ID: 1105642841

View in Genome Browser
Species Human (GRCh38)
Location 13:22284220-22284242
Sequence TCCCCACCGCTCCCCGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 681
Summary {0: 1, 1: 0, 2: 9, 3: 72, 4: 599}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105642841 Original CRISPR TCCCCACCGCTCCCCGGCCC TGG Intergenic
900117188 1:1033786-1033808 GCCCCAGCGCTCCCGGCCCCGGG + Intronic
900119044 1:1040902-1040924 GCCCCGCCCCTCCCCGCCCCAGG - Intronic
900289756 1:1918921-1918943 TCCCCACAGGTGCCCGCCCCAGG - Exonic
900366305 1:2313266-2313288 TCCCCACGGTTCCCTGTCCCTGG - Intergenic
900419775 1:2550909-2550931 TCCCAACCCCTCCCCAGCCCTGG + Intergenic
900425196 1:2575129-2575151 TCCCAACCCCTCCCCAGCCCTGG - Intergenic
900476537 1:2878877-2878899 TCCCCACCGTCCCCCGGTCATGG + Intergenic
900633949 1:3652651-3652673 GCCGAACCGCCCCCCGGCCCTGG - Intronic
900962564 1:5934605-5934627 TCCCCACTGCTCCCAGTCCCGGG + Intronic
900992169 1:6103188-6103210 AGCCCACCCCTCCCGGGCCCCGG + Exonic
901063902 1:6485803-6485825 TTCCCACCTCTGCCTGGCCCGGG + Intronic
901186753 1:7378590-7378612 TCCCCACTCCTCCCTGCCCCCGG - Intronic
901204292 1:7485047-7485069 TCCCCAGAGCTGCCCGGACCTGG + Intronic
901577365 1:10211126-10211148 TCCCCCGCGCTGCCAGGCCCCGG + Intronic
901714270 1:11140510-11140532 TACTCACCGGTCCCCGGCCCCGG + Intronic
901923831 1:12553574-12553596 GCTCCACCGCTCCCCAGCCAAGG - Intergenic
902432089 1:16371232-16371254 TCCCCACTGCACCCCAGCCTGGG - Intronic
902472505 1:16658448-16658470 CACCCACCGCTGCCCGGCACCGG - Intergenic
902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG + Intronic
902520276 1:17011809-17011831 TCCGGACCGCGCCCCCGCCCAGG - Intronic
902771381 1:18647181-18647203 TCCCCTCCGCTGGCCGGCGCGGG - Intronic
902893337 1:19461084-19461106 TCCCCCCCCCGCCCCCGCCCAGG - Intronic
902896946 1:19485588-19485610 TCCCCGCCCCGGCCCGGCCCGGG + Intergenic
902940968 1:19799938-19799960 TCCCCGCCGCGTCCCGGCCCCGG + Intronic
903501338 1:23801540-23801562 TCCCTGGCGCTCCCGGGCCCGGG - Intergenic
903545050 1:24118713-24118735 TCCCCACCCCTCCCCTTTCCTGG - Intergenic
903781534 1:25823142-25823164 TCCCCACCATACCCCTGCCCTGG - Intronic
903851150 1:26306812-26306834 CCCCCACCCCGCCCCGGACCTGG - Intronic
903855905 1:26337448-26337470 TCCCCACCCCTACGCAGCCCAGG + Intronic
903969113 1:27107618-27107640 CCCCCACCCCGCCCCAGCCCTGG + Intronic
904483286 1:30807380-30807402 TTCCCACCCCGCCCCCGCCCCGG + Intergenic
905580807 1:39081737-39081759 TCTTCGCCGCTCCCCGGCGCCGG - Intronic
906532157 1:46530188-46530210 GCCCCCCCGCCCCCAGGCCCTGG + Intergenic
907286712 1:53385199-53385221 TACCCCCCGCTCCCCGGTCTTGG + Intergenic
908501115 1:64744908-64744930 CCCCCGCCGGCCCCCGGCCCCGG - Intergenic
908703947 1:66930450-66930472 ACTCCACTCCTCCCCGGCCCAGG - Intronic
909632268 1:77779745-77779767 TCTCCACCCCACCCCGCCCCTGG - Intronic
910200217 1:84690818-84690840 CCCCCACAGAGCCCCGGCCCCGG - Intergenic
910251169 1:85200844-85200866 GCCTCCCCGCTCCCCGTCCCGGG + Exonic
912517550 1:110225813-110225835 TGCCCTCTGCTCCCCGGCTCTGG + Intronic
913219169 1:116645659-116645681 TCCCTACAGTTCCCCTGCCCGGG - Intronic
915099058 1:153485460-153485482 TCCCCACCTCTTTCCAGCCCAGG + Intergenic
915304749 1:154970792-154970814 TCCCCTTAGCTCCCCGCCCCTGG - Intronic
916179235 1:162069859-162069881 GCCCCACCGCTCCCCTCCCCGGG + Exonic
917124171 1:171671014-171671036 TTCCCACCGCCCGCCAGCCCAGG - Intergenic
917449178 1:175132718-175132740 TCCCCACCCATCCCCTGCCCAGG + Intronic
918015990 1:180632535-180632557 CTCCCACCGTTCCCCGGCCCCGG - Intronic
920284585 1:204870537-204870559 TCCCCACCCCACCCCCGCCTTGG + Intronic
920360284 1:205410682-205410704 TCTCCACCCCACCCCTGCCCAGG - Intronic
920366437 1:205450506-205450528 CTCCCACCACTCCCCTGCCCTGG + Intronic
920390779 1:205599295-205599317 GCTCCCCCGCTCCCCGACCCCGG - Intronic
920445400 1:206012474-206012496 TCCCCACCACTCCCTTGCGCAGG + Intronic
920654889 1:207867873-207867895 TCCACACCCCTCCCCTGCCGAGG - Intergenic
920951517 1:210575493-210575515 TCCCCAGGGCTCCCAGGCCCAGG - Intronic
921138819 1:212285973-212285995 GCCCCACGGCCCTCCGGCCCCGG - Exonic
921382265 1:214536154-214536176 CCCCCACCCCACCCCGGCCTTGG - Intronic
921925280 1:220705951-220705973 GCCCCACCGCTCCCTGGCCTTGG - Intergenic
922714184 1:227858172-227858194 TCCCCACCCCAGCCTGGCCCAGG - Intergenic
923094152 1:230761394-230761416 TCCCCACTGCTCCCCTGCTCAGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923505444 1:234601407-234601429 TTCCCACCGCCCCCCCACCCCGG + Intergenic
923517084 1:234707033-234707055 GCCCCATGGCTTCCCGGCCCTGG + Intergenic
923781861 1:237031996-237032018 ACCTCACCTCTCCCCAGCCCCGG + Intergenic
924007747 1:239630894-239630916 TCCCCACTGCTGCCCTCCCCCGG - Intronic
924127931 1:240875189-240875211 CCCCCACTGCCCCCAGGCCCTGG + Intronic
924520511 1:244802179-244802201 TCACCACCCCTCCCCAGCCTGGG - Intergenic
1063429660 10:5977539-5977561 TCGCCACCTCCCCCCGGCCTGGG - Exonic
1064095846 10:12424086-12424108 TCCCCACCACTGCCTGGTCCCGG + Intronic
1064145333 10:12822355-12822377 TCCCCACTGCTGCACAGCCCAGG + Intronic
1064410188 10:15097776-15097798 TCCCCACTGCACGCCGCCCCTGG - Intronic
1065189796 10:23198839-23198861 CCCCCGCCTCCCCCCGGCCCTGG - Intergenic
1066560147 10:36661083-36661105 TCACCACCGCACCCCAGCCTGGG + Intergenic
1068388660 10:56363244-56363266 TTCCCACCAATCCCCAGCCCTGG - Intergenic
1069403607 10:68075254-68075276 TCCCCAACTCTCCCCACCCCTGG - Exonic
1069593573 10:69656386-69656408 TCCCCTCCGCTCCCCTACCCAGG - Intergenic
1069796965 10:71059751-71059773 TCCCCAGCCCTCTCCAGCCCTGG - Intergenic
1069818881 10:71215460-71215482 TCCCCACCCCACCCCATCCCTGG + Intronic
1070675460 10:78408765-78408787 TCCCCCCTGCTCCCCTGCCATGG + Intergenic
1070959092 10:80486401-80486423 TCACCTCTGCTCCCCTGCCCGGG - Intronic
1071629092 10:87203833-87203855 TCCCCACCGTGCCCAGACCCCGG + Intergenic
1073076949 10:100830137-100830159 TCCCCCACGCACCCCGGCCCTGG + Intergenic
1073137297 10:101227139-101227161 TCCTCCCCTGTCCCCGGCCCCGG - Exonic
1073265632 10:102226687-102226709 ACCCCCTCGCGCCCCGGCCCCGG - Intronic
1073294811 10:102432497-102432519 TCCCCTCCTGCCCCCGGCCCAGG - Intronic
1073336724 10:102715073-102715095 GCGCCACCGCACTCCGGCCCGGG - Intronic
1073461282 10:103667309-103667331 TCCCCACGACTCCCCAACCCTGG + Intronic
1074148871 10:110740605-110740627 TCCCCACCCCTACCAAGCCCTGG - Intronic
1074382542 10:112992333-112992355 TCGCCTCCGCCCCCCAGCCCTGG + Intronic
1074424379 10:113338222-113338244 TCCCCACCCCTACCCAGCCAAGG - Intergenic
1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG + Intronic
1076372605 10:129964840-129964862 TGCCCAGGGCTCCCCGGCCAAGG + Intergenic
1076420921 10:130331066-130331088 TCCCCACCCCTCCCCCACCATGG + Intergenic
1076554318 10:131311868-131311890 GCCCTCGCGCTCCCCGGCCCTGG + Intergenic
1076570249 10:131428049-131428071 TCCGCACACCTCCCCGGACCTGG + Intergenic
1076764302 10:132624804-132624826 TCCACACCCCACCCCCGCCCTGG + Intronic
1076776693 10:132701750-132701772 ACCCCACCCCACCCCAGCCCTGG + Intronic
1077059553 11:611834-611856 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077059567 11:611873-611895 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077090197 11:774964-774986 TCCCCACTCCTCCCAGGCCGCGG + Intronic
1077119677 11:901113-901135 AACCCACCCCTCCCTGGCCCAGG + Intronic
1077119961 11:902648-902670 AACCCACCCCTCCCTGGCCCAGG + Intronic
1077211063 11:1371160-1371182 TTCCCGCCGCTGCCCAGCCCTGG - Intergenic
1077253760 11:1571824-1571846 CGCCCTCCGCCCCCCGGCCCGGG + Intronic
1077408828 11:2394217-2394239 CCCCAGCCCCTCCCCGGCCCAGG - Intronic
1077409126 11:2395344-2395366 CCCCCACCCCGCCCCGCCCCAGG - Intronic
1077414360 11:2417949-2417971 TGCCCACCGCCCACCGGGCCCGG + Intronic
1077472757 11:2771961-2771983 TCTCCACTGCTCCCTGGCCCTGG + Intronic
1077571994 11:3346798-3346820 TCTCCACCAATCCCCGGCCCTGG + Intronic
1078190894 11:9091739-9091761 TCCCGTCCCCTCCCCGGCCTCGG + Intronic
1078569516 11:12445245-12445267 TCCCCACAGTTCCCAGCCCCAGG - Intronic
1078594651 11:12675178-12675200 TCCCCAGCGCACCCCGTCCAAGG - Intronic
1078594674 11:12675277-12675299 TCGCCGCCGCCCCCCGGCGCCGG + Intronic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1078611072 11:12820019-12820041 TCCCCACAACTCCCTGCCCCAGG - Intronic
1079088401 11:17463403-17463425 TTCCCACCCCACCCTGGCCCAGG + Intronic
1080581286 11:33645969-33645991 CACCCACTGCACCCCGGCCCTGG - Exonic
1080628345 11:34051564-34051586 TCTCCGCCGTCCCCCGGCCCCGG - Intergenic
1082809160 11:57468145-57468167 GCCCCTCTGCTCCCCGACCCTGG + Intronic
1083227638 11:61294890-61294912 TCCTCCCCGCTCCCCCGCCCGGG - Intronic
1083728883 11:64642749-64642771 CCCGCGCCGCCCCCCGGCCCTGG - Intronic
1083758762 11:64804751-64804773 GCCCCACGGCTCCTCGGCCTCGG + Exonic
1084070194 11:66728549-66728571 TCCCCGCCGCTCCCCGCCCGGGG + Intronic
1084179215 11:67438229-67438251 CCCCCACCCGTCCCAGGCCCAGG - Exonic
1084515604 11:69636782-69636804 TCCCAGCCGCACCCCGGCCCTGG + Intergenic
1084517205 11:69643388-69643410 TCCCGCCCGCTCCCCGGACAGGG - Intronic
1084916766 11:72434386-72434408 TCCCCAACGCTCCGGGGCCATGG - Exonic
1085038259 11:73312334-73312356 TCCCCAATTCTCCCAGGCCCAGG - Intronic
1085393535 11:76194699-76194721 TCCCCAGCGGTTCCCGGGCCCGG + Exonic
1085475024 11:76783989-76784011 TCCCCACCGCTACCCGGCCGGGG + Intronic
1085475103 11:76784196-76784218 TCCCTTCCTCTCCCCAGCCCAGG - Intronic
1086849802 11:91796322-91796344 TCCCCATCTCTCCCAGGCTCTGG + Intergenic
1090065227 11:123497856-123497878 TCGCCACCACTCCCCAGCCTGGG + Intergenic
1090370336 11:126246572-126246594 CCCCCACCGCCTCCCGCCCCAGG - Intronic
1090645867 11:128766290-128766312 TCCCCTCCCCTCCCCTGCCATGG + Intronic
1091335536 11:134762972-134762994 TCACGACCGCTCTCCGGGCCAGG + Intergenic
1091470560 12:722632-722654 TCCCCAACATTCCCCGGCCAAGG - Intergenic
1091705729 12:2691697-2691719 TCCCCAGAGCTCCGCGCCCCTGG - Intronic
1091773413 12:3168530-3168552 TCCCCACCGCCCCCCAGCTCTGG - Intronic
1091909893 12:4221091-4221113 TCCCCACTTCTCCCAGCCCCTGG + Intergenic
1092252697 12:6909615-6909637 AACCCACCCCTACCCGGCCCAGG - Intronic
1093037666 12:14348041-14348063 TCCCCACTTCCCCCAGGCCCTGG + Intergenic
1094124973 12:27014196-27014218 CCCGCACCTCTCCCCAGCCCTGG - Exonic
1095310619 12:40692929-40692951 TCCCCACCCCTCCCCTGCCGAGG - Intronic
1096145464 12:49275866-49275888 CCCACCCCGCTCCCCTGCCCAGG - Intergenic
1096469924 12:51869448-51869470 TCCCCGCCGGTTCCCGGCCGGGG - Intergenic
1097191178 12:57220330-57220352 CCCCCACCGCGCCCCGGAGCCGG + Intronic
1097251059 12:57632540-57632562 TCCGCAGCCCACCCCGGCCCAGG - Intronic
1097264649 12:57738261-57738283 TCCCCTCCCCTCCCCAGCTCGGG - Intronic
1101640617 12:106583777-106583799 TCCGCTCGGCTTCCCGGCCCTGG - Intronic
1101964378 12:109272446-109272468 TCCCCTCCCCTCCCAGCCCCTGG + Intergenic
1102592795 12:113969672-113969694 TCCCCACTGTTGCCAGGCCCTGG - Intergenic
1102745337 12:115244419-115244441 TCCCTCCTGCTCCCCAGCCCTGG - Intergenic
1103351854 12:120289384-120289406 TCGCCACCGCACTCCAGCCCAGG - Intergenic
1103415307 12:120738960-120738982 CCCCAACCTCTCCCCGTCCCTGG - Intronic
1103488255 12:121296905-121296927 TCCCCACCCCTCCCCGGCGCAGG - Intronic
1103903942 12:124317902-124317924 TCCCCATCTCCCCCCAGCCCAGG + Intergenic
1104014361 12:124952369-124952391 CCCCCACCGCCTCCCTGCCCGGG - Intronic
1104785053 12:131443918-131443940 TCCCCACCCTTCCCAGGCCCAGG + Intergenic
1104873970 12:132020102-132020124 TCCCCAGCACTCACCCGCCCCGG + Exonic
1104929236 12:132329457-132329479 CCCTCACCGCTCCCCGGGGCGGG - Intergenic
1105416792 13:20220349-20220371 TCCACACCCCTCCCCAGCCCTGG - Intergenic
1105535181 13:21259334-21259356 CCCCCCCCGCACCCCGTCCCCGG - Intergenic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1106231048 13:27821256-27821278 GCCCCACTGCGCCCCAGCCCAGG + Intergenic
1108668111 13:52652695-52652717 TCCCAGCCGCACCCCGGCCCAGG - Intronic
1108949038 13:56063856-56063878 TCCCCACTGCACTCCGGCCTGGG + Intergenic
1112295612 13:98184158-98184180 TCACCACCACTCTCCGGCCTGGG - Intronic
1112652646 13:101416123-101416145 TCCCCACCCCTCCCCCGCGCGGG + Intronic
1113100098 13:106707789-106707811 TCACCACTGCACCCTGGCCCTGG + Intergenic
1113841617 13:113364288-113364310 GCCCCGCCCCTCCCCCGCCCTGG - Intergenic
1113841669 13:113364394-113364416 GCCCCGCCCCTCCCCCGCCCTGG - Intergenic
1113847629 13:113401635-113401657 TCCCCACAGCTCCCCCGACAGGG - Intergenic
1115235577 14:31206874-31206896 TGCCCACCGCGCCCCGCCGCCGG - Intronic
1115659268 14:35475630-35475652 TCCCCACTGCACTCCAGCCCAGG - Intergenic
1117905777 14:60584133-60584155 TACCCTCCGCCCCCCGGCTCAGG - Intergenic
1118101057 14:62602808-62602830 TCCCCACCTGTCCCAGACCCTGG - Intergenic
1118338966 14:64879423-64879445 TCCCCTTCGCTCCCAGGCCGGGG + Intronic
1118450654 14:65898317-65898339 TCCCCACCCCAGACCGGCCCTGG - Intergenic
1120145320 14:80972769-80972791 TCCCCACTCCTCCCAGCCCCTGG + Intronic
1120914794 14:89701674-89701696 CCCCCCCCGCTTCCCGGCGCCGG + Intergenic
1121104697 14:91272723-91272745 TCCCCACCTCGGCCGGGCCCTGG - Exonic
1122082038 14:99273239-99273261 CCCCCCGCGCTCCTCGGCCCAGG + Intergenic
1122570070 14:102691309-102691331 TCCCCACCTCTCCCCATCCTAGG - Intronic
1122635979 14:103129866-103129888 TCCCTGCCCCTCCCTGGCCCAGG - Intronic
1122830929 14:104395388-104395410 TCCTCCCCGCTGCCCTGCCCAGG + Intergenic
1122882928 14:104698091-104698113 TCCTCAGAGCTCCCCAGCCCCGG - Intronic
1122931089 14:104933374-104933396 TCCCCGCCCCGCCCCGCCCCAGG - Exonic
1123090544 14:105740321-105740343 TCCCCACAGCTGCCCGCCCTGGG + Intergenic
1123096175 14:105768071-105768093 TCCCCACAGCTGCCCGCCCTGGG + Intergenic
1202899537 14_GL000194v1_random:27382-27404 GCCCCACCTCTCCACGGCGCGGG + Intergenic
1123716738 15:23039307-23039329 GCCCCAGCGCGCCCCGACCCCGG + Intronic
1123995615 15:25716150-25716172 TCCCCATGGCCCCACGGCCCAGG + Intronic
1124629550 15:31328573-31328595 TGCCCACCTCTCACCTGCCCTGG + Intronic
1124658159 15:31525074-31525096 TCCCCACTCCTCCCTGTCCCTGG + Intronic
1125771162 15:42166957-42166979 GCCCCACCCTTCCCTGGCCCAGG + Intronic
1126846730 15:52766977-52766999 TGTCCACCCCTCCCAGGCCCAGG - Intronic
1127286460 15:57538005-57538027 TCCCCGCCACCCCCCGCCCCAGG + Intronic
1127674975 15:61229636-61229658 TCCTCCCCTCTCCCCAGCCCAGG + Intergenic
1127753419 15:62067984-62068006 GCCCGCCCGCGCCCCGGCCCCGG + Exonic
1127763641 15:62164607-62164629 GCCCGCCCGCGCCCCGGCCCCGG - Exonic
1127812908 15:62580051-62580073 TCTACACCTCTCCCAGGCCCTGG + Intronic
1127889142 15:63233097-63233119 GCGCCACCACTCCCCAGCCCTGG - Intronic
1128028621 15:64460709-64460731 CCCCCACCCCACCCCGGCTCCGG - Intergenic
1128091482 15:64922046-64922068 TCCCCTCGGCTCCCCTGGCCTGG + Intronic
1128115493 15:65102389-65102411 TCCCCGGCGAGCCCCGGCCCCGG - Exonic
1128436305 15:67652795-67652817 TCACCCCCGCTCCCAGCCCCTGG + Intronic
1128640496 15:69332677-69332699 TCCCCACCCCACCCCCACCCCGG + Intronic
1128700593 15:69801345-69801367 TCCCCATCCCTCCCCCGCCTGGG - Intergenic
1128743119 15:70096843-70096865 CCCCCGCACCTCCCCGGCCCGGG - Exonic
1128980569 15:72182777-72182799 TCCCCTCTGCCCCCAGGCCCTGG - Intronic
1129016535 15:72474184-72474206 TCCCCTCGGGTCCCAGGCCCAGG + Intergenic
1129144305 15:73633260-73633282 TCCCCTCCCTTCCCCGGCCCCGG - Exonic
1129196740 15:73973041-73973063 GCCCCGCCCCTCCCCGGCCCTGG + Intergenic
1129457482 15:75683456-75683478 TTCCCACCTGTGCCCGGCCCCGG - Intronic
1129466933 15:75729440-75729462 TCCCACCCGCCCCCAGGCCCTGG + Intergenic
1129535647 15:76311637-76311659 TCTCTGCCGCTCCGCGGCCCGGG - Intergenic
1129540357 15:76342888-76342910 TCCCCAGCGGTCCGCGGCCCTGG + Intergenic
1129817161 15:78565377-78565399 TCCCCACCCCGCCCCGCCTCTGG - Intergenic
1129983691 15:79897220-79897242 TCGCCACCGCTCCCCTAACCGGG - Intronic
1130656527 15:85795075-85795097 TCCCCCCCCCTCCCCGCCCCCGG - Intergenic
1130899852 15:88199097-88199119 TCCCCACCCCACCCTGTCCCTGG - Intronic
1131846082 15:96491923-96491945 TGCGCACCGCCCCCCGCCCCGGG - Intergenic
1132055866 15:98649779-98649801 ACCCCGCCGCTCCCGAGCCCGGG - Intronic
1132464739 16:72356-72378 CCGCGACCCCTCCCCGGCCCCGG + Intronic
1132579306 16:677819-677841 TCCCCGCCGCTGCCCGCCTCGGG + Exonic
1132648357 16:1009452-1009474 TCCCCACTGCTCACAGACCCCGG - Intergenic
1132686250 16:1163326-1163348 TCCACACCGTACCCCGGCGCCGG - Intronic
1132705447 16:1241333-1241355 TCCCCACCCCTCCAGGCCCCGGG - Intronic
1132719504 16:1308975-1308997 TCCCGCCCGCGCCCCGGCCCAGG + Exonic
1132731976 16:1367168-1367190 TCCCCACAGCCCCGCAGCCCCGG + Intronic
1132805486 16:1773272-1773294 TCCCGCCCCGTCCCCGGCCCCGG - Exonic
1132841124 16:1978992-1979014 TCCCCGCTCCTCCCCAGCCCTGG + Exonic
1132987947 16:2777631-2777653 TCACCCCCGCTCCCTGACCCGGG + Intergenic
1133040942 16:3059431-3059453 TCCCCGCCCCTCCCCGGGCTCGG - Exonic
1133205157 16:4228788-4228810 TCCCCACCTTTCCCCAGCCCCGG - Intronic
1133371439 16:5248587-5248609 CCCCAAGCGCTCCACGGCCCTGG - Intergenic
1134284871 16:12852048-12852070 TCCCCACTGCTCTCCAGCCTGGG + Intergenic
1134849811 16:17470656-17470678 CCCGCGGCGCTCCCCGGCCCCGG + Exonic
1135732691 16:24907841-24907863 TCACCACTGCACCCCGGCCTTGG + Intronic
1135858167 16:26031254-26031276 GCCCCGCCACTCCCCGCCCCGGG + Intronic
1136460501 16:30407568-30407590 TCCCGCCCCCTCCCCGCCCCCGG + Exonic
1136533930 16:30888075-30888097 TCCCCTCCCCTCCTGGGCCCGGG + Intronic
1137057270 16:35751732-35751754 TCCCAACCGCTCCCTGACTCTGG + Intergenic
1137322806 16:47402526-47402548 TCCCCACAGCATCCCGGCTCTGG + Intronic
1137787598 16:51151362-51151384 CCTCCCCGGCTCCCCGGCCCCGG + Intronic
1139359417 16:66388206-66388228 TCCCCACCTCCCCCAGGTCCTGG - Intronic
1139451174 16:67029141-67029163 GCCCCAGCGCTCACCGCCCCCGG - Intronic
1139853800 16:69965485-69965507 TCCCCACCGCCCCCCGGCCTCGG - Intergenic
1139882778 16:70188398-70188420 TCCCCACCGCCCCCCGGCCTCGG - Intergenic
1140369732 16:74407121-74407143 TCCCCACCGCCCCCCGGCCTCGG + Intergenic
1141441326 16:84031517-84031539 TCCTCACTGTTCCCCTGCCCCGG + Intronic
1141620621 16:85235118-85235140 TCCTCACCGCTGCCCCTCCCAGG + Intergenic
1141673884 16:85507388-85507410 TGCCCTCCCCACCCCGGCCCAGG - Intergenic
1141674908 16:85512733-85512755 CCCCCACCGCTCCCGTTCCCTGG - Intergenic
1141993770 16:87624318-87624340 TTCCCACGGCTCCCCACCCCTGG + Intronic
1141997979 16:87647255-87647277 TGCCCACCCCACCCTGGCCCCGG - Intronic
1142005021 16:87685500-87685522 GCCCCACCGCCTCCCAGCCCAGG - Intronic
1142220740 16:88853785-88853807 TCCCCAGGGCTGCCCTGCCCTGG - Intronic
1142367519 16:89657853-89657875 TCCCCACACCTCCGCGGCCGCGG - Exonic
1142694829 17:1628011-1628033 TTGCCACCCCTCCCCGGCCGCGG + Intronic
1142709392 17:1715293-1715315 CCCCCACCTCCCTCCGGCCCTGG - Intergenic
1142836846 17:2593845-2593867 TCCCCTCCCCTCCCCCTCCCCGG + Exonic
1142848813 17:2694634-2694656 TCCCCAACGCTGTCCAGCCCGGG + Intronic
1143189536 17:5031678-5031700 CCCCCACCGCCCGCCCGCCCGGG - Intergenic
1143483471 17:7239694-7239716 TCCCCGCCGCTCCCCGGGGGAGG - Intronic
1143499210 17:7329242-7329264 CCCCCACCCCCGCCCGGCCCCGG + Exonic
1143618001 17:8064813-8064835 TCCCCTCCTCTCCCCAGACCTGG - Intergenic
1143660036 17:8319034-8319056 TGCCCATCGCTCCCTGGTCCAGG + Exonic
1143727622 17:8860282-8860304 CCCACACCGCCCCCCGCCCCAGG - Intronic
1144041183 17:11412795-11412817 TCCCCACCACCCCTGGGCCCGGG + Intronic
1144569931 17:16391035-16391057 TCCCCACTGCTCTCCAGCCTGGG + Intergenic
1144586905 17:16492418-16492440 TCGCCCCCGCGCCACGGCCCCGG - Intergenic
1144728874 17:17515363-17515385 TCCCACCCGCTCCCTGGCCCCGG - Intronic
1144851691 17:18247134-18247156 CCCCCCCCGCGCCCCGGTCCCGG + Intronic
1145283241 17:21483718-21483740 TCCCCTCCACTCCCAGCCCCTGG - Intergenic
1145362080 17:22220819-22220841 TCCCCACTGCTCTCCAGCCTGGG + Intergenic
1145394242 17:22482082-22482104 TCCCCTCCACTCCCAGCCCCTGG + Intergenic
1146787355 17:35731782-35731804 GCCCCCCGGCTCCCCCGCCCGGG - Exonic
1146913288 17:36661659-36661681 TCCCCACCTCTCCCCACCCCAGG + Intergenic
1147317298 17:39627111-39627133 TCCCTCGCGCTCCCCGGCCTGGG - Exonic
1148237294 17:45977281-45977303 TCCCCACCGCTGGCCAGCACAGG - Intronic
1148688700 17:49514580-49514602 CAACCACCGCTCCCCAGCCCAGG + Exonic
1148749790 17:49938884-49938906 TCCCCACCTCCCCACGGTCCAGG - Intergenic
1148777974 17:50106125-50106147 TCCCCTCAGCAGCCCGGCCCTGG - Intronic
1149678586 17:58488093-58488115 CCGCCACCGCCCCCCGGCCCGGG + Exonic
1151966376 17:77433796-77433818 TCCCCTGCGCCCCCCGCCCCAGG + Intronic
1152077981 17:78170265-78170287 TCCCCACCCCTCCCCGGTCCAGG + Intronic
1152476547 17:80522126-80522148 CACCCACCGCCCCCAGGCCCTGG + Intergenic
1152625660 17:81386944-81386966 TCGCCGCCGCGCCCCGCCCCCGG - Intergenic
1153238932 18:3013410-3013432 TTCTCACCGCTCCCAGTCCCTGG + Intergenic
1155532049 18:26777260-26777282 CCCCCACCGCTACCCTTCCCAGG - Intergenic
1156171838 18:34494357-34494379 CCCCCGCCGCCCCCCGTCCCCGG - Intronic
1156447878 18:37250389-37250411 TCCCCACAGCTGCCCTGCCTAGG + Intronic
1157736622 18:50055233-50055255 TCACCCCCGCCCCCCTGCCCCGG + Intronic
1158494476 18:57942140-57942162 TCCCTGCAGCTCCCTGGCCCTGG - Intergenic
1158503183 18:58022035-58022057 TCCCCATGGCTCCCCGACCCAGG - Intergenic
1158541164 18:58355955-58355977 TCCCCTGCACTCCCCCGCCCCGG + Intronic
1159040636 18:63320279-63320301 TCCGCCCCGCTCCCTGGCCCGGG + Intergenic
1160023980 18:75204253-75204275 ACCCCCCCTCTCCCCGCCCCAGG + Intronic
1160024927 18:75209225-75209247 TCCCCCCGCCTCCCCGGCGCCGG + Exonic
1160163205 18:76491263-76491285 CCCGCCCCCCTCCCCGGCCCCGG + Intronic
1160803173 19:979821-979843 CCCCCACCTCTCCCCAGCCAGGG + Intergenic
1160826368 19:1082284-1082306 GCCCCACCGAGCCCCGGCCCCGG - Intronic
1160835063 19:1120932-1120954 GCCCCACTGCTCTCCAGCCCAGG - Intronic
1160839480 19:1139324-1139346 TCCCCATCCCTCCCCTGCCCCGG - Intronic
1160861889 19:1240757-1240779 TCCCCCCCCCCCCCCCGCCCGGG + Intergenic
1160982677 19:1823529-1823551 TGCCCACGGCCCCCCGGCACAGG + Intronic
1161015783 19:1982321-1982343 TCGCCACCGCACTCCAGCCCGGG + Intergenic
1161139436 19:2638739-2638761 TCCCCTCCCCTCCCCTCCCCAGG - Intronic
1161216838 19:3098839-3098861 TCCCCACGTCTCCCTGGCCTGGG - Intronic
1161221526 19:3120251-3120273 CCCCCGCCACTCCCCTGCCCAGG - Intronic
1161306700 19:3572897-3572919 GCCCCGCCCCTCCCCGCCCCCGG - Intronic
1161333705 19:3700069-3700091 CTCCCACCGCTCCCGGGCCGGGG - Intronic
1161389714 19:4014780-4014802 TGGCCCCCGCTCCCCTGCCCAGG + Intronic
1161425046 19:4198584-4198606 TCCCCTCCCTTCCCCGTCCCCGG + Intronic
1161505075 19:4639501-4639523 TGCCCGCCCCGCCCCGGCCCCGG + Intronic
1161662293 19:5554292-5554314 TCCCCACCGCTCCCTGGCGCTGG + Intergenic
1161924977 19:7293669-7293691 TGGCCACCGCCCCCCGCCCCTGG + Intronic
1161932506 19:7350125-7350147 CCCCCACCCCTCCCAGTCCCAGG - Intronic
1162001270 19:7746565-7746587 TCCCCACCGGAGCCTGGCCCAGG + Intronic
1162471022 19:10871976-10871998 TCCCCGCCGGCCCCCGCCCCGGG - Intronic
1162525013 19:11201854-11201876 TCCCCACCCCCGCCAGGCCCAGG + Intronic
1162904926 19:13817763-13817785 TCCCCAGGGCTCCCGGGCACAGG - Exonic
1163117324 19:15196288-15196310 GCCCCACCGCTCGCCCTCCCAGG + Intronic
1163551785 19:17969549-17969571 TCCCCACCCCCTCCCTGCCCAGG + Intronic
1163701874 19:18790212-18790234 TCCCCCCCACCCCCCGCCCCGGG + Intronic
1164594810 19:29525989-29526011 TCCCCGCCTCTCTCCGGCTCCGG + Intergenic
1164615776 19:29665947-29665969 CCCCCGCCGCGCCCCTGCCCAGG - Intronic
1165077944 19:33291185-33291207 TCCCCACCTCCCCTCGGCTCAGG + Intergenic
1165157068 19:33795542-33795564 TCCCAGCCGGTCTCCGGCCCGGG + Intergenic
1165730051 19:38139474-38139496 TCCCCACCTCTGCCCGGGCCTGG + Intronic
1165751725 19:38264445-38264467 GCGCGGCCGCTCCCCGGCCCTGG - Exonic
1165994311 19:39833463-39833485 TCCCCTCCTCTCCCCGCCCCCGG - Exonic
1166043889 19:40218281-40218303 TCCCCACCGGGCTCGGGCCCAGG - Exonic
1166732786 19:45068163-45068185 TCCCCTCCCCTCCCTGTCCCTGG - Intronic
1166796650 19:45430172-45430194 TCCCCAGCGCTGCCCAGCACAGG + Intronic
1166800043 19:45451049-45451071 TCCCCTCCACCCCCCGCCCCGGG - Intronic
1166857931 19:45792500-45792522 TCCCCGCCGCCCGCAGGCCCCGG - Exonic
1166995430 19:46717550-46717572 TCCCCGCCGCGTCCCAGCCCAGG + Intergenic
1167455702 19:49595947-49595969 TCCCCAGCGCTCTCGGGCCATGG + Exonic
1167909548 19:52690552-52690574 GCCCCGCCGCCACCCGGCCCAGG - Intronic
1168145757 19:54419318-54419340 TCCCCACCGCCCACCCACCCTGG - Intronic
1168287639 19:55342418-55342440 TCCTCCCCGCTCACCGGGCCTGG + Intronic
1202704896 1_KI270713v1_random:15253-15275 CACCCACCGCTGCCCGGCACCGG - Intergenic
924962582 2:46914-46936 TCCCCTCTGCTCCCCCTCCCCGG - Intergenic
925905091 2:8535418-8535440 TCTCCTCCGCTCCCAGGCCTGGG + Intergenic
926156020 2:10454436-10454458 TCCCTAACTCTCCCTGGCCCTGG - Intergenic
926190107 2:10721758-10721780 TCCCCACCCCGCCCCTGCCTCGG - Intronic
926681298 2:15665897-15665919 TCCCCACGCCTCCCCAGCACTGG + Intergenic
927165920 2:20321326-20321348 TCCCCCCCGCTTCCCAGCCCAGG - Intronic
927424863 2:22970743-22970765 ACACCACCCCTCCCCGACCCCGG + Intergenic
927869751 2:26615995-26616017 CCCCCACCGCCCCCCAGCGCTGG - Intronic
928650616 2:33400179-33400201 TGCCCACCCCACCCCGCCCCTGG + Intergenic
928953367 2:36834927-36834949 TCCCCTCCCCTCCCCTCCCCTGG - Intergenic
929159952 2:38822027-38822049 GCTCCACCACCCCCCGGCCCAGG + Intronic
929452818 2:42048151-42048173 CCCGCGCGGCTCCCCGGCCCCGG - Exonic
931868287 2:66434255-66434277 TCCCAGCGGCTCCCCGGCCCCGG + Intronic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932426414 2:71638488-71638510 TCCCAACCACTCCCAGCCCCTGG + Intronic
933902887 2:86861951-86861973 CCCCCCCAGCTCCCCGACCCAGG - Intergenic
934079247 2:88452866-88452888 TCCCAGACGCTCCCGGGCCCGGG - Intergenic
934933501 2:98447068-98447090 GCCCCACTGATCCCCAGCCCAGG + Intronic
935087089 2:99858506-99858528 TCCCCACTGCACTCCAGCCCAGG + Intronic
935777658 2:106487319-106487341 CCCCCCCAGCTCCCCGACCCAGG + Intergenic
936410546 2:112254645-112254667 TCCACCCCGCTCCCCCGCCCAGG + Intronic
936574775 2:113643968-113643990 TCACCACCCCACCCCGTCCCAGG + Intergenic
937131369 2:119516549-119516571 TCCCACCCCCTCCCAGGCCCTGG - Intronic
937911689 2:127078717-127078739 TCCCCACTGCTGCCCCTCCCTGG + Intronic
938077359 2:128346853-128346875 CTCCAGCCGCTCCCCGGCCCGGG - Intergenic
938240775 2:129741024-129741046 TCCCAGCTGCTCCCTGGCCCAGG - Intergenic
940830087 2:158457071-158457093 CCCCCACCGGCCCCCGCCCCCGG - Intronic
942284051 2:174395944-174395966 TCCACCCCGCACCCCGGCCCTGG - Intronic
942401089 2:175604234-175604256 TCCCCACCCCTGACAGGCCCTGG - Intergenic
942617981 2:177814427-177814449 TCCACCCCGCTCCCTGGCCTAGG - Intronic
946151786 2:217778763-217778785 TCCCCACCCCACCCCACCCCCGG + Intergenic
946361894 2:219223901-219223923 TGCCCACCGCTCGCAGACCCGGG - Exonic
947102588 2:226637307-226637329 TCCCGACCCCTCACTGGCCCAGG - Intergenic
947476072 2:230448767-230448789 TCCCCAGAGCTACCCTGCCCAGG - Intronic
947696595 2:232195537-232195559 ACCCCACCGCACCCCACCCCAGG - Intronic
947754416 2:232551043-232551065 TCCCCACCCCTCCACGTCGCAGG - Intronic
947765280 2:232633785-232633807 TCCCCTCGGCGCCCCAGCCCCGG + Exonic
948216541 2:236237342-236237364 CCCGCCCCGCGCCCCGGCCCCGG - Intronic
948216556 2:236237367-236237389 CCCGCCCCGCGCCCCGGCCCCGG - Intronic
948216571 2:236237392-236237414 CCCGCCCCGCGCCCCGGCCCCGG - Intronic
948252944 2:236545010-236545032 TCCCCACCTCTGCTCTGCCCTGG - Intergenic
948454191 2:238097146-238097168 GCCCCAGCCCTCCCCAGCCCCGG - Intronic
948613371 2:239183717-239183739 TCCCCACCGCACCCCTGTCCTGG + Intronic
948714503 2:239852018-239852040 TCCCCACCACCCCCCCACCCAGG - Intergenic
948839748 2:240643117-240643139 TCCCCAACCCTGCCAGGCCCAGG + Intergenic
948897834 2:240935416-240935438 TGCCAGCTGCTCCCCGGCCCGGG - Intronic
948901472 2:240958737-240958759 TCCCCACTGCACCCCTGCCCAGG - Intronic
949027470 2:241773367-241773389 CCCCCAGCCCTCCCCGTCCCAGG - Intergenic
1168851353 20:979194-979216 TCCCCACCACTCACCTTCCCTGG + Intronic
1168869789 20:1118606-1118628 TCCCCGCCCCGCCCCGTCCCCGG + Exonic
1168878087 20:1185068-1185090 TCGCCGCCACTCCCCGCCCCCGG + Intronic
1168973577 20:1947527-1947549 TCCCCACCCCTGTGCGGCCCTGG + Intergenic
1171543511 20:25984297-25984319 CCCCCAACCCTCCACGGCCCAGG - Intergenic
1171810913 20:29743705-29743727 TCCCCACCTCACCCCGTCCAGGG + Intergenic
1172363229 20:34329481-34329503 GCGCCACCGCACTCCGGCCCAGG + Intergenic
1172589678 20:36108860-36108882 TCCCCACCTCACCCCAGCCCGGG + Intronic
1172599663 20:36175092-36175114 GCCCCACCGCCGCCCGCCCCGGG - Intronic
1173507330 20:43598283-43598305 TCCCCACCTCCCCCAGGCCCTGG - Intronic
1173662826 20:44745895-44745917 TCCGCATGGCGCCCCGGCCCCGG - Exonic
1174165359 20:48580207-48580229 CCCCCTCCCCTCCCCGGGCCTGG + Intergenic
1174282647 20:49450374-49450396 TCCCCACCCCTCCCTGGCACAGG + Intronic
1175238155 20:57526789-57526811 TCCCCACCCCTGCCCCGCCTAGG - Intergenic
1175415647 20:58799054-58799076 TCCCCACCGCCCCCACCCCCCGG - Intergenic
1175940980 20:62537453-62537475 GCCCCACCCCTGCCAGGCCCTGG + Intergenic
1176016824 20:62938173-62938195 CCGCCACCTCTCCCCAGCCCAGG + Exonic
1176030688 20:63009806-63009828 CTCCCACCGCGCCCTGGCCCTGG + Intergenic
1176056168 20:63150448-63150470 TCCCCACCCTTCCCCGCCCGGGG - Intergenic
1176079552 20:63265423-63265445 TCCCCACCCCACCCCTGCCCAGG - Intronic
1176179578 20:63743030-63743052 TCCCCACCCCCTCCAGGCCCGGG + Exonic
1176308312 21:5135888-5135910 TGCCCACCACTCACCGGTCCTGG - Intronic
1176549488 21:8214992-8215014 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1176550451 21:8218723-8218745 TCCGCACCGGACCCCGGTCCCGG - Intergenic
1176557383 21:8259221-8259243 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1176568413 21:8398026-8398048 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1176569380 21:8401762-8401784 TCCGCACCGGACCCCGGTCCCGG - Intergenic
1176576325 21:8442256-8442278 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1176577293 21:8445993-8446015 TCCGCACCGGACCCCGGTCCCGG - Intergenic
1176603930 21:8814477-8814499 GCCCCACCTCTCCGCGGCGCGGG + Intergenic
1176618913 21:9042154-9042176 GCCCCACCTCTCCACGGCGCGGG + Intergenic
1177167776 21:17622271-17622293 TTCCCACCCCACCCCAGCCCAGG + Intergenic
1177964101 21:27705482-27705504 TCCCCACCTCTGACTGGCCCTGG + Intergenic
1178281882 21:31290602-31290624 GCCCCACTGCACTCCGGCCCCGG + Intronic
1178415760 21:32403789-32403811 TCCCCACCTCTCCCCAGCCCTGG - Intergenic
1178440423 21:32593872-32593894 CCCCCACCGCCCCCCGCCGCCGG + Intronic
1178481481 21:32983145-32983167 TCCCCTCCTCTCCCCCTCCCTGG + Intergenic
1178915065 21:36701445-36701467 GCCCCGCGGCTCCCCGGCCCAGG + Intronic
1178953873 21:37006551-37006573 TCCCCTCCGCTCCTCCGACCCGG + Exonic
1179187696 21:39097349-39097371 TCCCCACGGCCTCCCTGCCCTGG + Intergenic
1179439576 21:41383542-41383564 TCCCCAGCCTTCCCCTGCCCTGG - Intronic
1179455046 21:41493408-41493430 TCCCCACCTCTCCCCCACTCAGG - Intronic
1179605798 21:42514348-42514370 TCCCCTGCCCACCCCGGCCCGGG + Exonic
1179848748 21:44126144-44126166 TGCCCACCACTCACCGGTCCTGG + Intronic
1179926178 21:44535062-44535084 TCCCCATCACCCCCCAGCCCCGG - Intronic
1180032915 21:45224490-45224512 TCCCCACAGCTGCCCCACCCAGG - Exonic
1180033006 21:45224721-45224743 TCCCCACAGCCGCCCCGCCCAGG - Exonic
1180064238 21:45404923-45404945 TCCCCGCCGCCCCCGGGTCCCGG + Intergenic
1180139045 21:45880272-45880294 TCCCCTCCCCTCCGAGGCCCAGG - Intronic
1180346214 22:11706054-11706076 GCCCCACCTCTCCGCGGCGCGGG + Intergenic
1180820460 22:18823715-18823737 TCCCTACAGTTCCCCTGCCCGGG - Intergenic
1181046889 22:20219166-20219188 TCCCCACCCTTCCCCGCCCCTGG + Intergenic
1181206684 22:21258187-21258209 TCCCTACAGTTCCCCTGCCCGGG - Intergenic
1181560526 22:23697149-23697171 TCCCCACCCCTCCTTGGCACAGG + Exonic
1182438257 22:30345240-30345262 TCCCCTCCCCTCCCCTCCCCTGG - Intronic
1182697187 22:32205502-32205524 TCACCCCCGCCCCCCGGCCGCGG - Intergenic
1183228143 22:36564283-36564305 TCCCCGCCCCGCCCCGCCCCCGG + Exonic
1183420555 22:37709281-37709303 TCCCCAGGGATCCCAGGCCCAGG + Intronic
1183616629 22:38949931-38949953 TCCCCACTGCTGGCCAGCCCTGG + Intergenic
1183942126 22:41301860-41301882 TCCCCAGCCCTGCCCGGCCCGGG - Intronic
1184066717 22:42125617-42125639 TCCCCACCCTTCCCCACCCCGGG - Intergenic
1184069185 22:42137769-42137791 TCCCCACCCTTCCCCACCCCGGG - Intergenic
1184380743 22:44143586-44143608 TCCCCATCCCTCCCTGGCTCAGG - Intronic
1184380917 22:44144323-44144345 TCCCCACTGCCACCCAGCCCTGG - Intronic
1184386815 22:44181408-44181430 TCCACACCCCGCCCCGGGCCAGG - Intronic
1184412065 22:44331413-44331435 TCCCCGCCGCTCTCGGACCCCGG + Intergenic
1184461498 22:44640420-44640442 TCCTCCCTCCTCCCCGGCCCTGG - Intergenic
1184523382 22:45008387-45008409 TCCCCACCCCTCCCCTTTCCTGG - Intronic
1184667335 22:45995930-45995952 GGCCCACCGCTCCCTCGCCCTGG - Intergenic
1184734513 22:46390286-46390308 GCCCCAACACTCCCCAGCCCAGG + Intronic
1184768815 22:46586431-46586453 TGCCCTCCCCTCCCCAGCCCAGG + Intronic
1185105562 22:48867580-48867602 CACCCACCGTTCCCAGGCCCCGG - Intergenic
1185171506 22:49297257-49297279 TCCCCACCGATGCCAGGGCCAGG - Intergenic
1185208948 22:49555836-49555858 TGCCCACCACTCCCCAGCCCAGG + Intronic
1185333606 22:50262032-50262054 TCCCCACGGCTCCAGGGCGCAGG + Intergenic
1185388177 22:50546099-50546121 ACCCCACCATTCCCAGGCCCTGG + Intergenic
1185425398 22:50766908-50766930 TCACCACCCCACCCCGTCCCAGG - Intergenic
1203220240 22_KI270731v1_random:37236-37258 TCCCTACAGTTCCCCTGCCCGGG + Intergenic
1203254375 22_KI270733v1_random:131314-131336 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1203255347 22_KI270733v1_random:135062-135084 TCCGCACCGGACCCCGGTCCCGG - Intergenic
1203262431 22_KI270733v1_random:176393-176415 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1203270586 22_KI270734v1_random:49590-49612 TCCCTACAGTTCCCCTGCCCGGG - Intergenic
949710254 3:6862913-6862935 AACCCACCGCTCAGCGGCCCCGG - Intronic
949987758 3:9553509-9553531 GCCCCGCTGCTCACCGGCCCCGG - Intronic
950400965 3:12768917-12768939 CCCCCGCCCCGCCCCGGCCCCGG - Intronic
950465038 3:13148677-13148699 TCCCCGGGGCTCCCTGGCCCAGG + Intergenic
950729925 3:14948070-14948092 TCCCCTCCCCTCCCCGCCCGCGG + Intronic
952367129 3:32685090-32685112 TCCCCTCCGCGCCCCGCCTCCGG - Intergenic
954049790 3:47965014-47965036 TCCCCGCCTCTCCCAGCCCCTGG + Intronic
954627969 3:52033026-52033048 CCCCCACCGCACCCCACCCCAGG - Intergenic
954633009 3:52056924-52056946 CCCCCACCACGCCCCGTCCCAGG - Intergenic
954693780 3:52409922-52409944 TCCCCACCGCTGCCCCCACCGGG + Exonic
955140103 3:56260437-56260459 TCGCCCCCGCGCCCCAGCCCTGG + Intronic
955687632 3:61562401-61562423 TCCCCAACGCGCGCCGGCCGGGG - Intronic
957939885 3:86991104-86991126 TCCCCACGGCTGCCCGACCCGGG - Exonic
959975800 3:112457923-112457945 TCACCACAGCTCCCTGCCCCTGG - Intergenic
960701187 3:120440919-120440941 TGCCCACCCCTTCCTGGCCCTGG - Intronic
960947308 3:122975419-122975441 TCCCCACCACCCCCCTGCCTCGG + Intronic
961482154 3:127189510-127189532 TCCACACCACCCCCTGGCCCTGG + Intergenic
961674431 3:128555926-128555948 CCCCCAGCGCCCCCCGCCCCTGG + Intergenic
963537272 3:146544373-146544395 TCCACACCTGACCCCGGCCCTGG + Intronic
965721960 3:171671980-171672002 CCCCCACCCCGCCCCCGCCCTGG + Intronic
967776110 3:193387775-193387797 TCCCCACCCCCACCCTGCCCAGG + Intergenic
967817510 3:193811892-193811914 TCACCACAGCTCCCTAGCCCCGG + Intergenic
967969161 3:194986479-194986501 CTCCCACGGCTCCCCGTCCCAGG + Intergenic
968096006 3:195931286-195931308 CCCCCACCCCACCCCTGCCCAGG + Intergenic
968472141 4:787037-787059 TGCCCACCCCTCCCTGCCCCGGG - Intronic
968697527 4:2040513-2040535 CCCCCAGGGCTCCGCGGCCCCGG + Intronic
968985771 4:3873611-3873633 TCCCCGCCCTTCCCCAGCCCTGG + Intergenic
969274603 4:6127095-6127117 TCCCCAGCAATCCCCGGCCAAGG + Intronic
969734361 4:8977183-8977205 CTCCCCCCGTTCCCCGGCCCCGG + Intergenic
970811166 4:20095673-20095695 TCCCCTCCCCTCCCCACCCCTGG - Intergenic
972686893 4:41360716-41360738 TCCCCGCCTCTCCCCGCCCCCGG - Intronic
975622171 4:76306584-76306606 CCCGCCCCGCTCCCCGCCCCTGG - Intronic
975883553 4:78939234-78939256 CCGCCGCCGCTCCCCGGCTCGGG + Exonic
978698484 4:111613703-111613725 TCCCCACCGCTGACAGGCCTGGG - Intergenic
979195661 4:117917183-117917205 CCACCACCGCTACCCAGCCCTGG + Intergenic
980113980 4:128661719-128661741 TCCCCACTCCTCCCCACCCCAGG + Intergenic
981268643 4:142818209-142818231 TCCCCCCTACTCCCCTGCCCTGG + Intronic
982149325 4:152435063-152435085 TCCCCTCCCCTCCCCTCCCCAGG - Intronic
984803741 4:183735852-183735874 CCCCCCCCTCCCCCCGGCCCGGG + Intergenic
985611648 5:892721-892743 CCGCCACCGCCCCCTGGCCCTGG + Exonic
985638360 5:1051383-1051405 TCCCCACCCCACCCCACCCCAGG - Exonic
985714271 5:1446597-1446619 GCTCCCCCGCTCCCCGGCTCCGG + Intergenic
985838423 5:2288021-2288043 TCCCCACCGATCCACAGCCAGGG + Intergenic
986784141 5:11096318-11096340 CCCCCACCCCTGCCAGGCCCCGG + Intronic
991987033 5:72299333-72299355 TCCCCGCCCCTCCCCATCCCAGG - Intronic
992226217 5:74621670-74621692 CCCCCCCCGCCCCCCGCCCCCGG + Intergenic
992910675 5:81393672-81393694 GCGCCACCGCTCTCCAGCCCGGG + Intronic
993116128 5:83722140-83722162 TCCCCAGCGCTCCGCGACACCGG - Intergenic
993320695 5:86465353-86465375 TCCCAGCCGCTCCCCAGGCCTGG + Intergenic
993603822 5:89962376-89962398 TCCCCACCCCCACCCCGCCCAGG + Intergenic
994002382 5:94795246-94795268 TCCCCACCCCACCCCCGCCCAGG - Intronic
994954269 5:106507193-106507215 TCCCCACAGCTCCCAGCCTCTGG - Intergenic
995295115 5:110511281-110511303 TCCCCACCCCCACCAGGCCCTGG - Intronic
997204423 5:132035668-132035690 GCGCCACCGCTCACCGGCCTGGG + Intergenic
997319031 5:132963182-132963204 CCCCCACCCCCACCCGGCCCCGG + Intronic
999928926 5:156409484-156409506 TCCCAACCAATCCCCGGGCCCGG + Intronic
1001051535 5:168418289-168418311 TCCCCACTGCTCCCCAGAGCTGG + Intronic
1001312937 5:170624063-170624085 TCCTCTCAGCTCCCGGGCCCAGG + Intronic
1001382270 5:171312408-171312430 TCCCCAGCCCGCCCCGGCGCTGG - Intergenic
1001588151 5:172847194-172847216 TCCCCACCACTGCCAGGCCAAGG - Intronic
1001747571 5:174103528-174103550 TCCCCACCGCGCCCCAGCACTGG - Intronic
1002063897 5:176642851-176642873 TCCCCCCCCCCCCCCGCCCCAGG + Intronic
1002211949 5:177604563-177604585 TCCCCTCGGCACCCCTGCCCGGG + Intronic
1002470975 5:179435983-179436005 TCCCCACCCCTCCCAGGCATGGG - Intergenic
1002524255 5:179806694-179806716 CCCCCGCCCCTCCCCGACCCGGG - Intronic
1002803590 6:550698-550720 TCCCCTCCAGTCCCCGGGCCTGG + Intronic
1003006043 6:2382493-2382515 TCCCCGCCGCTCCCCTGTCCTGG + Intergenic
1003103443 6:3195124-3195146 TCCTTGCCGGTCCCCGGCCCTGG + Intergenic
1003868507 6:10383686-10383708 GCCCCACCCCGTCCCGGCCCGGG - Intergenic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006137084 6:31901877-31901899 TCCCCACCCCCCCCCGGGGCCGG + Exonic
1006366474 6:33619179-33619201 TCCCCACCCCTCCCCATCCTAGG - Intergenic
1007521230 6:42452864-42452886 CCCCCACCGCACCCTGGCCTCGG + Intergenic
1007614530 6:43172196-43172218 TCCCCACCCCAACCGGGCCCCGG - Intronic
1007625380 6:43243618-43243640 CCCCCGCCCCGCCCCGGCCCCGG + Intergenic
1007760238 6:44128740-44128762 TCCCCACCTCACCCTGGCCTGGG - Intronic
1010787758 6:80024584-80024606 TCCCCACTGCTCCCAGCCCCTGG - Intronic
1012528990 6:100211833-100211855 TCCCCTCCACTCCCCTTCCCAGG + Intergenic
1013233103 6:108174749-108174771 TCCACACCGTTTCCCCGCCCGGG + Intronic
1013372678 6:109483560-109483582 TCCCCGCCCTGCCCCGGCCCCGG - Intergenic
1015149113 6:130019329-130019351 GCCGCACCGATCCGCGGCCCCGG - Intronic
1016608679 6:145963984-145964006 TCCCCACCTCTTCCCGATCCCGG - Intronic
1016824982 6:148379903-148379925 TCACCACCCCTCCCAGGCCCAGG + Intronic
1017021166 6:150141880-150141902 TCGCCACTGCTCCCCAGCCTGGG + Intergenic
1017616454 6:156251739-156251761 TCCCCACCCCACCCCACCCCCGG + Intergenic
1019161934 6:170074722-170074744 TCCACCCGGCTCCCAGGCCCAGG - Intergenic
1019213376 6:170423970-170423992 TCCACACCCCTCCCCGGCCCGGG + Intergenic
1019427458 7:984317-984339 TCCCCACCCCTACCCAGCACAGG + Intronic
1019473049 7:1231423-1231445 CCCCCCACCCTCCCCGGCCCAGG + Intergenic
1019530197 7:1499409-1499431 CTCCCACCCCTCCCCTGCCCTGG + Intronic
1019568013 7:1694227-1694249 TCCCCAGCCCTGCCCGGCACCGG - Exonic
1019613375 7:1948004-1948026 CTCCCACCGCTCCCGGGCACTGG - Intronic
1019615267 7:1956586-1956608 CCCCCACCCCTCCAAGGCCCTGG + Intronic
1019710859 7:2517607-2517629 TCCCCACAGTTCCCAGGCCAGGG - Intronic
1019828442 7:3301967-3301989 GTCCCCCCGCTTCCCGGCCCGGG + Intronic
1020010942 7:4805531-4805553 TCCCCAGCCCTCTCCTGCCCTGG + Intronic
1020142421 7:5619879-5619901 TCCCCACCACTCCCCTGCCAGGG - Intergenic
1020252943 7:6483953-6483975 CCCCCGCCGCTCACCGGCGCAGG + Exonic
1023362759 7:39432683-39432705 TCCCCACCACCCCCCAACCCCGG - Intronic
1023990175 7:45124090-45124112 TCCCCACCACCCCCCTGGCCGGG - Intergenic
1024913311 7:54470580-54470602 TCCACACCGCTTCCAGGCCATGG + Intergenic
1026086937 7:67270492-67270514 TCCCCTCCCCTCCCCTCCCCGGG + Intergenic
1026406135 7:70067809-70067831 ACACCACTGCTCCCCAGCCCAGG + Intronic
1026690165 7:72544206-72544228 TCCCCTCCCCTCCCCTCCCCAGG - Intergenic
1026741339 7:72980571-72980593 TCCCCACCACTGCTCTGCCCCGG + Intergenic
1027051559 7:75024559-75024581 TCCCCACCCCGGCCCTGCCCTGG - Intronic
1028370331 7:90085272-90085294 TCCCCACTGCACCCCAGCCTGGG - Intergenic
1028922206 7:96321595-96321617 CCCCCAGCGCTTGCCGGCCCAGG + Intronic
1029073776 7:97920399-97920421 CCCCCAATGCCCCCCGGCCCTGG + Intergenic
1029259653 7:99293108-99293130 TCCCCTCTGCTGCCTGGCCCAGG - Intergenic
1029706700 7:102280135-102280157 GCCCCTCCCCTCCCCTGCCCAGG - Intronic
1030632268 7:111908702-111908724 CCCCCACCGCCCCCAGGCCCTGG + Intronic
1031051928 7:116953718-116953740 CGCCCACCCCTCCCCCGCCCCGG + Intronic
1032081048 7:128858675-128858697 TCCCCACCCCACCGCGCCCCAGG + Exonic
1032504316 7:132424251-132424273 TGCCCCCCGCTCCCTGGCCTGGG + Intronic
1032545386 7:132737617-132737639 TCCCCACAGCTTCCCTGCCCTGG + Intergenic
1033222184 7:139535357-139535379 TCCCCTCCTCTCCCCAGCCCCGG - Intronic
1033328433 7:140398324-140398346 TCCCCACCGCCCTCCCGACCCGG + Intronic
1034147403 7:148884731-148884753 GCCCCGCCCCTCCCCCGCCCGGG - Intergenic
1034442817 7:151095588-151095610 TCCCCACCCCTTCCTGGGCCTGG + Intronic
1034985892 7:155515294-155515316 GCCCCCCCCCCCCCCGGCCCCGG + Intronic
1035147484 7:156834558-156834580 GCCCCACTGCTCTCCGGCCTAGG + Intronic
1035375003 7:158401980-158402002 TTCCCACCTCTCCCTGGCTCTGG - Intronic
1035926793 8:3736573-3736595 TCACCATGGCTCCCAGGCCCTGG + Intronic
1036810994 8:11867733-11867755 TGCCCTCCGCTCCCCTCCCCGGG - Intronic
1037805295 8:22055283-22055305 TCCCCGCCGCACCCCGACCTGGG - Intronic
1038318469 8:26507912-26507934 TCTCCACCGCTCTCCGGAGCAGG + Exonic
1038594844 8:28878934-28878956 TGCCCACCGCACTCCGGCCTGGG + Intronic
1038807994 8:30812478-30812500 TCCCCACCCGCCCCCGGCCCCGG + Exonic
1039297035 8:36168192-36168214 TCCCCTCCCCTACCCAGCCCTGG + Intergenic
1039592009 8:38757246-38757268 GCCCCACCGCCTCCCCGCCCAGG + Intronic
1041355319 8:56993695-56993717 TGGCGCCCGCTCCCCGGCCCCGG + Exonic
1045246444 8:100445495-100445517 ACCCCACCCCTCCCTGGCCCAGG - Intergenic
1046379973 8:113437591-113437613 TCCCCACCCCACCCCCGCCCAGG - Intergenic
1047300098 8:123606546-123606568 TCCCCACCGGCCCCCGCACCAGG - Intergenic
1048366148 8:133740373-133740395 TCCTCACTGCTGCCCAGCCCAGG + Intergenic
1048833510 8:138497513-138497535 TCTCCGCCGCGCCCCGCCCCCGG - Intergenic
1049266337 8:141669871-141669893 TGCCCACTGCTCCCTGGCCTCGG + Intergenic
1049493177 8:142915670-142915692 TCCCCACCCTTCCCCGCCCTGGG + Intronic
1052088155 9:24292805-24292827 TCCCCACCACTCACAAGCCCTGG - Intergenic
1052362242 9:27573514-27573536 CCCCGACCACGCCCCGGCCCCGG + Intronic
1053002762 9:34586327-34586349 TCCCTACCCCTCCCCAGCCAGGG + Intronic
1053142615 9:35690768-35690790 GCCCCTCCGCTCCCCGCCCCTGG + Exonic
1054350746 9:64015634-64015656 GCCCCACCTCTCCACGGCGCGGG + Intergenic
1054745030 9:68845372-68845394 CCCCCACGGCTCCACGGCTCTGG - Intronic
1055044422 9:71910524-71910546 TCCCCTCCCCCCGCCGGCCCGGG + Intronic
1055121671 9:72667035-72667057 TCCCCACTGCACTCCAGCCCGGG + Intronic
1055887965 9:81087226-81087248 TCCCCAGCTCTCCCAGACCCTGG + Intergenic
1056154011 9:83817416-83817438 TCCCCTCGGCGCCCCGGCCTCGG - Intronic
1056168409 9:83959944-83959966 CCCCCGCCGCCCCCCCGCCCCGG + Intergenic
1057290148 9:93801246-93801268 CCCCCACCGCCCCCAGCCCCTGG - Intergenic
1057314599 9:93960374-93960396 CACCCACCGCTCGCCAGCCCCGG + Intergenic
1057726564 9:97572440-97572462 TCCCCACAGCCCCCTGGTCCTGG - Intronic
1059187378 9:112287032-112287054 TCCCCACCCCTGCCCAGCTCTGG + Intronic
1059230681 9:112718309-112718331 GCCCCGCCCCTCCCCCGCCCCGG - Intergenic
1059944515 9:119395233-119395255 CCCCCGCCCCTCCCCTGCCCTGG - Intergenic
1060191989 9:121599371-121599393 TCCCCACCACCGCCCCGCCCAGG - Intronic
1060478128 9:124000176-124000198 CGCCCCCCGCCCCCCGGCCCTGG + Intergenic
1061228480 9:129296252-129296274 TCCCCACCCCCCACAGGCCCTGG + Intergenic
1061230921 9:129315420-129315442 TCCCCACCCCACCCCCACCCTGG - Intergenic
1061260952 9:129480882-129480904 TCCCCACCAGTGCCCAGCCCAGG - Intergenic
1061422966 9:130482062-130482084 ATCCCACCCCTCCCCAGCCCTGG - Intronic
1061755406 9:132808924-132808946 TCCCCACCACTCCCCAAGCCAGG - Intronic
1061843341 9:133373126-133373148 TCCCCAGCGCCCCCAGCCCCTGG - Intronic
1061859459 9:133460457-133460479 CCCCCGCCGCCCCCCCGCCCTGG - Intronic
1062214265 9:135380656-135380678 CCCCCGCCGCCCCCAGGCCCTGG + Intergenic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1062406096 9:136397432-136397454 TTCCCACCTCTCCCAGACCCAGG - Intronic
1062448849 9:136607147-136607169 GCCCCACCGCACCCCAGGCCCGG - Intergenic
1062462279 9:136666933-136666955 TCCCCACCCCTCAGCTGCCCAGG + Intronic
1062614831 9:137391571-137391593 ACCCCACCGCCCGCCGGCCCTGG + Intronic
1203771914 EBV:53881-53903 TCCCGGCCGCTGCCCGGGCCAGG + Intergenic
1203775679 EBV:71893-71915 TGCCCCCGGCTCCACGGCCCCGG + Intergenic
1203470776 Un_GL000220v1:114458-114480 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1203471745 Un_GL000220v1:118199-118221 TCCGCACCGGACCCCGGTCCCGG - Intergenic
1203478597 Un_GL000220v1:158430-158452 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1185450767 X:280175-280197 TCCCCTCCACCCCGCGGCCCCGG + Intronic
1185472096 X:390028-390050 TCACCACCGCTCTCCAGCCGAGG + Intergenic
1185507672 X:642508-642530 TCTCCAGCTCTCCCTGGCCCAGG + Intronic
1186455488 X:9707221-9707243 TGCCCACCTCTCCCCACCCCTGG + Intronic
1186483512 X:9914453-9914475 TTCCCACTGCTCCCCTACCCTGG - Intronic
1186906258 X:14114345-14114367 GCCCCACCCCACCCCAGCCCTGG + Intergenic
1187416509 X:19097683-19097705 TCTCCTCCCCACCCCGGCCCCGG + Intronic
1188441084 X:30215788-30215810 CCCCCACCCTTCCCCTGCCCTGG - Intronic
1189002933 X:36964104-36964126 TCCCCGGCGCTGCTCGGCCCAGG - Intergenic
1189332480 X:40152383-40152405 TTCCCAGCGCGCCCTGGCCCTGG + Intronic
1189437728 X:41007740-41007762 TCTCCACTGCTGCCCTGCCCTGG + Intergenic
1190094452 X:47467439-47467461 TCCCCCATGGTCCCCGGCCCTGG - Exonic
1190119781 X:47650489-47650511 GCCCCACCGCCCCCCAGGCCTGG + Exonic
1190221027 X:48512372-48512394 TACCCACCTCGCCCCGGTCCAGG - Exonic
1191817088 X:65257440-65257462 TCCCCACCCCCCACAGGCCCTGG - Intergenic
1193044132 X:77034050-77034072 TCCCCACTGATCCCTGCCCCAGG + Intergenic
1193115991 X:77775775-77775797 TCACCACCGCACTCCGGCCTGGG - Intronic
1195747920 X:108137272-108137294 TCCCCTAAGCTCCCCTGCCCTGG - Intronic
1196283864 X:113856973-113856995 TGCCCCCCGCCCCCCGCCCCAGG + Intergenic
1196938525 X:120753124-120753146 GCCCCACGCCTCCCCTGCCCTGG - Intergenic
1198184178 X:134237495-134237517 TCCCAAACGCTCTCCAGCCCCGG - Intronic
1198215535 X:134550921-134550943 TCCCCACCCCGCACCGCCCCCGG - Intergenic
1199082241 X:143590186-143590208 TCCCCCCCGCCCCCCGCCTCAGG + Intergenic
1200034583 X:153319300-153319322 TGCCCAGGCCTCCCCGGCCCAGG - Intergenic
1200063613 X:153494727-153494749 TCCCCCCCCCTCCCCCGCCTGGG - Intronic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic
1200143385 X:153913174-153913196 TCCCCGCCTCTCCCCTGCCCAGG - Intronic
1200256709 X:154586219-154586241 GCCCCACCGCTTCCCGTGCCAGG + Exonic
1200261060 X:154618184-154618206 GCCCCACCGCTTCCCGTGCCAGG - Exonic
1200267099 X:154652542-154652564 GCCGCACCGCTCCCCCGACCAGG - Exonic
1200989216 Y:9334279-9334301 TTCCCAGCGCTTCCCAGCCCTGG + Intergenic