTAAGGTGGAGCAGGG - Intronic
1192295455 X:69842865-69842887 CAGAAGGCAAAGGTGGAGCAGGG - Intronic
1193503197 X:82305977-82305999 CCCTAGGAAAAGATGGAGCAGGG - Intergenic
1193661225 X:84260949-84260971 CCTAATGAAAAGGTGGAGGGGGG + Intergenic
1194839095 X:98716152-98716174 CAGAAGGCAAAGGTGGAGCAAGG - Intergenic
1198025615 X:132703473-132703495 CATTTTGAGAAGGTAGAGAATGG + Intronic
1198226899 X:134653535-134653557 CATTGGGACAAGGTAGAGCAAGG - Intronic
1199254914 X:145708737-145708759 CAGTATAAAAAGGTGGGGGAAGG + Intergenic