ID: 1105658657

View in Genome Browser
Species Human (GRCh38)
Location 13:22469006-22469028
Sequence CACAGCAAGAAGATGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105658652_1105658657 30 Left 1105658652 13:22468953-22468975 CCTCATCAAGGAGGCTTGGGGAG 0: 1
1: 0
2: 4
3: 17
4: 165
Right 1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 268
1105658653_1105658657 -3 Left 1105658653 13:22468986-22469008 CCCCTTCTGCTATGTGAAAGCAC 0: 1
1: 0
2: 6
3: 88
4: 454
Right 1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 268
1105658655_1105658657 -5 Left 1105658655 13:22468988-22469010 CCTTCTGCTATGTGAAAGCACAG 0: 1
1: 0
2: 22
3: 186
4: 884
Right 1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 268
1105658654_1105658657 -4 Left 1105658654 13:22468987-22469009 CCCTTCTGCTATGTGAAAGCACA 0: 1
1: 0
2: 18
3: 156
4: 788
Right 1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG 0: 1
1: 0
2: 2
3: 15
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105658657 Original CRISPR CACAGCAAGAAGATGTGGTC TGG Intergenic
900354816 1:2255553-2255575 CACAGACAGAAAATGAGGTCAGG - Intronic
900416526 1:2537700-2537722 CACACCCAGAAGAGGGGGTCAGG + Intergenic
902148667 1:14424840-14424862 CTCAGCAAGCAGATGGGGCCTGG - Intergenic
902225946 1:14996549-14996571 CACTGCAGGCAGGTGTGGTCAGG - Intronic
902341516 1:15786339-15786361 CAGGGCAAGACGCTGTGGTCTGG - Intronic
902882227 1:19379970-19379992 CACATCACAATGATGTGGTCAGG - Intronic
903982298 1:27197914-27197936 CACAGCTAGAAGATGTCGCAGGG - Intergenic
904296619 1:29523520-29523542 CACAGCAGGAAGAGGTGGGCTGG - Intergenic
904349551 1:29896012-29896034 TACAGCAGGAGGATGTGCTCAGG + Intergenic
904463515 1:30694290-30694312 CACAGCAGGAAGGGGTGGGCTGG + Intergenic
905042607 1:34972786-34972808 CACAGCCACAAGGTGTGGCCTGG + Intergenic
905581153 1:39083187-39083209 CACAGCATGAGGATGGGGTGGGG - Intronic
907536530 1:55165806-55165828 TACAGCCAGAGGATATGGTCTGG - Intronic
907600049 1:55760269-55760291 CCCAGGAAGAAGAAGGGGTCAGG + Intergenic
910815035 1:91283068-91283090 TACAGCAAAAAGATTTCGTCAGG - Intronic
911761754 1:101625336-101625358 CACAGGAGAAAGATGTAGTCTGG - Intergenic
912072182 1:105823970-105823992 CTCAGCAAGAACATGTGCACTGG - Intergenic
912252269 1:108023920-108023942 CACAGGAGAAAGATGTAGTCTGG + Intergenic
912332284 1:108830721-108830743 CCCAGCAAGCAGCTGAGGTCCGG + Intronic
912860385 1:113208878-113208900 CACAGCATGAAGGTTTGGACAGG + Intergenic
913239795 1:116820064-116820086 CACAGCAAGGAGAGGTGTACTGG - Intergenic
914347773 1:146814694-146814716 CACAGCAAGAGATTGTGGACTGG - Intergenic
914801084 1:150963081-150963103 CAGAGCCAGAGGATATGGTCTGG - Exonic
915135865 1:153731059-153731081 CACAGTAAGCATATATGGTCAGG - Intronic
917599292 1:176558721-176558743 AGCAGCAAGAAGATGTCATCTGG - Intronic
918990031 1:191685783-191685805 CACTGCAAGAAAAAGTGCTCTGG - Intergenic
919082402 1:192882359-192882381 GAAAGAAAGAAAATGTGGTCTGG + Intergenic
920964303 1:210689444-210689466 GACAGCAAGACGATGTGGGGAGG + Intronic
921008312 1:211115539-211115561 CACAGGAGAAAGATGTAGTCTGG - Intronic
921161706 1:212477371-212477393 CAGAGCAAGAAGAGCAGGTCTGG - Intergenic
921335772 1:214084352-214084374 CACAGGAGGAAGATGTAGGCTGG - Intergenic
923118425 1:230966696-230966718 CACAGTCAGAAGATATGGCCTGG + Intronic
923142487 1:231172475-231172497 TACAGAAAGGAGATGTGGTGTGG + Intronic
924111269 1:240702256-240702278 CAAAAGAAGAAGATGTGGACAGG + Intergenic
924712851 1:246545100-246545122 CACAATAAGAAAATGTGGGCCGG - Intronic
1063172003 10:3517452-3517474 AAGATCAAGATGATGTGGTCGGG - Intergenic
1063687399 10:8250355-8250377 CAAATCAACAAGGTGTGGTCTGG + Intergenic
1067023153 10:42819637-42819659 GAAAGAAAGAAGATGTGGACTGG + Intronic
1071266739 10:83971386-83971408 CACAGGAGAAAGATGTAGTCTGG + Intergenic
1071267538 10:83977537-83977559 CACAGGAGAAAGATGTAGTCTGG + Intergenic
1072965219 10:99966320-99966342 CAAAGGAAGAGGATGTGGGCAGG - Intronic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1075494422 10:122907550-122907572 CACAGGAAAAAGATGTAGGCTGG - Intergenic
1075536711 10:123277628-123277650 TACAGAAGGAAGATGTGGTTGGG - Intergenic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1077199959 11:1301784-1301806 CACAGCAGGAAGACCTGGGCTGG + Intronic
1077865921 11:6221798-6221820 CACATTAATAAGTTGTGGTCAGG - Intronic
1078651983 11:13204402-13204424 CACAGCAAGAATGTGTAGTATGG - Intergenic
1078849351 11:15149774-15149796 CACAGCTGGAAGATGTGGTAAGG + Intronic
1079097966 11:17523051-17523073 CCCAGCAAGAAGTTTGGGTCAGG - Intronic
1079412969 11:20207391-20207413 CACACCAAAAAGAACTGGTCAGG + Intergenic
1081290465 11:41319032-41319054 CACAGAAAGAATATGTGGTTGGG + Intronic
1081761061 11:45576674-45576696 GACAGCAACAAGAGGTGTTCGGG + Intergenic
1082084802 11:48041088-48041110 CACAGAAAGAGGATGTACTCAGG - Intronic
1082222381 11:49655574-49655596 CAAAGCAAGAAGAGGTTGACCGG + Intergenic
1083996357 11:66274948-66274970 CACCTCAAGCAGAGGTGGTCTGG + Intronic
1084327547 11:68410527-68410549 CAAAGCAAGGAGACCTGGTCAGG - Intronic
1085413228 11:76303932-76303954 CACAGTAAGAAGATGTGGGCTGG + Intergenic
1086763268 11:90660764-90660786 CACAGAAGGAAGATGTAGGCTGG + Intergenic
1087862415 11:103176582-103176604 CACAGCAAGAAGATCAAATCAGG - Intronic
1088730508 11:112677531-112677553 CACAGGAGGAAGATGTAGGCTGG + Intergenic
1088806575 11:113358464-113358486 CTCAGCAAGCAGGTGTGGCCTGG + Intronic
1088909958 11:114183299-114183321 GAAGGCAAGCAGATGTGGTCAGG + Intronic
1090875635 11:130786451-130786473 CACAGCAGGAAGGTGGGGGCAGG - Intergenic
1091755050 12:3045847-3045869 AACAGCAGGGAGAGGTGGTCAGG + Intergenic
1093049339 12:14488405-14488427 CACAGGAAAAAGATGTAGGCTGG + Intronic
1093050148 12:14495059-14495081 CACAGGAAAAAGATGTAGGCTGG + Intronic
1093550245 12:20401261-20401283 TACATCAAGAAGATGTAGTGTGG - Intronic
1094313705 12:29114582-29114604 CACAGGAAGAAGAACAGGTCTGG + Intergenic
1097079273 12:56417914-56417936 AACAGGAAGAAGATGAGGGCAGG - Exonic
1097221515 12:57454016-57454038 GACAGTGAGAAAATGTGGTCAGG + Intronic
1097564335 12:61249859-61249881 CATAGGAAGAAGATGTAGGCTGG + Intergenic
1098175148 12:67782318-67782340 CACGGGAGGAAGATGTGGGCTGG - Intergenic
1099868910 12:88321337-88321359 CACAGGAAAAAGATGTAGGCTGG - Intergenic
1100372680 12:93982963-93982985 CACAGCAGGAACATGTGCCCCGG + Intergenic
1101282480 12:103272831-103272853 CACAGCAAGAAGGAATGATCGGG + Intronic
1102490641 12:113287891-113287913 TACTGCAAGGAGATGTGGCCTGG + Intronic
1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG + Intronic
1104542199 12:129676197-129676219 CACATCAAGATGATGGGGGCAGG + Intronic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1106146018 13:27050555-27050577 CACTGCAAGAACAGGTGGCCTGG - Intergenic
1106487106 13:30181602-30181624 CTCAGGAGGAGGATGTGGTCAGG + Intergenic
1107614462 13:42150400-42150422 CGCAGGCAGAAGATGTAGTCAGG - Intronic
1110385357 13:74904584-74904606 AAAAGCAATAAGATGTGGTTTGG + Intergenic
1112234287 13:97621646-97621668 CTCAGCATGAAGATGAGGCCAGG - Intergenic
1112841682 13:103587056-103587078 CACAGGAGAAAGATGTGGGCGGG + Intergenic
1112928384 13:104705372-104705394 CACAGGAAGAAGATGAAGTATGG - Intergenic
1113332491 13:109343098-109343120 CACAGCAGAAAGATGTAGGCTGG - Intergenic
1117338631 14:54775594-54775616 CACAGCAAGAACCTCTGGGCAGG - Intronic
1118393835 14:65318835-65318857 CTCAGCCTGAAGGTGTGGTCAGG + Intergenic
1120081699 14:80225006-80225028 CACAGGAGAAAGATGTAGTCTGG + Intronic
1122355292 14:101119548-101119570 GACACCATGAAGGTGTGGTCAGG + Intergenic
1123131977 14:105994513-105994535 CCCTGCAAGAAGGTGTGGCCAGG + Intergenic
1123900641 15:24873219-24873241 GACAGCAAGAGGGTGTGTTCAGG + Intronic
1125086083 15:35731480-35731502 CACAGCAGGAATATGGGCTCAGG - Intergenic
1126644109 15:50858038-50858060 CTGAGCAAGAAGCTCTGGTCAGG + Intergenic
1127654177 15:61040297-61040319 CAAAGCAAGAATATGGGTTCAGG + Intronic
1128357729 15:66939910-66939932 CACAGCGTGAAGATGCAGTCTGG - Intergenic
1128680635 15:69648849-69648871 ACCAACAAGAAGATGTTGTCAGG + Intergenic
1129278756 15:74466584-74466606 AACAGCACCAAGATGTAGTCAGG - Intergenic
1130738310 15:86572350-86572372 GACTGCAAGGAGGTGTGGTCTGG - Intronic
1130854023 15:87824923-87824945 CTCAGAGAAAAGATGTGGTCAGG - Intergenic
1131711695 15:95062595-95062617 CACTGCAAGTGGATGTGGTCAGG + Intergenic
1132990155 16:2788126-2788148 CAGAGCAAGATGCTGGGGTCAGG + Intergenic
1133912935 16:10082327-10082349 CACAGGAAGAATATTTGGTTTGG + Intronic
1138440483 16:57031649-57031671 CACAGGGACCAGATGTGGTCTGG - Intronic
1139055631 16:63180380-63180402 TACAGCAAGAAAATGTGTTTGGG - Intergenic
1139986265 16:70900846-70900868 CACAGCAAGAGATTGTGGACTGG + Intronic
1141450335 16:84095618-84095640 CACTGCAGGCAGATGTGCTCTGG - Exonic
1141466010 16:84206232-84206254 CAAAGTAAGGAGATGAGGTCAGG - Intergenic
1141929799 16:87194440-87194462 CACAGAAATAAGAAGTGGGCTGG + Intronic
1142441569 16:90101702-90101724 CACAGCAAGAAGCTGAGGGAAGG - Intergenic
1144329354 17:14210367-14210389 CACAGCAAGGAGGTGGGGACAGG - Intergenic
1147475133 17:40703588-40703610 CAGTGGAAGCAGATGTGGTCTGG - Exonic
1149090804 17:52776122-52776144 CACAGCAAAGTGCTGTGGTCAGG - Intergenic
1151037477 17:70819042-70819064 CACAGGAAAAAGATGTAGGCTGG + Intergenic
1151219624 17:72602909-72602931 CACAGGGAGAAGGTGTGTTCTGG - Intergenic
1151744632 17:76005265-76005287 AGAAGGAAGAAGATGTGGTCTGG - Intronic
1203168823 17_GL000205v2_random:127005-127027 CACAGGAGAAAGATGTAGTCTGG - Intergenic
1153496331 18:5703613-5703635 CACATCCAGAAGAAGAGGTCAGG - Intergenic
1156069247 18:33186375-33186397 TACAGACAGAAGAGGTGGTCTGG - Intronic
1156763969 18:40628904-40628926 CACAGGAGAAAGATGTGGGCTGG + Intergenic
1156950683 18:42893403-42893425 CACAGCAAGAAGGTGGCATCTGG - Intronic
1159261653 18:66021015-66021037 CACAGGAGGAAGATGTAGTCCGG - Intergenic
1161172809 19:2821481-2821503 CCCAACATGAAGATGTGGTGGGG + Intronic
1161919556 19:7255872-7255894 CAAAGAAAGAAGATGAGGTTGGG - Intronic
1165096177 19:33411088-33411110 CACGACAAGGAGATGTGGGCAGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
925009732 2:474090-474112 CACAGGAGAAAGATGTGGGCTGG - Intergenic
926630179 2:15128876-15128898 CACAGAAAGACGATGAAGTCAGG + Intergenic
927702436 2:25276847-25276869 CACAGCCAGGAGATGAAGTCGGG - Intronic
928284878 2:29981308-29981330 CAGGGCAAGATGGTGTGGTCAGG - Intergenic
928832794 2:35508741-35508763 CACAGGAAAAGGATGTGGCCTGG + Intergenic
928914508 2:36456892-36456914 CACAGAAAGTAGGTGTGGTGGGG - Intronic
929128540 2:38543226-38543248 CACAGAAACAGCATGTGGTCGGG - Intergenic
929388001 2:41434208-41434230 CATAGAAAGAAGATGTAGGCAGG + Intergenic
931188623 2:59977836-59977858 CACAGCATGAAGATGTGAGATGG - Intergenic
932042747 2:68318518-68318540 CACAGCAAGAGGATGTTTTTTGG - Intronic
937582723 2:123507689-123507711 CACAGGAAAAAGATGTAGGCTGG - Intergenic
938012256 2:127838249-127838271 AACAACAAAAAGATGTGGGCTGG - Intergenic
939729911 2:145770802-145770824 CACAGCAATAAGTTGTAGACTGG - Intergenic
940408367 2:153331578-153331600 CACAGGAGAAAGATGTAGTCCGG + Intergenic
941116518 2:161479129-161479151 AACAGAAAGCATATGTGGTCTGG - Intronic
943012393 2:182466253-182466275 CTTAGGAAGAAAATGTGGTCTGG - Intronic
943715775 2:191150916-191150938 GGCAGCCAGAAGGTGTGGTCTGG + Intronic
947386788 2:229598709-229598731 TCCACCAAGAAGAGGTGGTCTGG + Intronic
948217102 2:236239970-236239992 CACAGCAAAGGGATGTGGGCTGG - Intronic
948447154 2:238041530-238041552 TACAGCAAGAAAATGTGTTTGGG + Exonic
1169151826 20:3295501-3295523 TACAGCAAGAAAATGTGTTTGGG - Intronic
1169445403 20:5667123-5667145 AACAGCAAGAAGATTGGATCAGG + Intergenic
1172595510 20:36148626-36148648 CACAGTAAGAGGATCTGGTCTGG - Intronic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1173222695 20:41142526-41142548 CTCAGCAAGAAGGTCTTGTCTGG - Intronic
1176402933 21:6332146-6332168 CACAGGAGAAAGATGTAGTCTGG + Intergenic
1176434224 21:6656958-6656980 CACAGGAGAAAGATGTAGTCTGG - Intergenic
1179947805 21:44689885-44689907 CACAGCAGAAAGATGTAGGCTGG + Intronic
1180021491 21:45130993-45131015 TACAAAAAGAAGATGTGGTGTGG - Intronic
1181365311 22:22371980-22372002 AACGGCAAGAGGATGTTGTCAGG - Intergenic
1181643234 22:24215780-24215802 CATGGCTAGAAGAGGTGGTCTGG - Intergenic
1182151305 22:28029059-28029081 CAGAGCAAGAACATGTGTCCAGG + Intronic
1183531520 22:38356614-38356636 TACAACATGAAGATGAGGTCAGG - Intronic
1184550859 22:45203470-45203492 CTAAGCAAGCAGATGTGGGCAGG - Intronic
949452903 3:4206564-4206586 CACTGCCAGAAGATGTGGCAAGG + Intronic
950849329 3:16047833-16047855 CAAAGCAATAAGATGAGGCCTGG - Intergenic
953740301 3:45532935-45532957 CACAGTAAAAAGAGGTGGCCGGG - Intronic
953993445 3:47501569-47501591 CACAGCAAGCAAGTGAGGTCTGG + Intronic
954181405 3:48883996-48884018 AACACCCAGAAGATGTGCTCAGG - Exonic
954242616 3:49305749-49305771 CTCATTAAGCAGATGTGGTCTGG - Exonic
954633995 3:52061695-52061717 CTCAGCAAGAAAATGTGCTGTGG - Intergenic
960349105 3:116572339-116572361 CACAGGAGGAAGATGTAGGCTGG - Intronic
960754954 3:121001314-121001336 CACTGCAAGTGGATGTGGCCAGG + Intronic
960774738 3:121237044-121237066 CACAGCAAAAACATGGGGACAGG - Intronic
961535637 3:127568892-127568914 CACAGCAGGAACAGTTGGTCAGG + Intergenic
962013369 3:131415763-131415785 CACAGGAGGAAGATGTAGGCTGG - Intergenic
962235565 3:133704268-133704290 CATAGCAGGGAAATGTGGTCTGG + Intergenic
962733679 3:138305187-138305209 CACAGCAGGCAGAGGTGGCCAGG - Intronic
963401235 3:144802292-144802314 CACTGCAAGCAGATGTAGCCAGG + Intergenic
965050372 3:163639160-163639182 CACAGGAGGAAGATGTAGGCTGG + Intergenic
966295236 3:178412731-178412753 AAAAGCAAGAATACGTGGTCAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967960107 3:194913585-194913607 ACTGGCAAGAAGATGTGGTCTGG + Intergenic
968361828 3:198152678-198152700 CACAGCAAGAAGCTGAGGGAAGG - Intergenic
969718156 4:8878318-8878340 CACAGGAAGAAGCGGTGCTCAGG - Intergenic
971225705 4:24749713-24749735 CACAGGAGAAAGATGTAGTCTGG + Intergenic
971424332 4:26501377-26501399 CACAGAAAGGAGATGGGGTGAGG - Intergenic
974977463 4:68907630-68907652 CACACCAAAGAAATGTGGTCTGG - Intergenic
975032611 4:69640121-69640143 CAGATCAAGAAGATATGGCCTGG + Intronic
975126667 4:70790214-70790236 CATAGGAAGAAGATGTGCTTTGG - Intronic
975909200 4:79248123-79248145 CACTGCAAGCAGGTGTGGTCAGG - Intronic
977074300 4:92433304-92433326 CACAGCACTAAGCTGTGCTCAGG + Intronic
979303105 4:119110085-119110107 CACAGCAAGGAGAGGGAGTCTGG - Intergenic
979800639 4:124904383-124904405 CACATCAAGAAGATGGTGGCAGG - Intergenic
980948187 4:139344821-139344843 CACAGAAAGAATATGAGTTCTGG + Intronic
981276248 4:142901039-142901061 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
982847354 4:160270828-160270850 CACAGCAGAAAGATGTAGGCTGG - Intergenic
983170885 4:164535158-164535180 TACAGAAAGAAAATGTGGGCTGG + Intergenic
984057626 4:174949130-174949152 CACTGCAAGTGGATGTGGTCAGG + Intronic
984144501 4:176044492-176044514 CCCTGCAAGAAGATGTAGCCAGG + Intergenic
986445664 5:7819070-7819092 CACAGGAGGAAGATGTAGGCTGG + Intronic
986624645 5:9712265-9712287 GACAGCAAGAATTGGTGGTCTGG - Intronic
986645581 5:9913289-9913311 CACAGGACGAAGATGTAGGCTGG + Intergenic
986851213 5:11816353-11816375 CACAGAAACCAGATGTGGTTGGG + Intronic
986959414 5:13195749-13195771 CACAGCAGAAAGATGTAGGCTGG - Intergenic
988870543 5:35384835-35384857 CCCTGCAAGAAGATGTGGCCAGG - Intergenic
990376898 5:55179561-55179583 CAGAGCAAGAATATCTGGTCCGG - Intergenic
991031420 5:62085930-62085952 CACAGCAAGAAGGTGCCATCTGG + Intergenic
993481670 5:88431487-88431509 CAAAGCATGAAGATGTGACCTGG - Intergenic
994170254 5:96652122-96652144 CACTGCAGGAAGATCTGCTCTGG - Intronic
994291050 5:98029381-98029403 CACAGGAGAAAGATGTGGGCTGG + Intergenic
994959051 5:106574592-106574614 CACAGGAAAAAGATGTAGGCTGG - Intergenic
995298829 5:110554286-110554308 CACAGGAGAAAGATGTAGTCTGG - Intronic
997879355 5:137575504-137575526 AACAACAAAAAAATGTGGTCAGG + Intronic
998152167 5:139763719-139763741 CAAAGGCAGAAGATGTGGTTAGG - Intergenic
1000260161 5:159580545-159580567 GACAGACAGAAGATGTGGCCTGG - Intergenic
1000471648 5:161650201-161650223 GACAGCAAGAAAATGGGATCAGG - Intronic
1002044763 5:176535820-176535842 GACAGCATGGAGATGTGGACGGG - Intronic
1003838278 6:10094036-10094058 CAAAGCATTAAGATGTGGCCTGG - Intronic
1004139821 6:13007584-13007606 GACAGAAAGAAGATCTGGTCTGG - Intronic
1007314900 6:40979382-40979404 CACTGCAAGCAGTTGTGGCCAGG + Intergenic
1008816124 6:55568902-55568924 CACAGAAAGAAGAAAGGGTCAGG + Intronic
1012490774 6:99780419-99780441 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
1016112393 6:140241595-140241617 CACAGAAGGAAGATGTGGTAGGG + Intergenic
1017388258 6:153910585-153910607 CACAGGAGAAAGATGTGGGCTGG + Intergenic
1019253855 7:36044-36066 CACAGCAAGAAGCTGAGGGAAGG + Intergenic
1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG + Intronic
1022078451 7:26996860-26996882 CACAGGAGGAAGATGTAGGCTGG - Intergenic
1023790917 7:43752982-43753004 CACAGGAGAAAGATGTAGTCTGG - Intergenic
1027247624 7:76377989-76378011 GGCAGCAAGAAGATGAGGCCAGG + Intergenic
1030206242 7:106954992-106955014 CACAGCAAGGCAATGTGGGCAGG - Intergenic
1033613073 7:142984510-142984532 CCCTGCAAGAAGGTGTGGCCTGG + Intergenic
1035519419 8:265541-265563 TACAGGAAGAAGCTGAGGTCTGG - Intergenic
1035600396 8:893844-893866 CACAGCAAGAGGAGGGGCTCGGG - Intergenic
1035746904 8:1967501-1967523 CACAGAAAGAAGATGATGTGGGG - Intergenic
1035772182 8:2156469-2156491 CCCAGCAAGAAGGTCTGTTCTGG - Intronic
1037245308 8:16827832-16827854 CACAGGAGAAAGATGTGGGCTGG + Intergenic
1038333097 8:26624933-26624955 CCCAGGAAGATGATGTGGCCTGG - Intronic
1039257302 8:35733623-35733645 GACAGCATAAAGATGTGGTTTGG - Intronic
1039392531 8:37193006-37193028 CACAGCAAGAAGATGACCACAGG + Intergenic
1040011085 8:42661671-42661693 CAGAGCAAGAGCATGTGGGCAGG + Intergenic
1041189448 8:55338616-55338638 CAACTCAACAAGATGTGGTCAGG + Intronic
1041256336 8:55982615-55982637 CACAGCAAGGAGGAGTGTTCGGG - Intronic
1041865392 8:62567370-62567392 CAGAGCAAGAAGAAATGGTGTGG + Intronic
1043237646 8:77888607-77888629 CACAGGAGAAAGATGTAGTCTGG + Intergenic
1043332198 8:79131272-79131294 CACAGCAAGAACATGGAGTTTGG - Intergenic
1044789938 8:95837010-95837032 CAAAGAAAAAAAATGTGGTCTGG + Intergenic
1044934374 8:97278744-97278766 CCCAGGCAGAAGAGGTGGTCAGG - Intergenic
1047768590 8:128011678-128011700 CACAGAGAGAAGATGTGGAGAGG + Intergenic
1048518585 8:135133409-135133431 CACAGAAGGAAGGTGGGGTCAGG - Intergenic
1050498703 9:6271356-6271378 CTCAGGAAGAATATCTGGTCTGG - Intergenic
1051056233 9:12990422-12990444 CACAGGAGAAAGATGTAGTCTGG + Intergenic
1051337203 9:16076615-16076637 CCCAGCACGAAGATGTGCTGAGG - Intergenic
1051352539 9:16212134-16212156 AACAGCATGAGGATGTGATCAGG + Intronic
1052389947 9:27867969-27867991 CACAGCAATTAAATGTGGTAAGG - Intergenic
1053283994 9:36838862-36838884 CACAGCAAAGACATGTGGCCAGG + Exonic
1053542986 9:38993894-38993916 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
1053807429 9:41817411-41817433 CACTGCAAGCAGGTGTGGCCAGG + Intergenic
1054623163 9:67370016-67370038 CACTGCAAGCAGGTGTGGCCAGG - Intergenic
1054802317 9:69362818-69362840 CACAGGAGAAAGATGTGGGCTGG - Intronic
1055126574 9:72725541-72725563 CACAGGAGAAAGATGTTGTCGGG + Intronic
1055731952 9:79287516-79287538 CACAGCAATCAGAAGTGATCAGG - Intergenic
1055843325 9:80531706-80531728 CACAGAAAGAAAAAGTGGTCTGG - Intergenic
1056549330 9:87638657-87638679 CAAGGCAGGAAGAGGTGGTCTGG + Intronic
1059044075 9:110845245-110845267 AACAGCAAGATGAAGTTGTCAGG + Intergenic
1060308573 9:122438713-122438735 CACAGGAAAAAGATGTGGGCTGG + Intergenic
1060488656 9:124065653-124065675 CCCAGCAGGAAGAGATGGTCTGG + Intergenic
1062501849 9:136855117-136855139 AACAGCAAGAGGGTGGGGTCTGG + Intronic
1062627590 9:137450254-137450276 CCCTGTAAGAAGCTGTGGTCAGG + Exonic
1062746543 9:138216499-138216521 CACAGCAAGAAGCTGAGGGAAGG - Intergenic
1203437312 Un_GL000195v1:151692-151714 CACAGGAGAAAGATGTAGTCTGG + Intergenic
1185686375 X:1932227-1932249 GAAAGAAAGAAGATGTGGCCGGG - Intergenic
1186328039 X:8501160-8501182 CAAATCAAGAAGATATGGGCAGG + Intergenic
1188272282 X:28155080-28155102 CACAATAAGAAGGTGTGGTCTGG + Intergenic
1188771377 X:34158200-34158222 CACAGCAAGCAGGTATGGCCTGG + Intergenic
1189225126 X:39406525-39406547 CACAGGGAGGAGAGGTGGTCAGG + Intergenic
1189678280 X:43486753-43486775 TACTGCAAGCAGATGTGGCCGGG - Intergenic
1193056709 X:77159955-77159977 CACTGCAAGTAGGTGTGGCCAGG - Intergenic
1194052424 X:89087797-89087819 CACAGGAGGAAGATGTAGGCTGG - Intergenic
1195541534 X:106068261-106068283 CACTGCAAGCAGATGTGGTCAGG + Intergenic
1195970324 X:110465930-110465952 CAAAGCAAGAAGATCTGCTGAGG - Intergenic
1196519854 X:116660834-116660856 CACGGCAAGCAGGTGTGGCCAGG - Intergenic
1196867361 X:120082354-120082376 CACAGAATGAATAGGTGGTCTGG + Intergenic
1196875738 X:120153928-120153950 CACAGAATGAATAGGTGGTCTGG - Intergenic
1197404285 X:126030193-126030215 CCTTGCAAGAAGGTGTGGTCAGG + Intergenic
1198514764 X:137394779-137394801 CACAGCAAAATGATATGGTTTGG - Intergenic
1198718341 X:139587090-139587112 CACAGCAAGCAGATGCTGTGTGG + Intronic
1202071349 Y:20994864-20994886 CACAGACTGAATATGTGGTCTGG - Intergenic