ID: 1105637917

View in Genome Browser
Species Human (GRCh38)
Location 13:22233681-22233703
Sequence TTGGCAGGCCAAATATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105637917 Original CRISPR TTGGCAGGCCAAATATTTGG GGG (reversed) Intergenic
901629440 1:10641101-10641123 TGGGCAGGGCAGACATTTGGTGG - Intronic
907770943 1:57462741-57462763 TTTTCAGGTCTAATATTTGGTGG + Intronic
911103691 1:94113699-94113721 TTGGTAGGCCAGATTTTTGTTGG - Intronic
911246801 1:95526813-95526835 TTGTCAGGCCAGATTTTGGGGGG + Intergenic
913363214 1:118005199-118005221 ATGGCAAGCCGAATAATTGGTGG - Intronic
915566642 1:156717676-156717698 TTCCCAGGCCAAATAGCTGGAGG - Intergenic
921396055 1:214670717-214670739 ATGGCAGGACAAATAAATGGAGG + Intergenic
924144752 1:241062328-241062350 TTGGCCGGCCAAGCATTTGAGGG - Intronic
924181110 1:241439407-241439429 TTGGGACGGCAAAAATTTGGGGG - Intergenic
1065156509 10:22875204-22875226 TTGGCCAGCCACAAATTTGGGGG + Intergenic
1068698229 10:59992194-59992216 TTGAAAGTACAAATATTTGGTGG + Intergenic
1071792812 10:88973742-88973764 TTGCCAGGCCAAATATTAACAGG + Intronic
1072010852 10:91301755-91301777 TTGGGATGGCAAAAATTTGGGGG + Intergenic
1078845239 11:15114326-15114348 TTGGCAGGTCCAAGATGTGGAGG + Intronic
1080011506 11:27464254-27464276 TTGGCAGACCAGATATTTTCAGG - Intronic
1081244418 11:40746770-40746792 TAGGCAGGCCCAATCTTAGGAGG - Intronic
1087752982 11:102025771-102025793 TTGGCTGGCCAAATGTAAGGAGG + Intergenic
1089934926 11:122354658-122354680 TTAGCTGGCCAAATATTTAAAGG + Intergenic
1095553115 12:43468217-43468239 TTGGTATTACAAATATTTGGGGG + Intronic
1099469508 12:83030091-83030113 TTTACAGGCCAAATATTTACAGG - Intronic
1105637917 13:22233681-22233703 TTGGCAGGCCAAATATTTGGGGG - Intergenic
1111540437 13:89661088-89661110 CTAGCATCCCAAATATTTGGAGG + Intergenic
1114857279 14:26464200-26464222 ATGACAGGCCACATATATGGTGG + Intronic
1116278276 14:42866029-42866051 TTGAAAGGCCAAATAATTTGAGG - Intergenic
1118012723 14:61626412-61626434 TCTGCAGGCCAAATATTAGAGGG + Intronic
1120405915 14:84092671-84092693 TTGGCAGGTCCAGTTTTTGGTGG - Intergenic
1123130358 14:105980879-105980901 AGGGGAGGCCAAATGTTTGGTGG - Intergenic
1123916868 15:25039807-25039829 TTGGAAGGCTAAATGTTTGAAGG - Intergenic
1125271414 15:37942633-37942655 TTGGGTGTCCATATATTTGGGGG - Intronic
1131326305 15:91450082-91450104 TTGGTAGGCCAATTCTTTGAAGG + Intergenic
1138525904 16:57607136-57607158 TTGGCTGGCCAAACACTGGGAGG - Intergenic
1140394831 16:74617547-74617569 TTGGCAGGCCACTTATTTCCTGG - Intergenic
1140833033 16:78769121-78769143 TTGGTATTCCAAATAATTGGTGG + Intronic
1141095188 16:81158204-81158226 TTCACAGGACAAATATTTGTGGG + Intergenic
1143978920 17:10850985-10851007 TTGGAAGGGAAAATGTTTGGAGG + Intergenic
1144457900 17:15433824-15433846 TGGGCAAGCCAGATATTTGGGGG - Intergenic
1145829589 17:27904944-27904966 TAGGCAGGCCAAATATTCTATGG + Intergenic
1146303286 17:31708769-31708791 TTGGCAGGCCAGACAATTTGAGG + Intergenic
1150488722 17:65560736-65560758 TTGGCAGGCCGGCTATTTCGGGG - Intronic
1152712331 17:81878877-81878899 TTGACTGGCCAAGCATTTGGTGG - Intergenic
1155812146 18:30250310-30250332 GAGGCATGCCAAATATTTGGTGG + Intergenic
1156053527 18:32969550-32969572 TTGGAAGGACAAATATCTGAAGG - Intronic
1157434074 18:47653813-47653835 TTGGCTGTCCAGATAATTGGGGG + Intergenic
1159306358 18:66648084-66648106 CTGCCATGCAAAATATTTGGAGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1163351467 19:16778763-16778785 TTGGGAGGCCAAACTTTGGGAGG - Intronic
1164872118 19:31654892-31654914 TTGACGTGCCAAATAGTTGGAGG + Intergenic
1168235362 19:55059563-55059585 TTGGGAGGCCAAAGTTTTGGGGG + Intronic
925475386 2:4207624-4207646 TTGCCTGGCCAAGTATTTTGGGG + Intergenic
928790536 2:34946542-34946564 TAGGCAGACCAAAGAGTTGGAGG + Intergenic
929064151 2:37956177-37956199 GTGAAAGCCCAAATATTTGGTGG - Intronic
929200394 2:39229044-39229066 TTGGTAGGGGAAGTATTTGGAGG + Intronic
931477456 2:62603677-62603699 TTTGATGGTCAAATATTTGGAGG + Intergenic
933214147 2:79607627-79607649 TTTGCCACCCAAATATTTGGGGG - Intronic
935420041 2:102857887-102857909 TTGTTAGGCAGAATATTTGGGGG - Intergenic
935812789 2:106816686-106816708 CTGGCAGGACAATTAATTGGTGG - Intronic
936604716 2:113938795-113938817 TTTGTAGGCCAAATTATTGGAGG - Intronic
940128256 2:150352082-150352104 CTGGCAGGGAAACTATTTGGAGG + Intergenic
943950857 2:194131166-194131188 TTGGGACGGCAAAAATTTGGGGG + Intergenic
946682026 2:222227350-222227372 TTGGGAGGCCAAAAAATAGGAGG + Intronic
948813600 2:240498610-240498632 GTGGCTGGCTAAATATTTGTGGG + Intronic
1169457481 20:5764828-5764850 TTTTCATGCAAAATATTTGGAGG + Intronic
1169534105 20:6518453-6518475 TTAGTATGCCAGATATTTGGTGG - Intergenic
1175955587 20:62607503-62607525 AAGGCAGGCCCTATATTTGGGGG - Intergenic
1176257740 20:64160901-64160923 CTGGCAGGCCATATAGCTGGTGG + Intronic
1177537116 21:22442433-22442455 TTGACATGCCAAACATTGGGAGG + Intergenic
950005814 3:9690255-9690277 CTTGCAGGCCCAGTATTTGGAGG + Intronic
951455483 3:22887409-22887431 GTTGCAGGCCAAAAAATTGGAGG - Intergenic
952152133 3:30605168-30605190 TTGGCAAGGCAATTAATTGGTGG + Intergenic
952948237 3:38495874-38495896 TTGCCCGGCTAAATTTTTGGCGG - Intergenic
954401836 3:50323125-50323147 TTGGGAGTCAAAATACTTGGGGG + Intronic
955633059 3:60995443-60995465 TTGGCAGCTCAACTGTTTGGGGG - Intronic
957445176 3:80307631-80307653 TAGCCATGCCAAAGATTTGGTGG - Intergenic
962322547 3:134403941-134403963 CTAGCAGTACAAATATTTGGGGG + Intergenic
964222966 3:154367755-154367777 TAGCCATGCCAAAGATTTGGTGG - Intronic
974099385 4:57400131-57400153 TTGGATGAACAAATATTTGGGGG - Intergenic
975879815 4:78891108-78891130 TTGGCAGGGCAAATAATTTTAGG + Intronic
976084841 4:81397025-81397047 TTGGCATGCCATATGTTTGACGG + Intergenic
977981324 4:103326359-103326381 TGTGCTGGCCAAATATTTGTAGG + Intergenic
979326890 4:119390634-119390656 TTGGCAGGCCAAAAATATAGAGG + Intergenic
979684703 4:123498975-123498997 TTGTCAGGTCAACTATTTAGGGG + Intergenic
983244761 4:165275325-165275347 TTTGCAGGCCAAAAATATAGAGG + Intronic
983452757 4:167928139-167928161 TTGGGACGGCAAAAATTTGGGGG - Intergenic
983992938 4:174144202-174144224 TTGACAGGCCAGATATATGATGG + Intergenic
984742014 4:183174035-183174057 TTGTCAGGCCGAAGAATTGGAGG - Intronic
990412535 5:55555270-55555292 TTGGCATGCCAAATACTTACTGG + Intergenic
990528478 5:56651500-56651522 TTGCCATGCCAAATCTTTAGTGG + Intergenic
994368814 5:98946471-98946493 TTGACAGCCAAAATGTTTGGGGG + Intergenic
994898333 5:105735509-105735531 TTGCCCAACCAAATATTTGGAGG - Intergenic
996982279 5:129513281-129513303 ATGACAGGCAAAATATTAGGAGG - Intronic
1008028823 6:46669548-46669570 GTGTCAAGTCAAATATTTGGAGG + Intronic
1009380733 6:63025609-63025631 TTGCCAGGCCCTATATTTGTAGG - Intergenic
1009692564 6:67055210-67055232 TTGGCAGGACATATATTTTCAGG + Intergenic
1011205342 6:84888675-84888697 TTGGAATGCCAGATATTTGTTGG + Intergenic
1013060919 6:106633188-106633210 CTAGCATGCAAAATATTTGGTGG + Intronic
1025715587 7:63952807-63952829 GTTGCAGGTCAAATAATTGGAGG + Intergenic
1027537789 7:79427716-79427738 ATGTCAGGCTAAATATTTAGAGG + Intronic
1030471038 7:109962640-109962662 TAGGCAGGCCAAATAAGTGGGGG + Intergenic
1033242850 7:139694987-139695009 TTAGCAGGCCATATAATAGGGGG - Intronic
1035002629 7:155625856-155625878 TGGGGATGCCTAATATTTGGTGG + Intronic
1040372954 8:46795090-46795112 GTTGCAGGCAAAATAATTGGAGG - Intergenic
1043745944 8:83873636-83873658 ATGGCAGGACAAGTATTTTGAGG + Intergenic
1045057109 8:98378783-98378805 TAGGCAGGACAGATATTTGCAGG - Intergenic
1046420096 8:113970263-113970285 TATTCAGGCCACATATTTGGTGG - Intergenic
1046875538 8:119250831-119250853 TTGCCTGCCAAAATATTTGGAGG - Intergenic
1048135902 8:131746149-131746171 TTGGAAGGCGAAAATTTTGGGGG - Intergenic
1050423430 9:5490428-5490450 GTGGGAGGGCAAATATTTGGAGG - Intergenic
1051559114 9:18420531-18420553 AAGGCATGCCCAATATTTGGAGG - Intergenic
1051826643 9:21229042-21229064 ATGGCAGCCCAAATATATGCAGG + Intronic
1052504189 9:29331020-29331042 TAGTCAGGCCAGAAATTTGGGGG - Intergenic
1057957288 9:99421052-99421074 TTGGGATCCCAAATATTTGCAGG + Intergenic
1187274216 X:17804437-17804459 TCAGCAGGACAAATATTTGTTGG + Intronic
1189655098 X:43236758-43236780 TTGACAAGCCATAAATTTGGGGG + Intergenic
1197173287 X:123457897-123457919 TTGGGAGGCCACATTTTAGGAGG + Intronic
1197197505 X:123718012-123718034 TTGGCTGGCCTTATATTTAGTGG - Intronic
1198491571 X:137146682-137146704 CTGACAAGCAAAATATTTGGGGG + Intergenic