ID: 1105636111

View in Genome Browser
Species Human (GRCh38)
Location 13:22216688-22216710
Sequence CGGCCTTAAGAACCACCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105636111_1105636113 4 Left 1105636111 13:22216688-22216710 CCTGTTGGTGGTTCTTAAGGCCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1105636113 13:22216715-22216737 TAACTTTAGTATTCTACCTTTGG 0: 1
1: 1
2: 0
3: 26
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105636111 Original CRISPR CGGCCTTAAGAACCACCAAC AGG (reversed) Intergenic
901791977 1:11658548-11658570 CGGCCTTGAGGTCCACCACCTGG - Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
906314396 1:44776818-44776840 CGGTCTTAAGATTCACCAAGTGG + Intronic
914312370 1:146478099-146478121 CCGCGTTTAGAACCACCAGCTGG - Intergenic
919895041 1:202004436-202004458 CGTCCTTAAGAACGACCACCAGG + Exonic
920062635 1:203238267-203238289 CTGCCTTAAGTGTCACCAACTGG + Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920824706 1:209414563-209414585 GATCTTTAAGAACCACCAACTGG + Intergenic
923098326 1:230793041-230793063 TGACCTTAAGAATCACCAACTGG - Intronic
1068611245 10:59062722-59062744 CAACCTAAAGAACCACCAGCTGG + Intergenic
1086850183 11:91799319-91799341 AGAACTTAAGAACCACCAAATGG + Intergenic
1092252568 12:6908294-6908316 GGGTCTTAAGAACCACAATCAGG + Intronic
1100730696 12:97464695-97464717 TGGCCATAGCAACCACCAACAGG - Intergenic
1103199743 12:119078049-119078071 GGGTCTTCAGAACCACCCACAGG - Intronic
1105636111 13:22216688-22216710 CGGCCTTAAGAACCACCAACAGG - Intergenic
1112128571 13:96496955-96496977 CACCCTTAAGCACCACCACCGGG - Intronic
1112295665 13:98184555-98184577 CTTCCTTAAGAAGCAACAACAGG - Intronic
1114379619 14:22187887-22187909 CAGCTTTAACAACCATCAACTGG + Intergenic
1121085230 14:91140994-91141016 CAGCCTTAAGAACTATCCACTGG - Intronic
1123203580 14:106691608-106691630 GGGCATTCAGAACCACCAGCAGG - Intergenic
1126548574 15:49901569-49901591 AGGGCTTAAGAACCACTATCTGG + Intronic
1128777636 15:70335736-70335758 TGGCTTTAAGTACCACCAAGAGG + Intergenic
1129101881 15:73272760-73272782 CTGCAGTCAGAACCACCAACAGG - Intronic
1148080958 17:44967625-44967647 CGGCCTCAAGAACCCCCACGAGG - Exonic
1151505014 17:74521952-74521974 AGGCCTCAAGAACCACCTCCAGG - Exonic
1152464433 17:80457896-80457918 TGGCAGTAAGAACCACCAAGGGG - Intergenic
1153250704 18:3118769-3118791 AGGACTTAAGAAATACCAACTGG + Intronic
1168339867 19:55616708-55616730 CGGCCTCAAGAAACACCGCCTGG + Exonic
947005143 2:225502736-225502758 GGGCCCTAACAACCACCAAAGGG - Intronic
947478374 2:230472961-230472983 AGGCCTTCAGAATCTCCAACAGG - Intronic
1170917141 20:20638249-20638271 AAGCATTAAGAACCACCAACAGG - Intronic
1172050337 20:32112393-32112415 CTGTCTTAAGAAACAACAACAGG + Intronic
1175888496 20:62305572-62305594 GGGACTTAAAAGCCACCAACAGG - Intronic
1179258453 21:39737881-39737903 GGGCCTTATGACCCACAAACAGG + Intergenic
1181740186 22:24914849-24914871 CAGCCTAAATGACCACCAACAGG - Intronic
1183435807 22:37794223-37794245 CTGTCTTAAGAAACACAAACAGG + Intergenic
949432346 3:3991320-3991342 CTACCTTAAAAACCACAAACCGG + Intronic
955278990 3:57575690-57575712 AGGCATTAACAACTACCAACCGG + Intronic
956857264 3:73287342-73287364 CACCTTTAAGAACCCCCAACTGG - Intergenic
968699900 4:2050151-2050173 CTGCCTTAAGAAACAGCAGCTGG + Intergenic
986105921 5:4659127-4659149 CAGACTTAAGAATCACCAAAGGG + Intergenic
1010743655 6:79537038-79537060 CTGCTTTAAGAACCACCCGCAGG + Intronic
1016991383 6:149931706-149931728 TGGGCTGAAGAACCACCCACTGG + Intergenic
1016998954 6:149982226-149982248 TGGGCTGAAGAACCACCCACTGG + Intergenic
1046855450 8:119026599-119026621 CATCCTTAAGAGCCACCAAATGG - Intronic
1047593823 8:126355761-126355783 CTGCCTTAATATCCATCAACAGG - Intergenic
1048249089 8:132843975-132843997 AGCTCTTAAGAACCACCAGCTGG + Intronic
1049737974 8:144220125-144220147 CCCCCTTGAGAACCATCAACAGG - Intronic
1052847357 9:33349018-33349040 AGGACTTGAGAACCACCCACAGG - Intronic
1200125701 X:153813412-153813434 TGCCCTTCAGAACCACCACCAGG + Intronic