ID: 1105634555

View in Genome Browser
Species Human (GRCh38)
Location 13:22204550-22204572
Sequence ACCTGGACATTTAATTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105634555_1105634562 30 Left 1105634555 13:22204550-22204572 CCTTCAGAATTAAATGTCCAGGT 0: 1
1: 0
2: 0
3: 14
4: 235
Right 1105634562 13:22204603-22204625 GAAGGAAAGGCCGGGAAAAATGG 0: 1
1: 0
2: 0
3: 46
4: 728
1105634555_1105634560 21 Left 1105634555 13:22204550-22204572 CCTTCAGAATTAAATGTCCAGGT 0: 1
1: 0
2: 0
3: 14
4: 235
Right 1105634560 13:22204594-22204616 TGACTCAGAGAAGGAAAGGCCGG 0: 1
1: 0
2: 1
3: 40
4: 412
1105634555_1105634559 17 Left 1105634555 13:22204550-22204572 CCTTCAGAATTAAATGTCCAGGT 0: 1
1: 0
2: 0
3: 14
4: 235
Right 1105634559 13:22204590-22204612 CAAATGACTCAGAGAAGGAAAGG 0: 1
1: 0
2: 4
3: 46
4: 486
1105634555_1105634558 12 Left 1105634555 13:22204550-22204572 CCTTCAGAATTAAATGTCCAGGT 0: 1
1: 0
2: 0
3: 14
4: 235
Right 1105634558 13:22204585-22204607 CTTTGCAAATGACTCAGAGAAGG 0: 1
1: 0
2: 3
3: 24
4: 270
1105634555_1105634561 22 Left 1105634555 13:22204550-22204572 CCTTCAGAATTAAATGTCCAGGT 0: 1
1: 0
2: 0
3: 14
4: 235
Right 1105634561 13:22204595-22204617 GACTCAGAGAAGGAAAGGCCGGG 0: 1
1: 0
2: 3
3: 45
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105634555 Original CRISPR ACCTGGACATTTAATTCTGA AGG (reversed) Intergenic
900846809 1:5110476-5110498 ACTTGCTCATTTACTTCTGAAGG - Intergenic
901836649 1:11928279-11928301 ACCTGGACAGTTCCTTCTAAAGG - Intergenic
902611321 1:17599042-17599064 ACCTGCACATTTAATTTTGCAGG - Intronic
902940202 1:19795659-19795681 ACCTTGACCTTCAATTCTCAGGG - Intronic
904031454 1:27536031-27536053 ACCTCGCCCTTTAATTCGGATGG - Intronic
905948231 1:41921631-41921653 ACCTGTACAGTTACTTCTTAGGG - Intronic
908665135 1:66481515-66481537 ACAGGGACATTTAAGTCTGCAGG - Intergenic
909795460 1:79729654-79729676 AACAGGATATTTAGTTCTGAAGG - Intergenic
910311568 1:85830335-85830357 ACAGGGACATTTAAGTCTGCAGG + Intronic
910957868 1:92727128-92727150 TTCTGGACATTTCATTATGATGG - Intronic
911408990 1:97478119-97478141 ACCTGGTTATTCAACTCTGAAGG - Intronic
911822894 1:102442672-102442694 ACAGGGACATTTAAGTCTGCAGG - Intergenic
912498774 1:110108038-110108060 GACTGGACATTGAATGCTGAGGG - Intergenic
914374938 1:147064502-147064524 ACAGGGACATTTAAGTCTGCAGG - Intergenic
914844771 1:151276521-151276543 ACCTGGATATTTAAATCAGCAGG - Intergenic
916568666 1:166006087-166006109 ATCCACACATTTAATTCTGAGGG - Intergenic
917590304 1:176469540-176469562 AACTGCTCACTTAATTCTGAAGG - Intronic
922772875 1:228197724-228197746 TCCTGGACATTGGGTTCTGAGGG - Intergenic
1065491011 10:26281393-26281415 ACCTGGAAATTTAATTTTTTGGG - Intronic
1068094604 10:52474903-52474925 ACATGGTCATTTAATTTTGCTGG - Intergenic
1068754713 10:60639366-60639388 AGATGGAAATTTAATTCTTAAGG + Intronic
1070264621 10:74890281-74890303 GCCTGGACATGTAATTTTTAAGG + Intronic
1071019760 10:81038862-81038884 ACCTGGAGATTTCTTTTTGAGGG - Intergenic
1072060785 10:91808717-91808739 GACTGGAGATTTAAATCTGAGGG + Intronic
1072593066 10:96845241-96845263 ACCTTCACATTTTATTTTGATGG - Intronic
1074272019 10:111963432-111963454 ACCTTGACAGATAATTGTGATGG - Intergenic
1074560786 10:114533622-114533644 ACTTGGCCATTTAATACTGTGGG + Intronic
1076700828 10:132271767-132271789 ACCTGGAAATTTTGTTCTGTAGG - Intronic
1081684375 11:45031563-45031585 AAATGGAGATTTAATTCTGTTGG - Intergenic
1085022922 11:73220265-73220287 ACCTAGAGATTTTATCCTGAAGG + Intronic
1085704017 11:78769895-78769917 ACTTGGCCTTTTAATTCTTATGG + Intronic
1087296469 11:96381263-96381285 ACCTGGACATTTAAATTACAGGG - Intronic
1088634114 11:111802957-111802979 ATCTGGACATTTTCTTCTGATGG - Intronic
1090424452 11:126597357-126597379 ACTTGGCCACTTAATTCAGATGG - Intronic
1092471321 12:8784522-8784544 ACATGCACATTGCATTCTGAAGG - Intergenic
1092917946 12:13204989-13205011 ACCATGACTTTTAATTCTGCCGG - Intronic
1093033812 12:14314306-14314328 ACTTGTACCTTCAATTCTGAGGG - Intergenic
1095102375 12:38198332-38198354 ACCTGGACAGTCATCTCTGAAGG + Intergenic
1098683922 12:73395401-73395423 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1100065158 12:90634992-90635014 GCCTGGATATTTATTTTTGAAGG - Intergenic
1100520736 12:95373180-95373202 ACTTGAACATTTATTTTTGAGGG - Intergenic
1100734055 12:97507158-97507180 ATCTGGATTTTTAATTCTGTAGG + Intergenic
1101537169 12:105628854-105628876 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1101552643 12:105776659-105776681 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1103032528 12:117628745-117628767 ACAGGGACATTTAAGTCTGCAGG + Intronic
1105634555 13:22204550-22204572 ACCTGGACATTTAATTCTGAAGG - Intergenic
1105728159 13:23186168-23186190 ACCCTGACATTCAACTCTGAAGG + Intronic
1108596264 13:51952291-51952313 ACCTATACAATTAATTCTGTTGG - Intronic
1109527081 13:63589618-63589640 CCCTAGACATTTATTTCTGGAGG - Intergenic
1109724244 13:66318591-66318613 ACTAAGACATTTTATTCTGAGGG - Intronic
1110370916 13:74739074-74739096 ACCCAGACATTTATTTCTAAAGG + Intergenic
1110785336 13:79517983-79518005 ACCTAAACAATTAATTGTGAAGG - Intronic
1111938620 13:94585016-94585038 ACCTTGAGATTTAATTGTTATGG - Intronic
1113330718 13:109324404-109324426 ACCTGGACATTCATTTCTAAAGG - Intergenic
1113549417 13:111180774-111180796 ACCTGGAAATTTAATCTTTATGG + Intronic
1115179138 14:30601977-30601999 ACATGGAAATTTAAATCTGTAGG + Exonic
1115815058 14:37154308-37154330 ACTTTGGCTTTTAATTCTGAGGG - Intronic
1116135953 14:40923804-40923826 ACCTACACATTTATTTTTGATGG + Intergenic
1116298764 14:43148667-43148689 ACATGGACATTTAAGTATAAAGG + Intergenic
1121590713 14:95105746-95105768 ACCTCGACATTTGAATCAGAAGG - Exonic
1122689690 14:103526318-103526340 ACCCTGACATTTAGGTCTGAAGG - Intergenic
1123953495 15:25309341-25309363 ACGTTGGCATTTAAGTCTGAGGG - Intergenic
1126324452 15:47461511-47461533 ACCATGAAATTTAACTCTGATGG - Intronic
1130813593 15:87407209-87407231 AGCTGCTCATTTAATTCTCAGGG - Intergenic
1133643343 16:7739221-7739243 ACCTGAACATTGAATACTTATGG + Intergenic
1138079069 16:54071676-54071698 TCCTGGACATTGATTTTTGAAGG + Intronic
1138687352 16:58737170-58737192 ACCTGGACATGTAATTGTTTTGG - Intergenic
1139203037 16:64998639-64998661 ACCTTGACAATGAATTCCGACGG + Exonic
1140705939 16:77629528-77629550 AACTGAACATGTAATTTTGAAGG - Intergenic
1142336719 16:89494078-89494100 ACCTGGAAATTAAATTTTTATGG + Intronic
1144024825 17:11268693-11268715 ACCTGGGGCTTAAATTCTGATGG - Intronic
1144177641 17:12722379-12722401 ACCTGGACATTTGACTCAGTCGG + Intronic
1144931234 17:18860525-18860547 GCCTGGACCTTAAATTCTGATGG + Intronic
1148350877 17:46941148-46941170 ACATGGACATTTACTTCAGGGGG + Intronic
1148927545 17:51100624-51100646 ACCTGGCCATTTTTTTTTGAAGG - Intronic
1150045776 17:61912099-61912121 TCATGAACAATTAATTCTGAAGG - Intronic
1155205959 18:23558000-23558022 TCATGGACTTTTAATTCTGTGGG - Intronic
1155346941 18:24866736-24866758 ACATGAACATTCAATTGTGAGGG - Intergenic
1155388712 18:25309746-25309768 ACCTGATAATTTAATTATGAGGG + Intronic
1155645459 18:28071877-28071899 ACCTCGTCATTTTTTTCTGATGG - Intronic
1155820436 18:30368924-30368946 CCTTTGACATTTAATTATGAAGG + Intergenic
1155884219 18:31187504-31187526 AAGAGGACATTTAATTCTGTAGG + Intergenic
1156206216 18:34888808-34888830 GCCTGTACATTTAAAGCTGAAGG - Intronic
1156883085 18:42103757-42103779 CACTGGACATTTATTTCTGAGGG + Intergenic
1158784898 18:60699021-60699043 ACCTGACTATCTAATTCTGATGG + Intergenic
1159551145 18:69896727-69896749 ACCTGAACATTTGATACTGTAGG - Intronic
1164691737 19:30215876-30215898 AGTTGGACTTTTAATTCTGATGG - Intergenic
1165834057 19:38743780-38743802 ACCTGGACTCTTAGGTCTGAGGG - Intronic
1166248057 19:41545111-41545133 ACCGAGACATTCAGTTCTGAGGG - Intergenic
1167560899 19:50226089-50226111 GCCTGGACTTTTGAGTCTGAGGG + Intronic
1167560927 19:50226163-50226185 GCCTGGACTTTTGAGTCTGAGGG + Intronic
1167561011 19:50226386-50226408 GCCTGGACTTTTGAGTCTGAGGG + Intronic
1167561040 19:50226460-50226482 GCCTGGACTTTTGAGTCTGAGGG + Intronic
1167744504 19:51342618-51342640 ACCTGGAGACTTGGTTCTGAGGG - Intergenic
927473521 2:23394771-23394793 GCCAGCACATTTAAGTCTGAAGG - Intronic
930613553 2:53570108-53570130 ACGGGGACATTTAGTGCTGATGG - Intronic
931144706 2:59504675-59504697 ACAGGGACATATATTTCTGAAGG + Intergenic
931372710 2:61678561-61678583 TCCTGGAATTTTTATTCTGAAGG + Intergenic
932927983 2:75999027-75999049 ACATGGAGATCTAATTCAGAGGG - Intergenic
935955250 2:108369983-108370005 CCCTGAACATTTAATCCAGAGGG - Intergenic
936255726 2:110909088-110909110 ACCTGGACATCTGATTTTAAAGG + Intronic
936757175 2:115729210-115729232 ACCTGTTTATTAAATTCTGAGGG - Intronic
938651503 2:133388570-133388592 ACAGGGACATTTAAGTCTGCAGG + Intronic
938715800 2:134020641-134020663 GTCAGGACATTTAACTCTGATGG - Intergenic
941142340 2:161800768-161800790 ACCATGAGATTTAAATCTGAAGG + Intronic
941189025 2:162353538-162353560 ACCTGGCCAATCAATTCTGAAGG - Intronic
942056906 2:172192808-172192830 ACAGGGACATTTAAGTCTGCAGG + Intergenic
944061453 2:195573322-195573344 ACATGAACATTAAATTATGAGGG - Intergenic
948644771 2:239397621-239397643 ACATGGCCATTTAATGCTGCAGG + Intronic
948658629 2:239492490-239492512 AACTGGACATTTCATTTTGGGGG + Intergenic
1169530816 20:6483040-6483062 GTCTGGACATTTAAATTTGAGGG - Intergenic
1169646608 20:7817650-7817672 ATCAGGACATTTAATTCTTCTGG + Intergenic
1171817651 20:29802597-29802619 ACCTGGACAGTCATCTCTGAAGG - Intergenic
1171900586 20:30852675-30852697 ACCTGGACAGTCATCTCTGAAGG + Intergenic
1172202767 20:33138561-33138583 CCCTGGACAATTAAGTCAGAAGG + Intergenic
1172945704 20:38687109-38687131 ACCTAGGCATTTAATTCAGTTGG - Intergenic
1173045786 20:39509722-39509744 ACCTGAAGATTTCTTTCTGATGG - Intergenic
1174197601 20:48784725-48784747 CCCAGGACATTTAATTCCCAAGG - Intronic
1176612316 21:8994374-8994396 ACCTGGTCATTGAATTATGTTGG + Intergenic
1178505582 21:33160093-33160115 ACCTGGACATTTAATCTTCCTGG - Intergenic
1180321095 22:11322086-11322108 ACCTGGACAGTCATCTCTGAAGG - Intergenic
1180333948 22:11558659-11558681 ACCTGGACAGTCATCTCTGAAGG + Intergenic
1180371017 22:12036892-12036914 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1182077439 22:27504639-27504661 ACCGGGACACTTAATTATAAAGG + Intergenic
1182403033 22:30097781-30097803 TCCTTGAAAATTAATTCTGATGG + Intronic
1183249048 22:36715655-36715677 AACTGGAGATTTTATTTTGATGG + Intergenic
1183850330 22:40580669-40580691 AGCAGGATATTTACTTCTGAAGG - Intronic
949144801 3:685877-685899 ACCTTGACTTTTCATTCTGCCGG - Intergenic
950888991 3:16386638-16386660 GTCTGGACTTTTTATTCTGAAGG + Intronic
951368333 3:21812801-21812823 ACAGGGACGTTTAATTCTGCAGG - Intronic
951656972 3:25020066-25020088 ATCTGTACCTTTTATTCTGAGGG - Intergenic
953702514 3:45207744-45207766 ACCTGGAGCTTTGATCCTGATGG - Intergenic
955263912 3:57423245-57423267 TCCTGAACATTTTATTCTGTTGG - Intronic
955337309 3:58097465-58097487 AACTGCATATTTTATTCTGAGGG + Intronic
955662299 3:61314252-61314274 ACCTGCACATTTAATACACAGGG + Intergenic
956862426 3:73338398-73338420 ACAGGGACATTTAAGTCTGCAGG + Intergenic
956926188 3:73991302-73991324 ACAGGGACATTTAATTCTGCAGG - Intergenic
958887026 3:99738636-99738658 ACAGGGACATTTAAGTCTGCAGG + Intronic
961947610 3:130709797-130709819 ATCTGGACATTTCATATTGATGG - Intronic
964224904 3:154387131-154387153 TCCTGGACATTTTATGCTTATGG + Intronic
965895909 3:173575328-173575350 ACCAGGACAGTTAATTTTCATGG + Intronic
967124507 3:186412019-186412041 ACTTGGAGACTTGATTCTGATGG - Intergenic
967248529 3:187513294-187513316 ACAGGGACATTTAAGTCTGCAGG - Intergenic
968249990 3:197200786-197200808 TCATGGACATTTTATTATGAAGG - Intronic
968747126 4:2365810-2365832 ACCTGCAGAATAAATTCTGAAGG + Intronic
969104593 4:4795949-4795971 GCCTAGACCTTTGATTCTGATGG + Intergenic
970120659 4:12748859-12748881 ACAGGGACATTTAAGTCTGCAGG - Intergenic
970134184 4:12904017-12904039 ACAGGGACATTTAAGTCTGCAGG - Intergenic
970521950 4:16893569-16893591 ACCTAGAAATTTAAATCTGCTGG - Intronic
972021017 4:34314447-34314469 ACCTGGCAAGTTAGTTCTGATGG - Intergenic
974655604 4:64816313-64816335 ACTTGGATCTTTCATTCTGAAGG + Intergenic
975102422 4:70529585-70529607 ACTTGGATATTTAATTTTTATGG + Intronic
975802268 4:78073175-78073197 ACCAGCACATCTAATTATGATGG - Intronic
976676679 4:87710965-87710987 ACAGGGACATTTAAGTCTGCAGG - Intergenic
978003907 4:103592946-103592968 ACCTGGATTTTCAACTCTGATGG - Intronic
978283066 4:107039956-107039978 AAATGTGCATTTAATTCTGAAGG - Intronic
979275660 4:118812226-118812248 ACATGGACATATCTTTCTGAGGG - Intronic
980699619 4:136407735-136407757 ACCTGGACATTAAAGACTTAAGG + Intergenic
982609996 4:157560740-157560762 AAATAGACATTTATTTCTGAAGG + Intergenic
982811389 4:159830479-159830501 TCCTGGAAATTTAATTTTTAAGG - Intergenic
983364612 4:166769721-166769743 ACAGGGACATTTAAGTCTGCAGG + Intronic
984774835 4:183472426-183472448 ACCAGGACACTTATTTCTCAGGG + Intergenic
985852055 5:2396083-2396105 ACCTGGACAAGGAGTTCTGAAGG - Intergenic
987154462 5:15074943-15074965 ACCTGGGCATGTACTTCTCATGG - Intergenic
989734281 5:44684668-44684690 ACAAGAACATTTAATTCTCATGG - Intergenic
990663094 5:58040888-58040910 ACTTTAACACTTAATTCTGAGGG + Intergenic
992457884 5:76932806-76932828 AGCTAGACATTTTTTTCTGATGG + Intergenic
993835429 5:92814027-92814049 ACCTTGACAATTAATACTGATGG + Intergenic
994679209 5:102864845-102864867 ACCTGCAAATTTTAGTCTGAAGG - Intronic
994727171 5:103450560-103450582 GCCTGGAGATTTTATTCTGTTGG + Intergenic
994791568 5:104233070-104233092 ACCTGGACATGAAATTTTGAGGG + Intergenic
995620358 5:114019474-114019496 ACTTGGACTTTTGATTTTGATGG + Intergenic
995874012 5:116771320-116771342 ACCTGGAGGTTTATCTCTGAAGG + Intergenic
996788642 5:127268696-127268718 ACAGGGACATTTAAGTCTGCAGG - Intergenic
997555107 5:134790606-134790628 ACATGAACATTTCATTCTCATGG - Intronic
1002150818 5:177228999-177229021 CCCTGGACATTTAATATTAATGG + Intronic
1002808558 6:602970-602992 ACCTAGTCCTGTAATTCTGATGG + Intronic
1003264945 6:4557572-4557594 ACCTTGACATTTATTAATGAGGG - Intergenic
1003265227 6:4559965-4559987 ACCTTGACATTTATTAATGAGGG - Intergenic
1003396328 6:5755905-5755927 ACCTGGAATTTTAATTTTCAGGG + Intronic
1005147255 6:22705834-22705856 ACCTGGAGAATTAATTTAGATGG + Intergenic
1007052893 6:38850969-38850991 ACCTGGACATGTCTTTTTGAGGG + Intronic
1007842991 6:44731853-44731875 ACCTGGACCTGTATTTCTGCCGG - Intergenic
1009002124 6:57730874-57730896 TCCTGCAAATTCAATTCTGAGGG - Intergenic
1009981839 6:70735388-70735410 ACTTTGACGTTTAATTCAGATGG + Intronic
1010752805 6:79633489-79633511 CCTTGGACATTTTATTGTGAAGG + Intronic
1010998235 6:82558071-82558093 ACCTGGAGGTTAAATCCTGAAGG + Intergenic
1011237670 6:85235498-85235520 ACCAGAACATTTTATTCTGCTGG + Intergenic
1012166210 6:95955736-95955758 GCCTAGACATTAAATTTTGAAGG + Intergenic
1012387209 6:98695947-98695969 ACTTGGACTTTTTCTTCTGAAGG + Intergenic
1014313351 6:119831863-119831885 ACTTGGACATTTAAGGGTGAGGG + Intergenic
1016082511 6:139873137-139873159 ACCTGGGCATATAAATGTGAAGG + Intergenic
1018492854 6:164313653-164313675 TTCTGGACATTTAATTTTAATGG - Intergenic
1019059471 6:169245346-169245368 TCTTGAGCATTTAATTCTGAAGG - Intronic
1019696024 7:2446586-2446608 CCCTGGACATCTCATTCTCATGG - Intergenic
1020708722 7:11578389-11578411 TCCTGGACATTTAATTTATAAGG - Intronic
1021457139 7:20841870-20841892 ACTTGGACATTTTTTACTGATGG + Intergenic
1022590383 7:31655582-31655604 GCCTGGACTTTTATTTCTGGTGG - Intronic
1022926037 7:35057124-35057146 ACCTGGGCATCTCATTTTGAGGG - Intergenic
1023455976 7:40339280-40339302 ACAGGGACATTTAAGTCTGCAGG + Intronic
1030696989 7:112596273-112596295 ACCTCGACAGTTAATTTTGCAGG - Intergenic
1031193444 7:118584783-118584805 ACTTGGACATTTTATTTTGTGGG + Intergenic
1031315371 7:120251214-120251236 AGCAGAACATTTATTTCTGAAGG - Intergenic
1032624019 7:133569787-133569809 ACCTGGGCATTTGATTACGAAGG - Intronic
1033855951 7:145561496-145561518 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1033928795 7:146497639-146497661 ACCTCTTCTTTTAATTCTGACGG - Intronic
1035475404 7:159140600-159140622 ACCTGGACATCTCATATTGAAGG - Intronic
1036536235 8:9655350-9655372 ACAGGGACATTTAAGTCTGCAGG - Intronic
1036944738 8:13084220-13084242 ACATGGATATTCAATTTTGATGG - Exonic
1041178094 8:55218509-55218531 ACCTTTAAATTTAATTCTGGTGG - Intronic
1042803361 8:72745074-72745096 ACATGCACATTTAATTCAGGAGG - Intronic
1044016680 8:87054544-87054566 ACCTGGGCATATAATCCTGTTGG - Intronic
1044081861 8:87895205-87895227 AGATGGACAATTAATTGTGAAGG - Intergenic
1044601420 8:94009155-94009177 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1045913048 8:107432909-107432931 ATTTGGACATTTATTTCTGTAGG + Intronic
1048091975 8:131250930-131250952 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1048167378 8:132075518-132075540 CCCTGCACAGTTAATTCTCATGG - Intronic
1049113202 8:140662682-140662704 AACTGGACATTGACTTCTGAAGG - Intronic
1052156150 9:25193401-25193423 ACATTAACATTTAATTCTTATGG - Intergenic
1055452626 9:76444462-76444484 ACCTGGACTCTTAATCCTCATGG - Intronic
1058080021 9:100691306-100691328 ACGGGGACATTTAAGTCTGCAGG - Intergenic
1058423253 9:104853526-104853548 ACTTGGAGCTTTCATTCTGATGG - Intronic
1058938556 9:109791820-109791842 ACCTGGAAATCCAATTTTGAAGG + Intronic
1059476339 9:114550987-114551009 CTCTGGACATTTCATGCTGATGG - Intergenic
1060410505 9:123396826-123396848 TCCCGGACATCTGATTCTGAGGG - Intronic
1061977053 9:134074297-134074319 ACATGGAAATTTAAATCTTAGGG + Intergenic
1203369308 Un_KI270442v1:287859-287881 ACCTGGACAGTCATCTCTGAAGG - Intergenic
1186773425 X:12839822-12839844 ACCTGGTAATTTAACTCTTATGG + Intergenic
1186914607 X:14206412-14206434 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1186968062 X:14809784-14809806 ACAGGGACATTTAAGTCTGCAGG - Intergenic
1188831442 X:34902751-34902773 ACCTAGACTTTTGATTTTGAAGG + Intergenic
1188981669 X:36732450-36732472 ACATGGACATATCTTTCTGAGGG - Intergenic
1189045587 X:37587329-37587351 ACAGGGACATTTAAGTCTGCAGG + Intronic
1191050146 X:56183003-56183025 ACATGGACGTTTAAGTCTGAAGG + Intergenic
1191114838 X:56841709-56841731 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1191765614 X:64695376-64695398 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1192352491 X:70368782-70368804 ACAGGGACATTTAAGTCTGCAGG + Intronic
1193007696 X:76639207-76639229 TCCTGGACTTTTAATTTTGTTGG + Intergenic
1193013712 X:76707966-76707988 ACCTGGACATTGAAGAGTGATGG - Intergenic
1193648319 X:84095746-84095768 ACCTGGATATTCATTCCTGATGG - Intronic
1193662937 X:84279240-84279262 AGCTGCACATTTACCTCTGAAGG - Intergenic
1195013387 X:100754860-100754882 ACCCAAACATTTATTTCTGAAGG + Intergenic
1195632277 X:107070088-107070110 CCCTTCACATTTATTTCTGAAGG - Intronic
1198155244 X:133953437-133953459 ACCTAGGCAATTAATTCTGATGG - Intronic
1200769889 Y:7113988-7114010 ACGTGGAAATTTAATTCTTTGGG + Intergenic
1201068972 Y:10127102-10127124 ACCTGGACAGTCATCTCTGAAGG + Intergenic
1202105053 Y:21355008-21355030 ACAGGGACATTTAATTCTGCAGG - Intergenic
1202242062 Y:22781186-22781208 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1202395046 Y:24414930-24414952 ACAGGGACATTTAAGTCTGCAGG + Intergenic
1202475738 Y:25255162-25255184 ACAGGGACATTTAAGTCTGCAGG - Intergenic