ID: 1105650439

View in Genome Browser
Species Human (GRCh38)
Location 13:22371699-22371721
Sequence TTGTAGGCTTATAGGTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2676
Summary {0: 2, 1: 17, 2: 190, 3: 1011, 4: 1456}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105650439_1105650447 17 Left 1105650439 13:22371699-22371721 CCCTTCCACCTATAAGCCTACAA 0: 2
1: 17
2: 190
3: 1011
4: 1456
Right 1105650447 13:22371739-22371761 TTACTTCCTAGATACAATGGGGG 0: 922
1: 1520
2: 1486
3: 981
4: 2568
1105650439_1105650449 23 Left 1105650439 13:22371699-22371721 CCCTTCCACCTATAAGCCTACAA 0: 2
1: 17
2: 190
3: 1011
4: 1456
Right 1105650449 13:22371745-22371767 CCTAGATACAATGGGGGTACAGG 0: 624
1: 1267
2: 1624
3: 1319
4: 1009
1105650439_1105650450 29 Left 1105650439 13:22371699-22371721 CCCTTCCACCTATAAGCCTACAA 0: 2
1: 17
2: 190
3: 1011
4: 1456
Right 1105650450 13:22371751-22371773 TACAATGGGGGTACAGGCATTGG 0: 505
1: 1433
2: 1785
3: 1516
4: 1175
1105650439_1105650444 14 Left 1105650439 13:22371699-22371721 CCCTTCCACCTATAAGCCTACAA 0: 2
1: 17
2: 190
3: 1011
4: 1456
Right 1105650444 13:22371736-22371758 TAGTTACTTCCTAGATACAATGG 0: 1208
1: 1716
2: 1488
3: 961
4: 774
1105650439_1105650445 15 Left 1105650439 13:22371699-22371721 CCCTTCCACCTATAAGCCTACAA 0: 2
1: 17
2: 190
3: 1011
4: 1456
Right 1105650445 13:22371737-22371759 AGTTACTTCCTAGATACAATGGG 0: 1072
1: 1588
2: 1299
3: 775
4: 621
1105650439_1105650446 16 Left 1105650439 13:22371699-22371721 CCCTTCCACCTATAAGCCTACAA 0: 2
1: 17
2: 190
3: 1011
4: 1456
Right 1105650446 13:22371738-22371760 GTTACTTCCTAGATACAATGGGG 0: 1114
1: 1599
2: 1420
3: 831
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105650439 Original CRISPR TTGTAGGCTTATAGGTGGAA GGG (reversed) Intergenic
Too many off-targets to display for this crispr