ID: 1105661619

View in Genome Browser
Species Human (GRCh38)
Location 13:22502166-22502188
Sequence CACTGAAGACAGTTTAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105661619_1105661621 18 Left 1105661619 13:22502166-22502188 CCTGATCTAAACTGTCTTCAGTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1105661621 13:22502207-22502229 ATATTACAAGAGTTGTCTCTTGG 0: 1
1: 0
2: 0
3: 15
4: 183
1105661619_1105661622 25 Left 1105661619 13:22502166-22502188 CCTGATCTAAACTGTCTTCAGTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1105661622 13:22502214-22502236 AAGAGTTGTCTCTTGGCATTAGG 0: 1
1: 0
2: 2
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105661619 Original CRISPR CACTGAAGACAGTTTAGATC AGG (reversed) Intergenic