ID: 1105640997

View in Genome Browser
Species Human (GRCh38)
Location 13:22264033-22264055
Sequence TTGTGGGTGGGGATGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 959
Summary {0: 1, 1: 0, 2: 8, 3: 84, 4: 866}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105640987_1105640997 16 Left 1105640987 13:22263994-22264016 CCAAAAAAAAAAAAAAAAAAAAA 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
Right 1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG 0: 1
1: 0
2: 8
3: 84
4: 866
1105640986_1105640997 22 Left 1105640986 13:22263988-22264010 CCATCTCCAAAAAAAAAAAAAAA 0: 2676
1: 87395
2: 67301
3: 106475
4: 184656
Right 1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG 0: 1
1: 0
2: 8
3: 84
4: 866

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105640997 Original CRISPR TTGTGGGTGGGGATGGCGGA AGG Intergenic
900195780 1:1374895-1374917 TTGTGGGTTGGGGTGGCGGAGGG - Exonic
900829197 1:4952213-4952235 TGGGGGGTAGGGATGGGGGATGG + Intergenic
900984526 1:6065741-6065763 TTGAGGGTGGGGACAGAGGAAGG + Intronic
901133655 1:6979078-6979100 TTGTTGGTGTGGCTGGAGGAGGG + Intronic
901517106 1:9755372-9755394 TTGGGGGTGGAGATGGGGGGAGG - Intronic
901638483 1:10681276-10681298 AGGTGGGTCGGGATGGTGGAAGG + Intronic
902252520 1:15163826-15163848 TTGGGGGGGGGGAGGGGGGAGGG + Intronic
902539095 1:17139805-17139827 ATGTGGGTGGGGAAGGCAGGGGG + Intergenic
902625183 1:17672200-17672222 TTAAGGGTGGGGAAGGCGGCTGG - Intronic
903056441 1:20639439-20639461 TTGTCGTGGGGGATGGAGGAAGG + Intronic
903139866 1:21332840-21332862 ATGGGGGTGGGGTGGGCGGATGG + Intronic
903181765 1:21608459-21608481 TGGGGAGTGGGGAGGGCGGAGGG + Intronic
903502173 1:23806864-23806886 TGGTGGGTGGGGAAGACAGATGG - Intronic
903674013 1:25053191-25053213 GTGTGTGTGGGGATGGGGGTGGG - Intergenic
903907626 1:26697268-26697290 TTGAGGGTGGGGGTGGCGGTGGG - Exonic
904906568 1:33901535-33901557 GTGTGGGTGGGGCTGAGGGAGGG + Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905435570 1:37953034-37953056 TTGTTGGTGGGGGGGACGGATGG - Intergenic
905458207 1:38103149-38103171 TTGGGGGTGGGGAAGGGGGTTGG + Intergenic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906510133 1:46405974-46405996 GTGGGTGTGGGGATGGCGGCGGG + Intronic
906715501 1:47965560-47965582 TTGGGGTTGGGGCTGGGGGAGGG - Intronic
907221958 1:52913699-52913721 TGGGGGATGGGGATTGCGGAAGG - Intronic
908224682 1:62044276-62044298 TAGTGGGAGGGGCTGGTGGATGG - Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
909139274 1:71843216-71843238 TTGTGGCAGGGGATGGAGAAAGG + Intronic
909186452 1:72492400-72492422 TGGGGTGTGGGGATGGGGGAGGG + Intergenic
909354754 1:74695892-74695914 TTGGGGGGGGGGGTGGGGGAAGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909614059 1:77587144-77587166 GTGTTGCTGGGGATGGAGGATGG + Intronic
910288449 1:85578457-85578479 TGGAGGTTGGGGATGGGGGACGG - Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910544175 1:88395521-88395543 TGGTGTGTGGGGAAGGCGGAAGG + Intergenic
910864709 1:91777564-91777586 TTGGGGCTGGGGCTGGGGGAAGG - Intronic
911055191 1:93702548-93702570 GTGGGGGTGGGGATGGGGGTTGG + Intronic
911413442 1:97540331-97540353 TGGGGGGTGGGGGTGGCGGCGGG + Intronic
911961578 1:104310477-104310499 TTGTGTGTGGGGCGGGCGGGGGG + Intergenic
912357438 1:109066606-109066628 TTGTGTGTGGGCATGGCAGTGGG + Intronic
912466996 1:109881232-109881254 TTGTGTGTGGCGGTGGGGGAGGG + Intergenic
912470711 1:109904943-109904965 TTGTGGTGGGGGGTGGGGGACGG - Intergenic
912491462 1:110064952-110064974 TTGTGGGTTGGAATGGAGGGAGG + Intronic
913995756 1:143651147-143651169 TTGGGGGTGGGGAAGGAGGGAGG + Intergenic
914148902 1:145022324-145022346 TTGTGTGTGGGGTTGGGGGGTGG - Intronic
914474509 1:148012273-148012295 TTGGGGGTGGGGAGGGAGGGAGG + Intergenic
914492080 1:148158587-148158609 TTGGGGGTGGGGAGGGAGGGAGG + Intergenic
915026865 1:152839047-152839069 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
915472712 1:156135383-156135405 TTGGGGGTGGGGGTGGGGGTGGG + Intronic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
916132189 1:161620754-161620776 TCGTGGGTGGGGAAGGGGGGAGG + Intronic
916176035 1:162039473-162039495 TTTTGTGTGGGGATGGGGCAGGG - Intergenic
917327430 1:173847233-173847255 TCGGCGGTGGGGATGGCGGGGGG + Intronic
917410590 1:174756571-174756593 TTGAGGGTGGGGGTGAGGGATGG + Intronic
917813555 1:178684580-178684602 ATGAGGGTGGGCATGGGGGAGGG + Intergenic
918144069 1:181740514-181740536 GTGGGGGTGGGGATAGTGGAGGG + Intronic
918329029 1:183438503-183438525 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
919641371 1:200048146-200048168 TTGGGGGTGGGGTGGGGGGAAGG - Intronic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920112849 1:203599229-203599251 TTGTGGGTGGTGATGTGGGCAGG - Intergenic
920225897 1:204438906-204438928 TTGTGGGTGGGGAGTGCGTCTGG - Intronic
920282408 1:204854076-204854098 TGGTGGGTGGGGGTGGGGAATGG - Intronic
920550351 1:206855442-206855464 TCAAGGGTGGGGAGGGCGGATGG + Intergenic
920694816 1:208174276-208174298 TTGTGTGTGGGGTTGGGGGCTGG + Intronic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921264880 1:213414103-213414125 CTGGAGGTGGGGATGGGGGAAGG + Intergenic
921358195 1:214306209-214306231 TGGAGGGTGGGGATGGGGGAAGG - Intronic
921563497 1:216687273-216687295 TGGTGGGAGGCGTTGGCGGAAGG + Intronic
921748869 1:218769470-218769492 TTGTGTGTGGGGGTGGGGTAGGG - Intergenic
922324214 1:224513340-224513362 TTGGGGGTGGGGGTGGGGGTGGG + Intronic
922739941 1:228009103-228009125 GTGGTGGTGGGGATGGGGGAGGG - Intronic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
923470441 1:234285754-234285776 TTGTGGGTGAGGATTCCTGAGGG + Intronic
923673532 1:236061967-236061989 TTGTTGGTGGGAATGTCAGATGG + Intronic
923689135 1:236176070-236176092 TTGAGGCTGGGGATGTGGGAGGG + Intronic
924178683 1:241419141-241419163 TTGTGGGCGGGGGTGGCGGAGGG + Intergenic
924510443 1:244725298-244725320 TTGTGGCTGGGGATGAATGAAGG - Intergenic
1063676108 10:8141685-8141707 GTGGGGGTGGGGATGGGGGTGGG - Intergenic
1063680465 10:8182359-8182381 CTGGGGGTGGGGGTGGGGGAAGG + Intergenic
1063830817 10:9950605-9950627 TGGTGGGTAGGGTTGGGGGAGGG - Intergenic
1064503990 10:16009627-16009649 TTGAGGGTGGGGAGGGTGGGAGG + Intergenic
1064736008 10:18382532-18382554 TGGTGGGTGGGGAAGGGAGAAGG - Intronic
1064916034 10:20459820-20459842 TGGTGTGGGGGGATGGGGGAGGG - Intergenic
1065184443 10:23158211-23158233 TTGTGGGGGGTGGTGGGGGAAGG + Intergenic
1066227127 10:33394187-33394209 TTGTAGGTAGGGTTGGAGGAGGG + Intergenic
1066365906 10:34776832-34776854 TTGTGGGGGGGGGGGGCGGGTGG + Intronic
1066481788 10:35803163-35803185 TTCTGGGTGGAGGTGGAGGACGG + Intergenic
1066547697 10:36518792-36518814 AGGTGGGTGGGGAGGTCGGAGGG - Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067741231 10:48897354-48897376 ATGTGGGTGGAGCTGGTGGAGGG + Intronic
1067955111 10:50782599-50782621 TTGGGGTGGGGGATGGGGGAGGG - Intronic
1068723148 10:60269638-60269660 TTGGGGGGGGGGAGGGGGGATGG - Intronic
1068899370 10:62249457-62249479 TTGTGCGTGGGGGTGGGGGTGGG + Intronic
1069796548 10:71056304-71056326 TTGATGGTGGGGAAGGTGGAAGG + Intergenic
1070287974 10:75097673-75097695 TTAGGAGTGGGGATGGCGGAAGG - Intronic
1070383459 10:75902385-75902407 GGGTGGGAGGGGATGGAGGAGGG + Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070794301 10:79207934-79207956 ATGCTGGTGGGGGTGGCGGAAGG - Intronic
1070800410 10:79242023-79242045 AGGTGGGTGGGGCTGGGGGAGGG + Intronic
1071798979 10:89036886-89036908 TTGGGGGTGGGGGTGGGGGTGGG - Intergenic
1073289866 10:102408314-102408336 TTGTGGCTGGGCATGGCTGTGGG - Intronic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1073735206 10:106337089-106337111 TTGTGGGTGGGTCTTCCGGAGGG + Intergenic
1074100799 10:110353721-110353743 TTGGGGGTGAGGTTGGGGGAGGG - Intergenic
1074120246 10:110488618-110488640 TTGGTGGTGGGGATGGAGCAGGG + Intergenic
1074192273 10:111148363-111148385 TAGTGAGGGGGGATGGGGGATGG + Intergenic
1074349528 10:112722360-112722382 TTGGGTGGGGGGATGGGGGAGGG + Intronic
1074755332 10:116620485-116620507 TTGGGGGTGGGGTAGGTGGAGGG - Intergenic
1074842048 10:117364077-117364099 TTGTGTGTGGGAATGGGAGAAGG + Intronic
1075747430 10:124737384-124737406 TGGGGGGTGGGGACGGGGGATGG + Intronic
1075784822 10:125041968-125041990 TTGGGGGTGGGGGTGGGGGAGGG + Intronic
1075926190 10:126253684-126253706 TTGTGGGTTGGGTGGGGGGAGGG + Intronic
1076215281 10:128688248-128688270 ATCTGGGTGGGGAAGTCGGAGGG + Intergenic
1076776993 10:132703387-132703409 TTGTGTGTGAAGATGGCCGAGGG - Intronic
1076838672 10:133033821-133033843 CTCTGGGTGGGGATGGCCGCTGG - Intergenic
1076870040 10:133188676-133188698 TGGGGGGTGGGGACGGCGGGGGG - Intronic
1076873787 10:133206292-133206314 TTGTGGGCGGGGCTGGGGGCAGG - Intronic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077455163 11:2673977-2673999 TTGGGGGTGGGGTGGGGGGAGGG + Intronic
1077710199 11:4528724-4528746 ATGAAGGTGGGGATGGCGAATGG + Intergenic
1077798647 11:5516729-5516751 TGGTGGGTGGGGTAGGAGGAGGG - Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078250133 11:9609956-9609978 GTGGGGGAGGGGATGGCAGATGG + Intergenic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1078703909 11:13719134-13719156 TTGTAGGTGGGCATGTAGGATGG + Intronic
1079079882 11:17406839-17406861 TTGGGAGTGGGGATGGGGGAAGG - Intronic
1079460990 11:20677719-20677741 TTGGGGGTGGGGTTGGGGGAAGG + Intronic
1080024671 11:27600861-27600883 TTGTGGGTGGGGATTGAGGGTGG - Intergenic
1080252042 11:30244300-30244322 TGGTGGGTGGAGAGGGTGGAGGG + Intergenic
1081945072 11:46985084-46985106 TTTTGGGTGGGGTTGGGGGTGGG + Intronic
1082114531 11:48313963-48313985 TTGGGGGTGGGGCTGGTGGGAGG + Intergenic
1082757400 11:57091749-57091771 TTGTTGGTGAGGAAGGAGGAAGG - Intergenic
1082864712 11:57888056-57888078 TTGTGGGGTGGGGGGGCGGAGGG - Intergenic
1083467426 11:62857785-62857807 TTGTGTGTGGGAATGGCAGTCGG + Intronic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083802985 11:65057537-65057559 GTGTGGGTGGGGAAGGGGGGTGG + Intronic
1084315098 11:68341343-68341365 TTCTGGGTGTGGGTGGGGGATGG - Intronic
1084728675 11:71059352-71059374 TTGTTGGTGGTGATGGTCGATGG + Intronic
1085078220 11:73610945-73610967 TTTTGGGTGGGGGTGGGGGTGGG + Intergenic
1085133596 11:74064041-74064063 TTGTGGGGTGGGACGGGGGAGGG - Intronic
1085536986 11:77227732-77227754 TTGGGGGTGGGGTTGGGGGAGGG - Intronic
1085665426 11:78411158-78411180 TTGGGGGGGGGGATGGTGGAAGG + Intronic
1085858285 11:80201154-80201176 ATGTGTGTGAGGATGGGGGAGGG - Intergenic
1085953233 11:81358726-81358748 TTGGGGGTGGGGACAGGGGAGGG + Intergenic
1086035735 11:82412132-82412154 TGGGGTGTGGGGATGGGGGAGGG - Intergenic
1086479398 11:87218084-87218106 TCATTGGTGGGGATGGCAGAGGG + Intronic
1086976941 11:93142943-93142965 TTGGGGGTGGGGTGGGAGGAGGG + Intergenic
1087087248 11:94232280-94232302 TTGTGTGGGGGGTTGGGGGAGGG - Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088530515 11:110803489-110803511 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089500862 11:118930380-118930402 GTGTGGGTGGGGAAAGAGGAGGG + Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090190136 11:124761869-124761891 GTGTGGGGGCGGATGGCGGGGGG - Intronic
1091191886 11:133702506-133702528 TTGCTGGTGGGGATGTCGAATGG - Intergenic
1091668884 12:2438398-2438420 GTGGTGGTGGTGATGGCGGAAGG + Intronic
1091725821 12:2845792-2845814 TCGTGTGTGGGGATGGAGTAAGG + Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092439327 12:8483879-8483901 TTGAGGGGGGGGATGAGGGATGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093013183 12:14129707-14129729 TTGTGCGTGGGGGTGGGGGTAGG - Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094121096 12:26975164-26975186 TTATGGGTGGGGATGGAATAAGG - Intronic
1094467789 12:30771959-30771981 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
1094483020 12:30900084-30900106 GTGTTTGTGGGCATGGCGGAGGG - Intergenic
1096159135 12:49362357-49362379 TTGGGGGTGGGGATGGGAGTGGG + Intergenic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1097328616 12:58308306-58308328 ATGAGGGTGGGGATTGCTGAAGG - Intergenic
1097444376 12:59649943-59649965 TTTTTGGTGGGGAGGGGGGATGG - Intronic
1098057873 12:66527524-66527546 TGGGGTGTGGGGATGGGGGAGGG + Intronic
1098061943 12:66572414-66572436 TTGGGGGTGGGGTGGGAGGAAGG - Intronic
1098374527 12:69799869-69799891 TTTTTGGTGGGGATGGGAGAAGG + Intronic
1098477388 12:70920846-70920868 TTGGGGGTGGGGGTGGGGGTGGG + Intergenic
1098596129 12:72274004-72274026 TTGTGGGTGGGGGTGGAGAACGG - Intronic
1099084005 12:78222267-78222289 TTGTGTGTGTGGTTGGTGGAAGG + Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099809950 12:87568213-87568235 TTGTTGATGGGGATGGAGGTAGG - Intergenic
1099811916 12:87593661-87593683 TTGTGGGGGGGGAAGGGGGGAGG + Intergenic
1099970065 12:89491112-89491134 GGGTGGGTGGGGATGTAGGAGGG - Intronic
1100039468 12:90296287-90296309 TTTTGCCTGGGGATGGGGGATGG - Intergenic
1101075334 12:101123464-101123486 TTGGGGGTGGGGGTGGGGGAAGG - Intronic
1101302825 12:103498869-103498891 TGGGGGGTGGGGTTGGGGGAGGG + Intergenic
1101371052 12:104130913-104130935 TTGGGGGTGGGGAGGGCAGGCGG + Intronic
1101392738 12:104317296-104317318 TTGTGGGTAGGGAAGGCTGCAGG - Intronic
1101674597 12:106906536-106906558 GTGTGGTTGGGGATGGTGGGTGG - Intergenic
1102886832 12:116528569-116528591 TTGGGGGTGGGGATAATGGAGGG - Intergenic
1103179684 12:118899278-118899300 TTGTGGGTTCGGCTGACGGAGGG - Intergenic
1103192517 12:119014375-119014397 TGGGGGGTGGGGATCGGGGAAGG - Intronic
1103253198 12:119518712-119518734 TTGGTGGTGGGGATGGTGGTGGG + Intronic
1104399140 12:128461307-128461329 TTGTGGGTGGGGGAGGCCTATGG + Intronic
1104656083 12:130574963-130574985 CTGGGGGTGGGGGTGGCGGTGGG - Intronic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1106049695 13:26178504-26178526 ATGTGGGCGGGGGTGGGGGAGGG + Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106201493 13:27541347-27541369 TTATGGGAGGGGTTGGGGGAAGG - Intergenic
1106269231 13:28138298-28138320 AAGCGGGTGGGGAAGGCGGAGGG - Intergenic
1106919983 13:34552872-34552894 TTGTGGGTTGGGGTAGGGGAGGG + Intergenic
1107119827 13:36784439-36784461 TTTTTGGTGAGGATGGCAGAAGG + Intergenic
1107451925 13:40517509-40517531 TTGTCGATGGTGATGGCTGAGGG - Intergenic
1107802580 13:44123209-44123231 GTGGGGTTGGGGAGGGCGGAGGG - Intergenic
1108104750 13:46997263-46997285 TAGGGAGTGGGGATGGTGGAGGG - Intergenic
1108127876 13:47264171-47264193 TTGTAGGTGAGGATGGGGAAGGG + Intergenic
1108545811 13:51492222-51492244 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108586102 13:51871114-51871136 GTGTGGGTGGGGATGGTCCAAGG - Intergenic
1110408625 13:75179125-75179147 GTGTGGGTGGGGGGGGCGGCGGG + Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112560165 13:100505855-100505877 TTTTTGGGGGGGATGGGGGAGGG - Intronic
1113082883 13:106535771-106535793 TGTCGGGAGGGGATGGCGGACGG - Intergenic
1113413775 13:110112383-110112405 TGGGGTGTGGGGATGGGGGAGGG + Intergenic
1113733161 13:112657151-112657173 TGGAGGGTGGAGATGGCCGAGGG + Intronic
1113804705 13:113106357-113106379 TCGGGGGTGGGGATGGCGTGTGG + Intronic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114559424 14:23579460-23579482 TGGGTGGTGGGGATGGAGGATGG - Intergenic
1114818255 14:25985596-25985618 TGGGGTGTGGGGATGGGGGATGG + Intergenic
1114908081 14:27155275-27155297 TTGTGGGTGGGAATGCATGATGG - Intergenic
1115063430 14:29223546-29223568 TGGTGGGTGGGGTAGGCAGAAGG - Intergenic
1115319991 14:32069439-32069461 TTGTGGAGGGGGATGGGGTAAGG + Intergenic
1116012667 14:39369158-39369180 TTGTGGGTAGGGCTTGGGGAGGG + Intronic
1116029102 14:39549546-39549568 TTTTGGTGGGGGATGGAGGATGG + Intergenic
1116520398 14:45839777-45839799 TTGGGGGTGGGGATGTTGGGAGG - Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1116855044 14:49944666-49944688 CTGTGGGTGGGAGTGGGGGATGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117411877 14:55457334-55457356 TTGGGGTTGGGGGTGGAGGAGGG + Intergenic
1117527557 14:56624880-56624902 TTGGGGGTGGGGGTGGGGAATGG + Intronic
1117547578 14:56805715-56805737 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1117712709 14:58548960-58548982 TTGTGTGTGGAGATGGGGGTGGG + Intronic
1117929319 14:60823311-60823333 TTTTGAGTGGGGATTGGGGAGGG + Intronic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118098677 14:62569774-62569796 TGGTGGGTGGGGGTGGGGGTGGG + Intergenic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1118931935 14:70250792-70250814 TGGGGGGTGGGGGTGGGGGATGG + Intergenic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119115982 14:72021922-72021944 TTGAGGGTGGGGGTGGCAGAAGG - Intronic
1119548983 14:75494340-75494362 TTGGGGGTGGGGATGGGGCAAGG + Intergenic
1119564523 14:75617059-75617081 TGGTGGGTGGGGACAGTGGATGG + Intronic
1120220241 14:81723469-81723491 TTGTGGGTGGAGGTGGGAGAGGG + Intergenic
1120253178 14:82085227-82085249 TTGTGAGTAGGGATGCCTGAGGG + Intergenic
1120881720 14:89418921-89418943 TTGGGGGTGGGGTTGGGGGCTGG - Intronic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121385313 14:93516449-93516471 TTGGGGGGGGGGGTGGGGGATGG + Intronic
1121402754 14:93695230-93695252 TAGTGGGTGGTGATGGTGGTTGG - Intronic
1121429314 14:93875689-93875711 TTGTGGGTAGTGATGGAGAAAGG + Intergenic
1121535469 14:94687616-94687638 TTGTGAGTGTGGGTGGGGGAAGG - Intergenic
1121893204 14:97618066-97618088 TTGTTGGTGGGAATGGAAGATGG + Intergenic
1122142762 14:99672724-99672746 TTGTGGGAGGGGCTGGCATATGG + Intronic
1122434362 14:101684127-101684149 TTGTGTGTGGGGGTGGGGGGTGG + Intergenic
1122465588 14:101931395-101931417 TTGGGGGTGGGGGTGGGGGCAGG + Intergenic
1122600697 14:102920273-102920295 TAGTGGGAGTGGATGGTGGATGG - Intergenic
1122915882 14:104858800-104858822 TGGTGGGTGGTGATGGAGGGTGG - Intergenic
1122915924 14:104858960-104858982 TGGTGGGTGGTGATGGAGGGTGG - Intergenic
1122916066 14:104859536-104859558 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916141 14:104859846-104859868 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916217 14:104860206-104860228 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916262 14:104860412-104860434 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916321 14:104860657-104860679 TAGTTGGTGGTGATGGAGGATGG - Intergenic
1122983276 14:105201096-105201118 TTGTGGGAGGGGAAGTCCGAAGG + Intergenic
1123781054 15:23628834-23628856 TTGTGGGTGGGGGTAGGGGCGGG + Intronic
1123955471 15:25330037-25330059 TTGAGGGTGGGGGTGGAGGTGGG + Intergenic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124376991 15:29134671-29134693 TTGTGGGTGTGATTGTCGGAAGG + Intronic
1124883307 15:33661541-33661563 TGGTGGGTGAGGCTGGGGGAGGG + Intronic
1125440435 15:39696920-39696942 GTGTGTGTTGGGATGGGGGAAGG + Intronic
1126307919 15:47282219-47282241 TTGTTGGTGGGGATAGGGTAGGG - Intronic
1126586690 15:50295763-50295785 TTGGGGGTGGGTGTGGTGGAGGG - Intronic
1127469821 15:59280974-59280996 TTGGAGGTGAGGATGGGGGAGGG - Intronic
1127538153 15:59910386-59910408 ATCTGGGTGGGGATGGGCGAGGG + Intergenic
1127586596 15:60383634-60383656 TTGTGGTTGTGGTTGGCTGATGG + Intronic
1127951743 15:63814439-63814461 TTGTGGGTGGGGGAGGGGGTTGG + Intronic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128272604 15:66324414-66324436 TTTTGGGTGGCCAAGGCGGAAGG - Intronic
1128576748 15:68781373-68781395 GGGGGGGTGGGGATGGGGGAGGG - Intronic
1129081953 15:73049096-73049118 TTGTGTGTGGGGGTGGGAGAAGG - Intergenic
1129583621 15:76838840-76838862 TTGTGGGTGTGGCTGCCGGAAGG - Intronic
1129631649 15:77266977-77266999 TTGTTGGTGGGGGTGGGGGCAGG + Intronic
1129793464 15:78358202-78358224 TTGTGGCAGGGGATGGAGGTCGG + Intergenic
1130012206 15:80160560-80160582 TGGTGGGGGGAGATGGAGGAGGG + Intronic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130698100 15:86151150-86151172 TTGTGGGGTGGGGTGGGGGAGGG + Intronic
1130768901 15:86904027-86904049 TTGTTGGTGGGGATGGGGGTGGG + Intronic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131144556 15:90002382-90002404 GTGGGGGTGGGGGTGGCGGGCGG + Intronic
1131812055 15:96182871-96182893 TTGAGGGTTGGGATGGGGGCTGG - Intergenic
1132074690 15:98810134-98810156 GTGTGGGGGTGGCTGGCGGAGGG + Intronic
1132588515 16:716341-716363 TTGTTGGTTGGGCTGGGGGAGGG - Intronic
1132671799 16:1105049-1105071 TTGTTGGTGGCGATGGAGAAGGG + Intergenic
1132676357 16:1122930-1122952 CTGTGGGTGGGTATGGAGGTAGG - Intergenic
1132884532 16:2176807-2176829 TGGAGGGTGGGGATGGAGGGTGG - Exonic
1134023626 16:10938698-10938720 TTGAGGGTGGGGAGGAGGGAAGG + Intronic
1134219014 16:12338775-12338797 CTGGGGGTGGGGATGGGGTAGGG - Intronic
1134240576 16:12503098-12503120 CTGGGGGTGGGGGTGGTGGATGG - Intronic
1134296580 16:12951614-12951636 TATTGGCTGGGGATGGCGGTGGG + Intronic
1134795085 16:17027861-17027883 TTCTGGGTGGGGAAGACTGAGGG - Intergenic
1135227476 16:20674443-20674465 TTGGGGGTGGAGAGGGGGGAGGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136240045 16:28937985-28938007 TTGGGGGTCAGGATGGGGGATGG - Intronic
1136372472 16:29844967-29844989 TTGAGGGTAGGGATGGCAGCAGG - Intronic
1136401952 16:30024100-30024122 TGGTGGGTGGGGTTGGAGAAAGG - Intronic
1137485482 16:48887168-48887190 TTGGGGGTGGGGGTGGCGGTGGG - Intergenic
1137614427 16:49838515-49838537 TTTGGGGTGGGGCTGGGGGAAGG - Intronic
1137775750 16:51053153-51053175 TTTTGGGTGGGGGTGGGAGATGG - Intergenic
1138134936 16:54513276-54513298 TGGTAGGTGGGGAAGGCAGATGG - Intergenic
1138166008 16:54802346-54802368 TGGAGGGTGTGGATGGCAGATGG + Intergenic
1138354758 16:56368245-56368267 TTGTGGGTGGGGATGTGAGCTGG - Intronic
1139044694 16:63042345-63042367 TAGTGGGTGGGGTTGGGGGAAGG - Intergenic
1140450980 16:75070650-75070672 TGGTGGGCGGGGTTGGGGGAGGG - Intronic
1140916702 16:79500291-79500313 ATGTTGGTGGAGATGGCAGATGG - Intergenic
1140980414 16:80103795-80103817 AAGTGGGTGGGGGTGGTGGACGG - Intergenic
1141227179 16:82129036-82129058 TTAAGGCTGGGGATGGCAGAGGG + Intergenic
1141492068 16:84380495-84380517 TTGGGGTTGGGGGAGGCGGAGGG + Intronic
1141750621 16:85955604-85955626 GTGGAGGTGGGGATGGCGGGGGG - Intergenic
1141792813 16:86248386-86248408 TGGTGGCTGGAGATGGGGGAGGG - Intergenic
1142205390 16:88780378-88780400 ATGTGGGTGGGGGTAGGGGAAGG + Intronic
1142244756 16:88964968-88964990 TGGTGGGTGGGGTAGGTGGATGG - Intronic
1142735684 17:1897552-1897574 TTGTGAGCGGGGATGGGGGGGGG - Exonic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1142759274 17:2033956-2033978 TTGTGGGAGGGAAAGGGGGAAGG - Intronic
1142905886 17:3041509-3041531 TTGGGGGTGGGGGTGGGGGTGGG + Intergenic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143150331 17:4803868-4803890 ATGTGGCTGGGGATGGTGGCGGG - Intergenic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143495120 17:7308145-7308167 TGATGGGGGGGGTTGGCGGACGG + Intronic
1143648513 17:8248078-8248100 TTGGGGGTGGGGATGGGGGTGGG + Intronic
1144182964 17:12770091-12770113 TGGTGGGTGGAGGTGGAGGAAGG + Intergenic
1144578894 17:16446927-16446949 TTGTGGGTGGGGGTGGGGGGCGG + Intronic
1144584185 17:16477933-16477955 CTGTGGGTGGGAGTGGCGGTGGG + Intronic
1144733124 17:17540133-17540155 CCGTGGGTGGGGATGGGGCAGGG + Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144938997 17:18923947-18923969 TTGTGGGTGATGTTGGAGGAAGG + Exonic
1144965098 17:19072187-19072209 TTGGATGTGGGGGTGGCGGAGGG - Intergenic
1144982869 17:19179993-19180015 TTGGATGTGGGGGTGGCGGAGGG + Intergenic
1144985354 17:19198246-19198268 TTGGATGTGGGGGTGGCGGAGGG - Intergenic
1145014084 17:19385574-19385596 TTGGGGGTGGGGAGGGTGGTGGG + Intronic
1145127544 17:20314682-20314704 TTTTGGGGGGGGAGGGGGGAAGG - Exonic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145247073 17:21276248-21276270 CTGCGGGTGGGGGTGGCGGGTGG - Intergenic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145936698 17:28718304-28718326 TCGGGGGTGAGGATGGTGGAGGG + Intronic
1146008731 17:29178398-29178420 TTGTAGGTGGGGGTGGAGGGTGG - Intronic
1146663956 17:34684190-34684212 GTTGGGGTGGGGATGGGGGAGGG - Intergenic
1146845503 17:36179359-36179381 TTGGGGGTGGGGATGGGGATGGG - Intronic
1146873719 17:36391200-36391222 TTGGGGGTGGGGATGGGGATGGG - Intronic
1146881077 17:36442290-36442312 TTGGGGGTGGGGATGGGGATGGG - Intergenic
1147065670 17:37921671-37921693 TTGGGGGTGGGGATGGGGATGGG + Intergenic
1147168219 17:38604541-38604563 TGGTGGGAGAGGACGGCGGAGGG - Intronic
1147426986 17:40350641-40350663 TTGGGGGATGGGATGGGGGAGGG + Intronic
1147853074 17:43457507-43457529 TTGAGAGTGTGGATGGCAGACGG + Intergenic
1147966337 17:44196230-44196252 GTGTGGGTGGGGAAGGGGGGTGG - Intronic
1147976331 17:44250251-44250273 TTCTGGCTGGGGATGGCCGATGG - Exonic
1148035163 17:44655062-44655084 TTGGAGGTGGGGATGGGGGTAGG - Intergenic
1148082415 17:44974863-44974885 TTGGGGATGGGGATGGAGTAGGG + Intergenic
1148357339 17:46984315-46984337 TTGGGGGTGGGGTTGGGGGTGGG + Intronic
1148550523 17:48547699-48547721 TTGGTGGTGGGGAAGGGGGAGGG + Intergenic
1148560331 17:48602383-48602405 GTGGGGGTGGGGATGGCGGTGGG + Intronic
1148756720 17:49976904-49976926 TCTTGGGTGGGGGTGGGGGATGG - Intergenic
1149287087 17:55176912-55176934 GTGAGGGTGGGGCTGGTGGAAGG - Intergenic
1149521075 17:57318641-57318663 TTGTGGGGGGTGGGGGCGGAGGG + Intronic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1150650760 17:67008589-67008611 TTTTCGGTGGGGATGGGGTAGGG - Intronic
1150834205 17:68550072-68550094 TTGATGGTGGTGATGGGGGAGGG + Intronic
1150993017 17:70282684-70282706 TTGGGGGTGAGAATGGCAGAGGG + Intergenic
1150997199 17:70332326-70332348 TTGTTGGTGGGGTGGGCGGTGGG + Intergenic
1151186849 17:72371126-72371148 TTGTGGGTGGGAGGAGCGGATGG - Intergenic
1151765818 17:76132696-76132718 TCGGGGGTGGGGATGTGGGAAGG - Intergenic
1151956666 17:77383544-77383566 TGGAGAGTGGGGATGGCTGAGGG + Intronic
1152024741 17:77801586-77801608 ATGTGGGTGGGGCTGGGGGTGGG - Intergenic
1152238395 17:79149989-79150011 ATGGGGGTGGGGGTGGGGGATGG + Intronic
1152238417 17:79150028-79150050 TGGGGGGTGGGGGTGGGGGATGG + Intronic
1152241293 17:79162736-79162758 TTGTGGGTGGTGTGGGCGGGCGG + Intronic
1152511525 17:80792891-80792913 GTGTGTGTGGGGAGGGCGCAGGG - Intronic
1152553728 17:81042715-81042737 ATGGGGGTGGGGATGGTGGTGGG + Intronic
1152790337 17:82275223-82275245 TTGTGGCTGGGGCTGGTGGTGGG - Intergenic
1152802915 17:82340105-82340127 TTGGGGGAGGGCATGGGGGAGGG - Intergenic
1152823294 17:82448217-82448239 TGGTGGGTAGCGATGGAGGACGG + Intronic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1154502830 18:15005079-15005101 TGGTGGGAGGGGCTGGCAGATGG + Intergenic
1155464514 18:26120373-26120395 ATATGGGTGGGGGTGGCTGAAGG - Intergenic
1156489401 18:37487376-37487398 TTGGAGGTGGGGAAGGCAGAGGG - Intronic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1156516055 18:37681567-37681589 TTGTGGCTGGGGATTGGTGAGGG + Intergenic
1157040777 18:44036570-44036592 TCCTTGGTGGGGATGGGGGATGG - Intergenic
1157519039 18:48332447-48332469 TTGGGGGTTTGGATGGCGGGAGG + Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157867309 18:51197544-51197566 GGGTGGGTGGGGACGGCGGCGGG + Intronic
1158327107 18:56324197-56324219 TAGGGGGTGGGGGTGGGGGATGG - Intergenic
1158368663 18:56771558-56771580 TTTTGGGGGGGGGTGGGGGAGGG - Intronic
1158424170 18:57324078-57324100 TTGTGTGTGGTGATGGTGGGAGG - Intergenic
1158883467 18:61803649-61803671 TTGGGGGTGGGGGTGGGGAAGGG - Intergenic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1159483357 18:69020533-69020555 TTGTGGGTGGGTATTGTGCATGG + Intronic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1160149821 18:76390590-76390612 TTGTGGGTGGTGCTGGCAGCTGG - Intronic
1160461642 18:79043411-79043433 GTGGGGGTTGGGATGGGGGATGG - Intergenic
1160461667 18:79043459-79043481 GTGAGGGTTGGGATGGGGGATGG - Intergenic
1160714640 19:570684-570706 GGGTGGGTGGGGGGGGCGGAGGG + Intergenic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161448266 19:4329817-4329839 TTGGGGCTGGGGGTGGGGGAGGG - Intronic
1162228296 19:9243220-9243242 GTGTGTGTGGAGATGGCGGGAGG - Intergenic
1162464477 19:10831717-10831739 ATGTGGGTGGTGGTGGCGGGGGG + Exonic
1162777623 19:12989569-12989591 TTGTGTGTGTGGATGAAGGATGG + Intergenic
1162789082 19:13053876-13053898 TTGAGGGTGGGACTGGGGGAGGG - Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163278323 19:16299888-16299910 TTTTTGGTGGGGAGGGCAGAGGG - Intergenic
1163548989 19:17954710-17954732 TTGGGGGTGGGGGTGGCTCAGGG + Intronic
1163576452 19:18113703-18113725 TTGTGGGAGGCCATGGCGGGTGG - Intronic
1164733648 19:30524698-30524720 GTTTGGGTGGGGGTGGAGGAGGG - Intronic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1164926642 19:32135829-32135851 TTGGAGGTGGGGAAGGCTGAGGG + Intergenic
1165098209 19:33421906-33421928 TGGTGGCTGGGGATGGTGAATGG + Intronic
1165709938 19:38003892-38003914 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1166197306 19:41215600-41215622 TTTTGGGGGGGGAGGGGGGATGG + Intergenic
1166568620 19:43779969-43779991 TTGGGGGTGGGGATGGGAAATGG - Intronic
1166690821 19:44820560-44820582 TGCTGGGTGGGGATGGCATAGGG - Intronic
1166762860 19:45235529-45235551 TTTGGGGTGGGGATGGCTGTGGG + Intronic
1166877710 19:45907733-45907755 TTCTAGCTGGGGATGGTGGATGG + Intergenic
1167150109 19:47703463-47703485 TTGTTAGTGGGGAAGGCGGGTGG + Intergenic
1167162840 19:47778940-47778962 ATGTGGGTGGGGTGGGCGTACGG + Intronic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167513762 19:49910715-49910737 GTGGGGGTGGGGGTGGGGGAGGG + Intronic
1167525748 19:49982941-49982963 TGGAGGGTGGGGCTGGGGGATGG - Intronic
1167591502 19:50406818-50406840 GTCTGGGTGGGGATGGAGGTAGG - Intronic
1167752376 19:51388710-51388732 TTGTGGTTGGGGATGGCATTGGG + Exonic
1168438277 19:56340027-56340049 TTTTGGGTTTGGATGGAGGAGGG - Intronic
925020538 2:564572-564594 TGGTTGGTGGGGATGCTGGATGG - Intergenic
925149580 2:1606033-1606055 GTGTGGGAGGGGACGGCCGAGGG + Intergenic
925348747 2:3187540-3187562 TGGTGGGTGGGGAGTGGGGAGGG - Intergenic
925366606 2:3315638-3315660 TAGGGGGTGTGGATGGGGGATGG - Intronic
925860717 2:8172858-8172880 TTCTGGGTGGGGCCGGCGCACGG - Intergenic
926259763 2:11248211-11248233 TTTTGGGGGGGGATGGGGGGAGG + Intronic
926701531 2:15807427-15807449 GTGGGGGTGGGGATGGTGGTAGG - Intergenic
926702610 2:15813758-15813780 GTGGGGGTGGGGATGGGGGTGGG + Intergenic
926765406 2:16319268-16319290 TGGAAGGTGGGGATGGCAGAAGG - Intergenic
926891483 2:17643002-17643024 TTGAGGGTGGGGGTGGGCGAGGG + Intronic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927411474 2:22831079-22831101 TTTTGGGGGGGGGTGGGGGACGG - Intergenic
928101666 2:28440868-28440890 TGTGGGGTGGGGATGGGGGAGGG + Intergenic
928341984 2:30451312-30451334 TTGTTGGTGGGGATGTCAAATGG + Intronic
928342480 2:30456553-30456575 TTGTGGGTGGGGGTGGGCCACGG + Intronic
928860982 2:35856756-35856778 TCGGGGGTGGGGTTGGGGGAGGG - Intergenic
928949614 2:36803110-36803132 TTGTGGGTGTGAATGGCACAGGG - Intronic
929216924 2:39424345-39424367 AGGTGGGAGGGGATGGAGGAAGG + Intronic
929551129 2:42892970-42892992 TTGTCTGTGGGGATGGGTGAGGG + Intergenic
929604209 2:43224659-43224681 TTGTGGGTCTGGATGGCGAGCGG + Exonic
929609161 2:43257095-43257117 TGGTGGGTGGAGAGGGGGGATGG + Intronic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
930024864 2:47023873-47023895 TAGGGGCTGGGGATGGTGGAAGG - Intronic
930164121 2:48187118-48187140 TGGTGGGTTGGGATGGGGAAGGG - Intergenic
930198180 2:48529734-48529756 CTCTGGGTGGGGATGATGGAGGG - Intronic
931147514 2:59535247-59535269 CTGTGGGTGGGGTTGGAGGCTGG + Intergenic
931278428 2:60765066-60765088 TTGTGTGGGGGAATGGGGGAAGG + Intronic
931726535 2:65117053-65117075 TGGTGGGTGGGGGTGGGGGAAGG - Intronic
932618433 2:73251098-73251120 TTGGGGCTTGGGATGGAGGAAGG + Intronic
932647905 2:73523760-73523782 TTTTTGGTGGGGAAGGGGGAAGG - Intronic
933723062 2:85410393-85410415 TGGTGGGTGGGGCTGGTGGTTGG - Exonic
933773151 2:85756182-85756204 GTGGGGGTGGGGGTGGGGGACGG + Intronic
934033235 2:88066448-88066470 TTGGGGGTGGGGGTGACGGCGGG - Intergenic
934636727 2:95996231-95996253 TGGAGGGTGGGGCTGGAGGATGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934781216 2:96970950-96970972 CTGGGGGTGGGGATGGGGGCAGG - Intronic
934796924 2:97109193-97109215 TGGAGGGTGGGGCTGGAGGATGG + Intergenic
934836489 2:97594238-97594260 TGGAGGGTGGGGCTGGAGGACGG - Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935720811 2:105977343-105977365 TTGTGGGTGGTGCTGGCTCAGGG - Intergenic
935794778 2:106630625-106630647 TTACGGGAGGGGATGGCAGAGGG - Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
935954586 2:108363044-108363066 CTGTGGGTGGGGTTTGGGGATGG + Intergenic
936151766 2:110025675-110025697 TGTTTGGTGGGGATGGCTGAGGG - Intergenic
936167721 2:110138171-110138193 TTGTGGGGTGGGGTGGGGGAGGG + Intronic
936192908 2:110345694-110345716 TGTTTGGTGGGGATGGCTGAGGG + Intergenic
936484363 2:112913893-112913915 GCGAGGGTGGGGATGGGGGATGG + Intronic
936545315 2:113387222-113387244 TGGAGGGTGGGGCTGGAGGACGG + Intergenic
936608969 2:113983042-113983064 TTGGGGGTGGGAATGGCTGGAGG - Intergenic
936644624 2:114354819-114354841 ATGTGTGTGGGGTTGGTGGATGG - Intergenic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
938223606 2:129595350-129595372 TTGTTGGTGGGGATGTAGAATGG - Intergenic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
938500933 2:131831083-131831105 CTGGGGGTGGGCAAGGCGGAGGG + Intergenic
938501997 2:131835249-131835271 TGGTGGGAGGGGCTGGCAGATGG + Intergenic
939693237 2:145292155-145292177 ATGGGGGTGGGGGCGGCGGAGGG - Intergenic
939712614 2:145541765-145541787 GGGTGGTTGGGGATGGGGGATGG + Intergenic
940598342 2:155823265-155823287 TGGTGGGAGGGGGTGGGGGATGG + Intergenic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941008719 2:160273706-160273728 TTGGGGATGGGGGTGGGGGAGGG - Exonic
941008723 2:160273712-160273734 TTGGGGTTGGGGATGGGGGTGGG - Exonic
941162297 2:162049474-162049496 TTGGGGGTGGGGTTGGGGGTGGG + Intronic
941211966 2:162651357-162651379 TTGGGGGTGGGGTGGGAGGAGGG - Intronic
942452016 2:176114346-176114368 TTGGGGGTGGGGGTTGAGGATGG - Intronic
942505199 2:176634550-176634572 CTGGGGGTGGGGATGGTTGAAGG + Intergenic
943095633 2:183425799-183425821 TTGGGTGGGGGGATGGGGGAGGG - Intergenic
943623055 2:190170578-190170600 TCCTGGTTGGGGATGGGGGATGG - Intronic
943745435 2:191457014-191457036 TGGTGGGTGGGGGTGGGGGAGGG - Intergenic
944666975 2:201966988-201967010 TTGGGGGTGGGGAGGGAGGTTGG - Intergenic
944755649 2:202759363-202759385 TTTTTTGTGGGGATGGTGGAAGG - Intronic
944926075 2:204465895-204465917 TTGGGGGTGGGGCTAGGGGAGGG + Intergenic
946418261 2:219551389-219551411 TAGGAGGTGGGGATGGGGGAGGG - Intronic
946431961 2:219630919-219630941 GTGTGGGTGGGGTGGGGGGAAGG + Intronic
946796858 2:223363502-223363524 TGGTGGGTGGGGATGGTTAATGG + Intergenic
947531892 2:230914642-230914664 TTGTGGGTGGGGGAGGGGAACGG + Intronic
947727919 2:232411096-232411118 TAGAGGGTGGGGGTGGTGGAGGG + Intergenic
948793055 2:240389012-240389034 TGGTGGGTGGGGCTGGCAGGAGG + Intergenic
1168771809 20:420688-420710 ATGGGGGTGGGGCTGGGGGATGG - Intronic
1169083815 20:2815030-2815052 TGCTGGGTGGGTATGGGGGAGGG + Exonic
1169356696 20:4912827-4912849 TTGTGGGAGGGGATGGCGGTGGG + Intronic
1169391953 20:5197903-5197925 TCGATGGTGGGGGTGGCGGAAGG + Intergenic
1169840339 20:9928839-9928861 TTGGGAGTGTGGATGGAGGATGG + Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170792064 20:19516603-19516625 ATGTGGGGTGGGATGGCTGAAGG + Intronic
1171035573 20:21710069-21710091 TTGTGGGTGGTGGTGGTGGTGGG + Intronic
1171913661 20:30991304-30991326 TTTTGGGGGGGGAGGGGGGAGGG + Intergenic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1172807688 20:37624376-37624398 TTGGGGGTGGGGAGGGAGGCTGG - Intergenic
1172843112 20:37913877-37913899 TTCTGAGTGGGGAGGGCGCACGG + Intronic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173471077 20:43324119-43324141 TGGGGGGTGGGGAAGGGGGAGGG - Intergenic
1173551178 20:43934069-43934091 GTGAGGGTGGGGATGGGGGGAGG + Intronic
1173647354 20:44641691-44641713 TTGTGGGTGGGACTGGTGGGGGG + Intronic
1173985552 20:47259002-47259024 TGGTGGGTGGGCATGGTGGTGGG - Intronic
1174054882 20:47791655-47791677 GTGTGGGTGGGGAGTGGGGAGGG - Intergenic
1174196558 20:48776430-48776452 CTGTGGGAGGGGATGGCAGCTGG + Intronic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1174772718 20:53316185-53316207 TTGTGAGTGGGGATGACTGAGGG - Intronic
1174980694 20:55391371-55391393 TGGTGGGTGGGGTTGGGGGAGGG - Intergenic
1175050028 20:56146685-56146707 GTGTGGGGGGGGATGGGGGGAGG - Intergenic
1175158403 20:56989956-56989978 TTGTGTGTGGGGGGGGCGGGGGG + Intergenic
1175291955 20:57881897-57881919 CTGTGGGGAGGGATAGCGGAGGG - Intergenic
1175554997 20:59845318-59845340 TTGTGGCGGGGGACGGGGGAAGG - Intronic
1175718109 20:61268943-61268965 TTGTGGGTGGGGACAGCCGCTGG + Intronic
1176139490 20:63538721-63538743 TGGGGGGTGGGGAATGCGGAAGG + Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1177148673 21:17432933-17432955 TTGGGGCGGGGGATGGGGGATGG - Intergenic
1177204383 21:17994736-17994758 GTGTGGGTGCCGATGGCAGAAGG + Intronic
1177636566 21:23795088-23795110 TGGGGGGTGGGGGTGGGGGAGGG - Intergenic
1178478970 21:32962592-32962614 GTGGGGGTGGGGATGGAGGTCGG + Intergenic
1178486138 21:33021076-33021098 TGGGGGGTGGGGGTGGGGGATGG - Intergenic
1178490998 21:33051745-33051767 TTGGGGGTGGGGGTGAGGGAAGG - Intergenic
1178555384 21:33586395-33586417 TTGGGGGTAGGGGTGGTGGAGGG + Intronic
1178981244 21:37267204-37267226 CTGGGGGTGGGGATGGAGGTGGG - Intronic
1179426438 21:41283020-41283042 GTGTGGTTCAGGATGGCGGATGG - Intergenic
1179719411 21:43306784-43306806 TTCTGGGTGGGGCTGGTGGAGGG - Intergenic
1179792658 21:43764478-43764500 GTGGGGGTGGGGACGGCAGATGG + Intergenic
1179800143 21:43807908-43807930 GTGTGTGTGGTGGTGGCGGAGGG + Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180121835 21:45757128-45757150 ATGTGGGTGGGAATGTCGAATGG - Intronic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1180661691 22:17473058-17473080 TTGAGGGTGGAGAAGGTGGAAGG + Intronic
1180700521 22:17779055-17779077 GTGTTGGTGGGGATGGAGCAGGG - Intergenic
1181007196 22:20019518-20019540 CTGGGGGTGGGGATGGCCCAAGG + Intronic
1181372492 22:22429387-22429409 TGGTGGGTGGGGATGAGGTAGGG + Intergenic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181387834 22:22558178-22558200 TGGGGGGTCGGGATGGGGGAAGG + Intronic
1181498517 22:23302079-23302101 ATGAGGGTGGGGGTGGCGGTGGG - Intronic
1181528168 22:23501909-23501931 TGGTGGGTGGAGATGGCGGGTGG - Intergenic
1181528177 22:23501935-23501957 TGGCGGGTGGAGATGGCGGGTGG - Intergenic
1181636692 22:24177914-24177936 GTGTGGGTGAGGATGGCATAGGG + Intronic
1182075571 22:27493203-27493225 ATGTGGGTGGGGGTGGGGGGTGG + Intergenic
1182105391 22:27685557-27685579 TTGAAGGTGGGGTTGCCGGAAGG - Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182345232 22:29658614-29658636 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1182559746 22:31150408-31150430 TTGGGGGTGGGGGTGGGGGCGGG - Intergenic
1182772185 22:32803617-32803639 ATGTGGGTGGAGGTGGAGGAGGG - Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183142114 22:35952091-35952113 TTTTGGCTGGGGATGGTGAAGGG - Intronic
1184194290 22:42916401-42916423 GTGGGGGTGGGGATGGGGGGTGG + Intronic
1184377798 22:44125467-44125489 TGGTGGGTGGGGGTTGGGGAAGG + Intronic
1184468636 22:44683416-44683438 TTCTGGGTGTGGGTGGCAGATGG - Intronic
1184496602 22:44846012-44846034 TTGGTGGTGGGGATGGGGGGGGG - Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1185215507 22:49597889-49597911 TAGAGGGTGGGGTTGGAGGATGG - Intronic
1185411175 22:50683795-50683817 TGGTGGAGGGGGATGGTGGAGGG + Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
950047395 3:9957635-9957657 TTGTGGGAGGGGAGGGAGCAGGG - Intergenic
950189467 3:10966628-10966650 TTGTGTGTGGGGATAGCAGGGGG - Intergenic
950491742 3:13309427-13309449 TTGTGGGTTGTGGTGGGGGAAGG + Intergenic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951368858 3:21818180-21818202 ATGGGGGTGGGGATGGGGGAGGG + Intronic
951580931 3:24161819-24161841 GTGGGGGTGGGGGTGGGGGAGGG - Intronic
951843670 3:27062441-27062463 TTTTGGGTGGTGATGCTGGATGG - Intergenic
952069652 3:29618585-29618607 TTGTGGGTGGGGATAGGTAATGG + Intronic
952816339 3:37451261-37451283 CTGGGGGTGGGGATGGGGGTAGG + Intergenic
952969281 3:38640826-38640848 TTGGGGGTGGGGCTGGGGGCGGG + Intronic
953081305 3:39621071-39621093 TGGGAGGTGGGGATGGCGGTGGG + Intergenic
953830894 3:46296938-46296960 CTGTATGTGGGGATGGCGGGTGG - Intergenic
953933022 3:47015969-47015991 TTTTGGGGGGGGGTGGGGGAGGG - Intergenic
954317195 3:49807529-49807551 TTGGGGGTGGGGATGGCTGACGG + Intronic
954397553 3:50300948-50300970 ATGAGGGTGGGGGTGGGGGAGGG - Intronic
954572494 3:51653781-51653803 TGGTGTGGGGGGATGGGGGAGGG + Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
955408449 3:58640719-58640741 TTGTGGGAGGAGGTGGCCGAAGG + Intronic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957257759 3:77860471-77860493 TTGTGGGGTGGGGTGGGGGAGGG + Intergenic
957792036 3:84953758-84953780 TTGGGGGTGGGGGTGGGGGGTGG - Intergenic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
959991750 3:112638828-112638850 TTGTGGCTGGGGCAGGAGGAAGG + Exonic
960273152 3:115696572-115696594 TTGTGGGGGGGGGGGGCGGTGGG - Intronic
960973154 3:123153658-123153680 TTGTGGGGGGTGATGGGGGGTGG - Intronic
961125837 3:124416677-124416699 TGGAGGGTGGGGATGGGGTAAGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961862585 3:129928634-129928656 GTCTTGGTGGGGGTGGCGGATGG - Intergenic
962714710 3:138116000-138116022 TGGTGGGTGGGGGCTGCGGAGGG - Intergenic
962870539 3:139487186-139487208 TGGGGTGTGGGGATGGGGGAGGG - Intergenic
963202349 3:142598321-142598343 TTGTGGGAGGGAGTGGGGGAAGG + Intronic
963263711 3:143218137-143218159 TTAGGGGTGGGGAGGGAGGAGGG + Intergenic
963447589 3:145434319-145434341 ATGTGTGTGGGGGTGGGGGAGGG + Intergenic
963579561 3:147108475-147108497 TTGTGGGTGGGGGAGGGGGGAGG - Intergenic
963740908 3:149079879-149079901 TTGTGGCTGGGCATGGGGCATGG - Intronic
963853050 3:150226773-150226795 GTGGGGGTGGGGGTGGGGGATGG - Intergenic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
964957450 3:162379194-162379216 TGGTGTGGGGGGATGGGGGAGGG - Intergenic
965210354 3:165779006-165779028 TTGTGGGTGGGGAGGGTGACTGG - Intronic
965271637 3:166623421-166623443 CTGGGGGTGGGGGTGGGGGAGGG + Intergenic
965925729 3:173977319-173977341 ATGGGAGTGGGGATGGGGGAAGG + Intronic
966234219 3:177682823-177682845 TTGGGGGTGGGGAAGGCAGAAGG - Intergenic
967157307 3:186705382-186705404 TTGGGGATGGGGATAGGGGAAGG - Intergenic
967404338 3:189099397-189099419 TTGTGGGTGGGAAGGGGGGCAGG + Intronic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968558857 4:1265704-1265726 TGGTGGGTGGGGGTGGGGGTCGG - Intergenic
968727110 4:2252819-2252841 TCCAGGGTGGGGATGGGGGATGG - Intronic
968768073 4:2485049-2485071 ATGTGGGTGGGGTGGGCGGAAGG - Intronic
969062946 4:4453342-4453364 TTGAGGGTGGGGGTTGCTGAAGG - Intronic
969276910 4:6141995-6142017 CAGTGGGTGGGGGTGGGGGATGG - Intronic
969345394 4:6566769-6566791 TTGTGGCTAGGGTTGGGGGAGGG - Intergenic
969367226 4:6703505-6703527 TTGTGGGTAGGTTTGGGGGAAGG - Intergenic
969441594 4:7220263-7220285 TTGGGGGAGGGGGTGGGGGACGG + Intronic
969703816 4:8781550-8781572 TTGTGGATGGGGCTGGCGGAAGG - Intergenic
969879117 4:10158263-10158285 TGGTGGGTGGGGGTGGGGGTGGG - Intergenic
970846453 4:20544024-20544046 TGGTGTGGGGGGATGGGGGAGGG + Intronic
971056901 4:22923282-22923304 TTTTGTGTGGGGTTGGAGGAGGG - Intergenic
971078522 4:23178987-23179009 TCGAGGGTGGGGTTGGGGGAGGG + Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
972026318 4:34382561-34382583 GTGAGGGTGGGGGTGGGGGAGGG + Intergenic
972463606 4:39330079-39330101 GTCTTGGTGGGGATGGGGGACGG + Intronic
972745503 4:41928279-41928301 GTGTGTGTGGGGATGGGGGTGGG + Intergenic
973664035 4:53139280-53139302 TTGTGGGGCGGGGTGGCGGCCGG - Intronic
973756056 4:54074568-54074590 TTGTAGGTGGAGATGGCAGTGGG - Intronic
973841275 4:54863568-54863590 TGGTGGGTGGGGGTGGGGGTTGG - Intergenic
974287370 4:59886302-59886324 GTGGGGGTGGGGGTGGGGGAAGG - Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974483128 4:62471615-62471637 TTGTGGGTGGGGTGAGGGGAGGG - Intergenic
974858993 4:67496884-67496906 TTGGGGGTGGGGGTGGGGGTGGG - Intronic
975530437 4:75394567-75394589 TGGTGGGTAGGGATGGAGAACGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976100788 4:81561050-81561072 TTGGGGGTGGGGTTGGGGGAGGG - Intronic
976269071 4:83212435-83212457 GTGTGGGTGGGGGTGGTGGAGGG + Intergenic
976460224 4:85302485-85302507 TCCTGGGTGGGGATGGCTAAAGG + Intergenic
976525814 4:86086270-86086292 TGGTGGGTGGGGATGGTTAACGG + Intronic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
979312539 4:119220865-119220887 ATGTGGGTGTGGTTGGTGGATGG + Intronic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980994364 4:139766174-139766196 TGGGGGGTGGGGGTGGGGGATGG + Intronic
981555670 4:145990948-145990970 TTGAGGGTGGAGGTGGCAGATGG + Intergenic
981765348 4:148242288-148242310 TTGCTGGTGGGGATGGAGGAAGG + Intronic
982598198 4:157412715-157412737 TTGGGGGTGGGGCTGGTGGGAGG - Intergenic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
983571020 4:169208193-169208215 GTGGGGGTGGGGATGAAGGAGGG - Intronic
984368279 4:178827444-178827466 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
985196502 4:187435926-187435948 TGGTGGGTGGGGGTGGGGTATGG + Intergenic
985203128 4:187505312-187505334 TTCTGGGTGGGGAAGGCCGCTGG - Intergenic
985397351 4:189558016-189558038 ATTTGGGTGGGGATGGTGGAAGG - Intergenic
985641458 5:1065266-1065288 TTGTGGGTAGGCATGGCTGGCGG - Exonic
986591410 5:9374789-9374811 TTGTGGGTGGGGGTGGGTGCGGG - Intronic
986623603 5:9702831-9702853 TTGGGGGTGGGGGTGTCAGATGG + Intronic
986717381 5:10533837-10533859 TTCTGGGTGGGAATGGTGGGAGG + Intergenic
986953654 5:13123295-13123317 TTGTGGGATGGGTTGGAGGAAGG + Intergenic
987314576 5:16712115-16712137 GTGGGGGTGGGGATGGGGAAGGG + Intronic
987717237 5:21587385-21587407 TTGTGGGTGGGGGTGGTTGTAGG + Intergenic
989578442 5:43010303-43010325 GTGAGGGTGGGGATGTTGGAGGG - Intergenic
989651735 5:43697712-43697734 ATGTGGATGGTGATGGTGGAAGG + Intronic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
990192831 5:53279831-53279853 TGGGGGGTGGGGATGGGGGAGGG - Intergenic
990287213 5:54311662-54311684 CTGAGGGTGGGGATGGGGGGGGG - Intergenic
990350227 5:54908741-54908763 GTTTGGGTGGGGACGGTGGATGG - Intergenic
990399871 5:55427774-55427796 TTGGGGGGGGGGATGTGGGAGGG + Intronic
991295404 5:65074961-65074983 ATGTGGGCTGGGATGGCTGAGGG + Intergenic
992342531 5:75840127-75840149 TTGTGGGTTGGGGAGGGGGAGGG - Intergenic
992484429 5:77181092-77181114 GTGAGGGTGGGGATGGTGGTGGG - Intergenic
992634722 5:78716504-78716526 TTGTGTGTGTGGATGGGGGGTGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994163697 5:96585236-96585258 TTGTGAGTGGGAATGGAGAAGGG - Intronic
994566193 5:101448036-101448058 TGGGGTGGGGGGATGGCGGAGGG + Intergenic
994616486 5:102110978-102111000 TTGTGGTGGGGGGTGGGGGAAGG - Intergenic
994683878 5:102924870-102924892 TGGTGGGAGGTGATGGGGGAAGG - Intronic
995022458 5:107381742-107381764 ATGTTGGTGGGGGTGGGGGAAGG + Intronic
995841329 5:116446278-116446300 GTGTGTGTGGGGGTGGGGGATGG + Exonic
996542023 5:124640397-124640419 TGGTGGGTGGGGAAGGGGCAGGG - Intronic
996909866 5:128643450-128643472 GTGTGCGTGGGGCTGGGGGAGGG + Intronic
997046257 5:130321657-130321679 TTGAGGGTGGAGGTGGAGGAGGG + Intergenic
997698642 5:135880932-135880954 GTGTGGGTGGGGGTGGGGGATGG - Intronic
998233844 5:140380790-140380812 GTGGGGGTGGGGATGGGGCAAGG + Intergenic
999966896 5:156819833-156819855 TTGAGGATGGGCATGGAGGAAGG + Intergenic
1000304515 5:159983325-159983347 TTCCGGGTGGGGATGGGGGATGG - Intergenic
1000832168 5:166116428-166116450 TTGTGGGTGGGAATGGAAAATGG - Intergenic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001712083 5:173787049-173787071 TTGTGCTTGGGGATGGGGAAGGG - Intergenic
1001713013 5:173793109-173793131 TTGTGGGTGGGGGTGGGTGGGGG + Intergenic
1001748896 5:174112825-174112847 GGGTGGGTGGGGTTGGGGGAGGG - Intronic
1001866591 5:175111418-175111440 TTGAGGTTGGGGATGGAGGGTGG - Intergenic
1002355873 5:178627989-178628011 TCGTGGGGGGGGACGGCGGGCGG + Intronic
1002442389 5:179271147-179271169 TTGGGGGTGGGGGTGGAGGGAGG + Intronic
1002466948 5:179412670-179412692 TGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002617685 5:180465846-180465868 TTCTGGGTGGGGAAGGTGAAAGG - Intergenic
1003085194 6:3054781-3054803 TTGGGGGTTGGGAGGGCGGTGGG + Intergenic
1003255877 6:4474506-4474528 TTGTGGGTGGAGATGTCAGCAGG - Intergenic
1003923502 6:10855679-10855701 TTGAGGGTGGGGATGGGGGTGGG - Intronic
1003923521 6:10855731-10855753 TTGAGGGTGGGGGTGTGGGAGGG - Intronic
1004367161 6:15022051-15022073 TCGTGGGCGGTGATGGAGGAAGG - Intergenic
1004810331 6:19252932-19252954 TTGGGTGGGGGGATGGGGGAGGG + Intergenic
1005161557 6:22870293-22870315 TTGGGTGTGGGGAGGGGGGAGGG + Intergenic
1005387918 6:25304272-25304294 GTGAGGGTGGGGATAGAGGATGG + Intronic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005898229 6:30196126-30196148 TTGTGGTTGGGGGTGGCTGAGGG - Intronic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006075423 6:31529366-31529388 TTGTGGGTGGGGGTGGGGTGAGG - Intronic
1006097411 6:31664769-31664791 TTGTTGGTGAGGATGGGGGTGGG - Intronic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006606714 6:35262666-35262688 ATGTGGCTGAGGATGGCAGAAGG - Intronic
1006980126 6:38140974-38140996 GTGTGGGTGGGGGTGGGGGCGGG - Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007282131 6:40720520-40720542 CTGTGGGTGGAGTTGGGGGAGGG - Intergenic
1007367649 6:41406198-41406220 TTGAGGGTGGGGGTGGGGGGTGG + Intergenic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008732488 6:54499809-54499831 TTGTTGGGGGGAATGGGGGAGGG - Intergenic
1008760672 6:54848104-54848126 GTGGGGGTGGGGGTGGCGGTGGG + Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009712038 6:67336206-67336228 TTGGGTGTGGGGATGGTGGTGGG + Intergenic
1010196013 6:73241077-73241099 TTGTGGGTGGGGGTGGGGGTGGG - Intronic
1010562105 6:77363120-77363142 TTGGGGGTGGGGGTGGGGGCAGG + Intergenic
1011511211 6:88103355-88103377 ATGTGGGTGGGGAAGCAGGATGG - Intergenic
1011718249 6:90129060-90129082 TGTGGGGTGGGGATGGGGGAAGG + Intronic
1012051422 6:94349845-94349867 TTTTGGGTGGGGATGGGATAAGG + Intergenic
1012380325 6:98613252-98613274 TTGTGGGGTGGGGGGGCGGAGGG - Intergenic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1013952836 6:115805650-115805672 TGTTGGGTGGGAATGGAGGAGGG + Intergenic
1014617781 6:123625470-123625492 TTGTTGGTGGGGATGGTTAATGG + Intronic
1015037208 6:128670132-128670154 CTGAGGGTGGTGATGGTGGATGG + Intergenic
1015594086 6:134849624-134849646 TTGTTGGGGGGGAGGGGGGAGGG + Intergenic
1015994174 6:138980673-138980695 TTGTGGGTGGGGCGGGGGGGGGG + Intronic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1016386579 6:143536364-143536386 GTGTGGGTGCGGATGGGGAAGGG + Intergenic
1016922206 6:149306815-149306837 TTGTGGGTGGGGATGGGGAGAGG + Intronic
1017146650 6:151240767-151240789 TTGGGGGTGGGGGTGGGGGTGGG + Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1017981520 6:159404486-159404508 GTGGAGGTGGGGATGGGGGATGG + Intergenic
1018137645 6:160793011-160793033 ATGTGTGTGGGGAGGACGGATGG - Intergenic
1018163692 6:161073768-161073790 TTGTGTGTGTGTATTGCGGAGGG + Intronic
1018785809 6:167107039-167107061 TAATGTGTGGGGATGGTGGAGGG + Intergenic
1018930964 6:168239989-168240011 TTGTGGCTGGGGGCTGCGGAGGG + Intergenic
1019186132 6:170221347-170221369 TGGGGGGTGGGGTTGTCGGAGGG + Intergenic
1019351057 7:554130-554152 ATGTGGGGGCAGATGGCGGAGGG + Intronic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019478689 7:1256165-1256187 GTGTGCGTGGGGAAGGCGGGAGG - Intergenic
1019498641 7:1353126-1353148 CAGTGGGTGGGGAAGGCGGTGGG - Intergenic
1020092891 7:5351180-5351202 TTCTGGGTGGGGAGGAGGGAGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021427355 7:20516756-20516778 TTGTGGGTGGGGGTTGGGGGAGG + Intergenic
1021740932 7:23684501-23684523 TTGTTGGTGAGGATGATGGAGGG + Exonic
1022422078 7:30232777-30232799 TTGGGGGTGGTGAGGGCAGAAGG + Intergenic
1022495849 7:30852611-30852633 TTGTGGGAGGGGGTGGGGCAGGG + Intronic
1022505875 7:30908417-30908439 TTGGGGGTGGGGAGGGAGGGAGG - Intergenic
1022622303 7:31997372-31997394 TTGTGAGTGGGGGTGAGGGATGG - Intronic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1023039042 7:36156161-36156183 TTGTTGGTGAGGCTGGCGGCGGG + Intronic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1025149576 7:56538225-56538247 TTGGGATTGGGGATTGCGGATGG + Intergenic
1026255833 7:68710278-68710300 TTGAGGGTAGGGTTGGGGGAGGG + Intergenic
1026468635 7:70675783-70675805 TTGTGGGAGGAGTTGCCGGAGGG + Intronic
1027015539 7:74777348-74777370 GTGAGTGTGGGGATGGAGGAGGG + Intronic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1028332482 7:89611673-89611695 CTGGGGGTGGGGCTGGGGGAGGG + Intergenic
1028382349 7:90212819-90212841 TTGGGGGTGGGGGTGGGGGTGGG - Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028634532 7:92972277-92972299 TGGAGGTTGGGGGTGGCGGAGGG + Intergenic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1029098488 7:98107475-98107497 TTGGGGCTGGGGAGGGCGGCGGG + Intronic
1029433260 7:100546167-100546189 TTTTTGGTGGGGGTGGCGGGCGG - Intronic
1030000525 7:105054974-105054996 TTGTGAGTGAGGATGATGGAAGG + Intronic
1030547562 7:110916607-110916629 ATCTGTGTGGGGATGGAGGAAGG - Intronic
1030709761 7:112736455-112736477 TTGGGTGTGGGGAGGGGGGAAGG - Intergenic
1031464267 7:122089129-122089151 TGGAGGGTGGTGATGGCAGAGGG + Intronic
1031466567 7:122119547-122119569 TTGGGGGTGAGGATGGGGAATGG - Intronic
1031979787 7:128117049-128117071 TTGTGGCTGGCGAGGCCGGACGG - Intergenic
1032485696 7:132285920-132285942 TTGTGGGTGGGGGTGGTGGGTGG - Intronic
1032548338 7:132762024-132762046 TTGGGGCTGGGGATGGGGAAGGG + Intergenic
1032743220 7:134760297-134760319 TTGAGGGTGGGGTTTGGGGATGG + Intronic
1032805253 7:135347869-135347891 TTTGGGGTGGGGGTGGCAGAGGG - Intergenic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1033840669 7:145369960-145369982 TTGTGGGTGGGGAAGGGGTCTGG + Intergenic
1034129979 7:148706670-148706692 TTGGGGGTGGGGGCGGCGGGGGG + Intronic
1034162288 7:149002418-149002440 TTGGGGGTGGGGATGGGGGTGGG + Intergenic
1034298339 7:149993662-149993684 CTGTGGGTGGGGATTGCAAAGGG - Intergenic
1034308629 7:150067793-150067815 TGGTGGGGGGGGATGGGGGATGG + Intergenic
1034469542 7:151248117-151248139 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1034527548 7:151675381-151675403 CTGTGGGTGGGGCTGCCGGGTGG - Intronic
1034807675 7:154103120-154103142 CTGTGGGTGGGGATTGCAAAGGG + Intronic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035540214 8:429139-429161 ATGTTGGTGGGAATGGAGGATGG - Intronic
1036125380 8:6057422-6057444 ATGGGGGTGGTGATGGGGGATGG - Intergenic
1036257709 8:7218818-7218840 GTGGGGGTGGGGGTGGAGGATGG - Intergenic
1036309758 8:7677414-7677436 GTGGGGGTGGGGGTGGAGGATGG - Intergenic
1036359778 8:8068705-8068727 GTGGGGGTGGGGGTGGAGGATGG + Intergenic
1036388139 8:8299490-8299512 TCGTGTGTGGGGTTGGGGGAAGG - Intergenic
1036524483 8:9522004-9522026 TTTTGGGGGGGGTTGGAGGAGGG + Intergenic
1036891182 8:12598265-12598287 GTGGGGGTGGGGGTGGAGGATGG - Intergenic
1037121582 8:15294126-15294148 TTGGGGGTGGGGGTGGGGGAGGG + Intergenic
1037258510 8:16981742-16981764 TTATGGGTGCAGATGGGGGATGG - Intergenic
1037551788 8:19981384-19981406 TCGTTGGTGGGGATGCCAGATGG + Intergenic
1037785348 8:21899707-21899729 TAGGAGGTGGGGATGGAGGAGGG - Intergenic
1037811755 8:22090485-22090507 TTTTGACTGGGGATGGGGGAAGG - Intronic
1038319636 8:26514693-26514715 TTGGGGGTGGAGACGGAGGACGG + Intronic
1038567141 8:28629147-28629169 TGGAGGGTGGGGGTGGGGGAGGG - Intronic
1040102338 8:43516717-43516739 TGGTGGGTGAGGGTGGAGGATGG + Intergenic
1040428009 8:47308628-47308650 TTGTGGGTGGGGGTGGGGATGGG + Intronic
1040428013 8:47308634-47308656 GTGGGGGTGGGGATGGGGGTGGG + Intronic
1040438464 8:47416769-47416791 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1040446399 8:47499786-47499808 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1040859697 8:51986262-51986284 TTGGCGGTGGGGATGGGGGTTGG + Intergenic
1041041249 8:53848535-53848557 TTGGGGGTGGGGTTGGGGGAGGG - Intergenic
1041274815 8:56146292-56146314 TTGAGTGGGGGGAGGGCGGAGGG - Intergenic
1041425150 8:57712694-57712716 TTCTGGGTGTGGATGGTTGAGGG - Intergenic
1041762250 8:61379383-61379405 TTGGTGGTGGAGATGGGGGAGGG - Intronic
1041972698 8:63761312-63761334 ATGCGGGTGGGGATGGCCGGAGG + Intergenic
1044866499 8:96576068-96576090 TTGTGTGTGGGGATCGGGGAGGG - Intronic
1045006314 8:97919667-97919689 TTGTGGGTGGGGGTTTGGGAGGG - Intronic
1045581301 8:103483280-103483302 TTGAGGGTGGGGATGGGGAATGG + Intergenic
1045661785 8:104445627-104445649 TAGTGGGGAGGGATGGCGGTGGG + Intronic
1046565773 8:115898841-115898863 ATGTGGGTGGGGATGCGGGTAGG + Intergenic
1046996210 8:120526735-120526757 TGGTGGGTGGGGTTGGAAGAGGG + Intronic
1047308970 8:123676454-123676476 TGGTGGGTGGTGATGGGGGCTGG - Intergenic
1047759053 8:127940590-127940612 TTGTGGGGGGGGGCGGTGGAGGG + Intergenic
1047761927 8:127960936-127960958 TTGGGGGTGGGGGGGGCGGGCGG + Intergenic
1048071879 8:131029852-131029874 GTGTGGGTGGGGGTGGAGTAGGG + Intronic
1048732766 8:137462110-137462132 TTCTGGGTGGGCATGTGGGATGG + Intergenic
1048881678 8:138877109-138877131 TTGTGGCTGGGGGTGGGGGAGGG - Intronic
1049710857 8:144062746-144062768 GGGTGGCTGGGGATGGTGGAGGG - Intronic
1049778760 8:144418023-144418045 TTGTGGGTGGGGCTGGGGTGGGG + Intergenic
1049958666 9:716980-717002 CTGTGGGTGGGGGTGGTGGGGGG + Intronic
1050111634 9:2222836-2222858 TTGGGTGGGGGGATGGGGGAGGG + Intergenic
1051079582 9:13279278-13279300 TTGGGGGTGGGGGTGGGGGCGGG - Intronic
1051423245 9:16909584-16909606 GTGTTTGTGGGGATGGAGGAAGG + Intergenic
1052254671 9:26441073-26441095 TGGGGGGTGGGGATGGCAGATGG - Intergenic
1052624494 9:30957459-30957481 TGGTGTGGGGGGATGGGGGAGGG + Intergenic
1052685453 9:31749983-31750005 TGTGGGGTGGGGATGGGGGAGGG - Intergenic
1054702901 9:68431886-68431908 TTAGGGGTGGGGATGGGGGTGGG + Intronic
1056672657 9:88644188-88644210 TTGTGGGTGGGAATGTAAGATGG - Intergenic
1056897695 9:90566357-90566379 TTGGGGGTGGTGATGGGGGAGGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057337518 9:94166884-94166906 TTGGGGGTTGGGATGAAGGAGGG + Intergenic
1057823409 9:98352526-98352548 ATGTGGGTGGTGATGGCAGCAGG + Intronic
1058087170 9:100760905-100760927 GGGTGGGTTGGGATGGCTGATGG + Intergenic
1058121509 9:101144263-101144285 TTGGGGGTGGGGAGCGGGGAGGG + Intronic
1058161040 9:101571050-101571072 AAGTGGGTGGGGATGGCTAAGGG + Exonic
1058210982 9:102169940-102169962 TGGGGTGAGGGGATGGCGGAGGG - Intergenic
1058638062 9:107056195-107056217 TTGTGAGTTGGGGTGGGGGAGGG + Intergenic
1059260682 9:112972974-112972996 TTGAGTGTGGGGTTGGCGGGGGG + Intergenic
1059487991 9:114642190-114642212 TTGAGGGTGGGGAGGAAGGAGGG - Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1059950133 9:119453896-119453918 GTGTGGGGGGGGATGGGGGGTGG - Intergenic
1060043937 9:120325404-120325426 TTGGGGGTGGGGATGGCACTGGG - Intergenic
1060112483 9:120916678-120916700 TGGTGGGTGGGGGTGGGGGCAGG - Intronic
1060427026 9:123514523-123514545 ATCTGGGTGGGGATGGAGGCAGG + Intronic
1060504443 9:124187556-124187578 TGGAGGGTGTGGATGGGGGAAGG - Intergenic
1060828733 9:126700837-126700859 ATGTGTCTGGGGATGGCGGGTGG - Exonic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061810477 9:133159796-133159818 TTGTGTGTGTGCGTGGCGGAGGG - Intronic
1061839193 9:133347885-133347907 TGGGGGGTGGGGATGGAGGGGGG - Intronic
1062497448 9:136838430-136838452 TGGTGGGAGGGGCTGGCAGATGG - Intronic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1203406188 Un_KI270538v1:15766-15788 TTGTGGGGGGGGAGGGGTGAGGG + Intergenic
1203663322 Un_KI270754v1:3272-3294 ATTTGGGTGGGGATGGTGGAAGG + Intergenic
1185497615 X:567274-567296 TGGGGTGTGGGGATGGGGGAGGG - Intergenic
1185672766 X:1825500-1825522 TTGGAGGTGGGGCTGGCTGAGGG - Intergenic
1185711261 X:2305201-2305223 TTGTGGGTGGGGGTCAGGGAGGG + Intronic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1187052625 X:15709646-15709668 TTGTGGGCGGGGGTGGGGGTGGG + Intronic
1187805030 X:23110432-23110454 TTGTGGGAGGGAAAGGGGGAGGG - Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188248702 X:27864504-27864526 TCGTGTGTGGGTATGGCAGAGGG - Intergenic
1188974815 X:36660393-36660415 TGGGGGGTGGGGATGGCAGGTGG + Intergenic
1190123703 X:47684852-47684874 TTGGGGGTGGGGGTGGGGGTGGG + Intergenic
1190123710 X:47684864-47684886 GTGGGGGTGGGGGTGGGGGAAGG + Intergenic
1190466468 X:50729007-50729029 TTGGGGGTGGGGGTGGGAGATGG + Intronic
1190929196 X:54933957-54933979 GTGTGGCTGGTGATGGGGGAGGG - Intronic
1190945170 X:55085599-55085621 TGGGGTGTGGGGATGGGGGAGGG + Intergenic
1191672816 X:63764806-63764828 TTGTTGGTGGGGCTGGGGGAGGG + Intronic
1192013238 X:67298817-67298839 GTGGGGTTGGGGATGGGGGAGGG - Intergenic
1192149134 X:68701104-68701126 CTGTGGGTGGGCATGGCCAAAGG - Intronic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1194411760 X:93566110-93566132 TTGAGGGTGGGGGTGGGGGTGGG + Intergenic
1195068463 X:101258167-101258189 CTGGGGGTGGGGATGGGGGTGGG + Intronic
1195069162 X:101262813-101262835 TTGTGGGCGGGAATGTGGGACGG + Exonic
1195129316 X:101838590-101838612 GTGTGGGGGGGGGTGGCGGTGGG + Intronic
1195415459 X:104615371-104615393 TGGGGGGTGGGGTTGGGGGAGGG - Intronic
1196841579 X:119864295-119864317 TTGGGGGGGGGGTTGGTGGAGGG + Intergenic
1197086292 X:122480086-122480108 TTGGGGGTGGGGGTAGGGGAGGG - Intergenic
1197395922 X:125927511-125927533 TTGTGGGGTGGGACGGGGGAGGG - Intergenic
1197625647 X:128799199-128799221 TGGTGGGTGGGGATTGTAGAAGG + Intergenic
1197668280 X:129246839-129246861 TGGTGGGGGGGGAGGGGGGAGGG + Intergenic
1197705647 X:129632699-129632721 TTGTGGGTTGGGTTGGGGGTGGG - Intergenic
1197723567 X:129761010-129761032 TGTTGGGTTGGGATGGAGGAGGG - Intronic
1198183993 X:134236749-134236771 GTGTGCGTGGGGATGGAGGGTGG + Intergenic
1198673653 X:139108831-139108853 TGGGGGGTGGGGTTGGGGGAGGG - Intronic
1199279130 X:145978651-145978673 TAGTTGGTGGGGATGGTTGATGG + Intergenic
1199525826 X:148790685-148790707 TTGGGGGTGGGGTTGGGGGAGGG + Intronic
1199600572 X:149539335-149539357 CTGTGGGTGGAGCTGGGGGAGGG - Intergenic
1199650010 X:149940606-149940628 CTGTGGGTGGAGTTGGGGGAGGG + Intergenic
1199716092 X:150508346-150508368 GTGGGGGTGGGGATGGGGGGTGG - Intronic
1199817862 X:151415244-151415266 TTGATGGTGGGGATGGCTGGGGG - Intergenic
1199895097 X:152119869-152119891 ATGAGGGTGGGGATGGGGGAGGG + Intergenic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201699494 Y:16864752-16864774 TTGTGGGTGGGGGAGGGGGGAGG + Intergenic
1202104660 Y:21350611-21350633 TAGTGTGTGGGGATGGGGGAGGG - Intergenic
1202119277 Y:21507806-21507828 GTGTGGGTGATGATGGCAGAGGG + Intergenic
1202121729 Y:21531346-21531368 GTGTGGGTGATGATGGCAGAGGG + Intronic
1202157276 Y:21898036-21898058 GTGTGGGTGATGATGGCAGAGGG - Intronic
1202159723 Y:21921577-21921599 GTGTGGGTGATGATGGCAGAGGG - Intergenic
1202186171 Y:22186492-22186514 GTGTGAGTGATGATGGCGGAGGG - Intergenic
1202205188 Y:22399904-22399926 GTGTGAGTGATGATGGCGGAGGG + Intronic