ID: 1105662959

View in Genome Browser
Species Human (GRCh38)
Location 13:22519627-22519649
Sequence TCTGTTAAGCAGATAGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105662959_1105662961 -1 Left 1105662959 13:22519627-22519649 CCTTACACTATCTGCTTAACAGA 0: 1
1: 0
2: 3
3: 13
4: 155
Right 1105662961 13:22519649-22519671 ATCAGAGAACATATCCATTTGGG 0: 1
1: 0
2: 1
3: 21
4: 233
1105662959_1105662960 -2 Left 1105662959 13:22519627-22519649 CCTTACACTATCTGCTTAACAGA 0: 1
1: 0
2: 3
3: 13
4: 155
Right 1105662960 13:22519648-22519670 GATCAGAGAACATATCCATTTGG 0: 1
1: 0
2: 0
3: 36
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105662959 Original CRISPR TCTGTTAAGCAGATAGTGTA AGG (reversed) Intergenic
901148714 1:7086017-7086039 TCTGTTCAGCAGATACAGTTTGG - Intronic
902602305 1:17548482-17548504 TTTGTTATGCAGATAAAGTAAGG + Intronic
905042188 1:34968922-34968944 TCTGTTAGGCAGATAGGTTGAGG + Intergenic
907841730 1:58164831-58164853 TATGTTAAGCAGATGCTGAAAGG - Intronic
908813721 1:68010470-68010492 TCAGTTACACAGACAGTGTAGGG + Intergenic
909318220 1:74250208-74250230 TCTGTTAAGCAGAGTCTGTTTGG - Intronic
910175946 1:84430319-84430341 TCTGTTAGGCAGAGAGGGTAAGG + Intergenic
912144477 1:106775148-106775170 TCTGTTAAGCATTTCTTGTAAGG - Intergenic
913582271 1:120238119-120238141 TCTTTAAAGCAGAAGGTGTAGGG - Intergenic
913625904 1:120660265-120660287 TCTTTAAAGCAGAAGGTGTAGGG + Intergenic
914564205 1:148849597-148849619 TCTTTAAAGCAGAAGGTGTAGGG - Intronic
914608621 1:149280642-149280664 TCTTTAAAGCAGAAGGTGTAGGG + Intergenic
914861894 1:151393100-151393122 TCTATCAGGCAGATAGAGTAAGG - Intergenic
915660961 1:157404487-157404509 TCTGTGAAGCAGATAGGAAAAGG - Intergenic
917159363 1:172040508-172040530 TCTTTCAAGCAGCCAGTGTAAGG + Intronic
917956437 1:180103447-180103469 TTACTTAAGCAGATAGGGTAAGG - Intronic
1064725734 10:18277883-18277905 TCACTTAAGCAGATCATGTATGG + Intronic
1065894825 10:30154111-30154133 TCACTTAGGCAGATAGGGTATGG - Intergenic
1066173576 10:32879309-32879331 TTTATTTAGCAGATACTGTATGG - Intronic
1067297113 10:44980969-44980991 CCTTTTTAGCAGATAGTGCAAGG + Intronic
1068258080 10:54540001-54540023 TATGTTAAGAGGAAAGTGTATGG + Intronic
1068516100 10:58027305-58027327 GCTGTTAATCAGATAGTTTCTGG - Intergenic
1068993332 10:63174178-63174200 TCTGTTAAGTAAATACTGAATGG - Intronic
1072552142 10:96487219-96487241 TCTGTTAAGCAGCCAGTGCCAGG + Intronic
1074831099 10:117250020-117250042 TCTGTTTAGGAGATACTGTGGGG + Intronic
1080087287 11:28299591-28299613 TCTGTTAAACAAATTGTGTGAGG - Intronic
1081697019 11:45119742-45119764 TCTGTTAAGAAAATGGGGTAAGG - Intronic
1085244751 11:75091161-75091183 TTTGTTAGGCAGGTAGAGTAAGG - Intergenic
1085649455 11:78254389-78254411 TCTGTTAAGAAGATGAAGTAGGG + Intronic
1086003783 11:82012009-82012031 TCAGTTAGGCAGATTGGGTAGGG - Intergenic
1086021604 11:82237641-82237663 GCTGTTAGGCAAATGGTGTAAGG - Intergenic
1088010978 11:105000717-105000739 TATATTAAGAAGACAGTGTATGG - Intronic
1090599984 11:128360017-128360039 ACTGTTAAGGAGATAAGGTAGGG - Intergenic
1093846812 12:23982185-23982207 TATGATAAGCAGATAGTTTATGG - Intergenic
1097596599 12:61640963-61640985 TGTGTTAGGTAGATAGTGTAAGG + Intergenic
1097596605 12:61641007-61641029 TCTGTTAGGTTGATAGTATAAGG + Intergenic
1098202057 12:68066761-68066783 TCTGTTAAGCATCTCTTGTACGG + Intergenic
1105460744 13:20583860-20583882 TCTGTACAGCAAATAGTGTTGGG - Intronic
1105662959 13:22519627-22519649 TCTGTTAAGCAGATAGTGTAAGG - Intergenic
1106233552 13:27841409-27841431 TCTGATAACTAGATAGTGTGGGG - Intergenic
1108402477 13:50060844-50060866 TTTGTAAAGCAGAAATTGTAAGG - Intergenic
1113210942 13:107980051-107980073 TCTGTTCAACAGATGGTGCAGGG - Intergenic
1114944798 14:27666809-27666831 TTTGTTAAATAGATAATGTAGGG + Intergenic
1117731037 14:58721966-58721988 TCTGCTAAACAGTTAGTATATGG + Intergenic
1118583857 14:67332313-67332335 TCTCTGCAGCAGATAGTATAGGG + Intronic
1121623144 14:95364087-95364109 TCTGTTAAGAAGAGAGTCTCTGG + Intergenic
1122251680 14:100444404-100444426 TCTCTAAAGCATATAGTGAAGGG + Intronic
1122647238 14:103203113-103203135 TCACTTAGGCAGATAGGGTATGG - Intergenic
1123674567 15:22696552-22696574 TCTATTAAGCAGATAGTGTTGGG - Intergenic
1124326582 15:28769543-28769565 TCTATTAAGCAGATAGTGTTGGG - Intergenic
1125430247 15:39586659-39586681 TCTGTCAAACACATGGTGTATGG + Intronic
1125927993 15:43578916-43578938 TCCGTTAGTCAGATAGTGTGGGG + Intronic
1125941137 15:43678487-43678509 TCCGTTAGTCAGATAGTGTGGGG + Intergenic
1127438628 15:58984167-58984189 TTTGTTAAGCAGATAAAGCATGG + Intronic
1127563941 15:60168138-60168160 TCTGTGAATCAGGTAGTGAAAGG + Intergenic
1128001504 15:64196838-64196860 TCTGTTTGGCAGCTAGAGTAGGG - Intronic
1130764515 15:86856529-86856551 TCTGTTTGGCAGAAAGTGTAGGG - Intronic
1131917378 15:97283585-97283607 TATTTTAAGCAGATAGAGAAAGG - Intergenic
1133823226 16:9255346-9255368 GCTGTTAAGCATATAGTTTTTGG + Intergenic
1137461823 16:48671497-48671519 TCTGTTACGAAGATAGATTAGGG - Intergenic
1138432153 16:56975830-56975852 TCTGGTAAGCAGGTTGTGTGTGG - Intronic
1142399333 16:89851119-89851141 TCTGGTAAGAAGAAAGTGTGAGG - Intronic
1144146298 17:12401655-12401677 TCTATTAAACAGAAATTGTATGG + Intergenic
1144237950 17:13280536-13280558 TCTGTTAAGCAAATATTTTGGGG - Intergenic
1146428931 17:32772613-32772635 TCTCTTAAGCAGGTAGGGCAGGG + Intronic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1156027012 18:32666824-32666846 TCTGTTATGCAGATAGAGTGAGG + Intergenic
1156362579 18:36397286-36397308 TCTGTTCAGCAGAGAGTAGAGGG - Intronic
1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG + Intronic
1158442000 18:57484122-57484144 TCTTGGAAGCAGCTAGTGTAAGG - Exonic
1159578138 18:70205127-70205149 CCTGTTAAGCAGATTGGTTAAGG - Exonic
1160090387 18:75821333-75821355 TCAGTCAAGCAGGTTGTGTAGGG + Intergenic
1160618203 18:80150079-80150101 TTTGCTAAGCAGAAAGTGTTGGG + Intronic
1166602748 19:44112402-44112424 TCACTTAGGCAGATAGGGTATGG - Intronic
1166809846 19:45508424-45508446 CCAGTTAAGCAGATTGTGTGCGG - Intronic
1166887132 19:45968647-45968669 TATGTGAAGCACATAGCGTAAGG - Intronic
925046866 2:778806-778828 TGTGATAAGCAGATAGTGTGAGG - Intergenic
925335137 2:3092748-3092770 TCTCTTCAACAGATAGTGTCAGG + Intergenic
927635530 2:24813320-24813342 TCTGGCAAGTAGATCGTGTATGG + Intronic
928843457 2:35639032-35639054 TCTGTCAAGTAGATCGTGAATGG + Intergenic
929311000 2:40424675-40424697 TCTGGTAAGCTGATATTCTAAGG + Intronic
931065394 2:58580523-58580545 TCTTTTAACAAAATAGTGTAAGG + Intergenic
931635538 2:64337972-64337994 CCTGGTAAGTAGATAGAGTAGGG - Intergenic
933988842 2:87618045-87618067 TCTCTTAAGCATTTATTGTAGGG - Intergenic
935507861 2:103929798-103929820 TGTGTCAGGCAGATAATGTAAGG - Intergenic
936305002 2:111332778-111332800 TCTCTTAAGCATTTATTGTAGGG + Intergenic
937169772 2:119854400-119854422 TATTTTACGCAGATAGGGTAAGG - Intronic
940834663 2:158507760-158507782 TCTGATAAGAAGGTAGTGTGGGG + Intronic
942626641 2:177908336-177908358 TTTGTCTAGCAGATGGTGTAAGG + Intronic
943537907 2:189175496-189175518 GCTTTTAAGCAGGTAGTGAAAGG - Intronic
946098432 2:217296610-217296632 TCTGTTAGGCAGAAAGGGAAAGG - Intronic
947549538 2:231036906-231036928 TCCGTAAAGCAGAAAGTCTAGGG - Intergenic
1169666475 20:8042113-8042135 TCAGTTGATCATATAGTGTAAGG - Intergenic
1174341305 20:49897984-49898006 TCTCTTCACCAGATAGTGTTGGG + Intergenic
1176907154 21:14515407-14515429 TCTTTTCAACAAATAGTGTAAGG + Intronic
1178759230 21:35384694-35384716 TTTGTTTAGCAGATAGTTTGTGG - Intronic
1179284018 21:39960882-39960904 TTTGTTAGGCAGAGAGGGTAAGG + Intergenic
1181291698 22:21799365-21799387 TGTGCTAAGCAGATAATGAAAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
949899713 3:8800513-8800535 TCTGTTAGGCTGCTAGTGTGGGG - Intronic
951923702 3:27883451-27883473 TCTTTCAAGCAGATAGTCTTTGG - Intergenic
952620625 3:35336235-35336257 TCTGTTAGGCAGAGAATGTGAGG - Intergenic
954013238 3:47662301-47662323 TCTGTTGAGGAGATGGTTTAGGG + Intronic
954510957 3:51124493-51124515 TCTGGTAAGCTGATTGTGCAGGG + Intronic
954869185 3:53754516-53754538 TCTGTTAAGCAGTGCGTATATGG - Intronic
955011120 3:55015336-55015358 TCTGTTTTGCAGATGGTGAATGG - Intronic
956125603 3:66008355-66008377 TCGGTTCACCAGATGGTGTAGGG - Intronic
956561947 3:70588228-70588250 TCTGTTTAGCAGGTAGTGTGAGG + Intergenic
959969703 3:112395574-112395596 TCTGTTAAGTCGTTAGTGGAAGG + Intergenic
960512153 3:118563507-118563529 TCTTTTCAGCAGGTAGAGTAGGG + Intergenic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
967613405 3:191535808-191535830 TCTCTAAAGAAGATATTGTATGG - Intergenic
968528897 4:1079688-1079710 TCTGTTAAACACATAGTGAAAGG + Exonic
971969177 4:33599757-33599779 TCATTTAGGCAGATAGGGTAAGG + Intergenic
971983148 4:33781268-33781290 TCTGTTAAGGAAATAAAGTAGGG + Intergenic
973716398 4:53681448-53681470 TCTGTCAAGCTGTTAGTGTGGGG + Intronic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
976610905 4:87029391-87029413 TCTGTCAGGCTGACAGTGTAAGG - Intronic
977597572 4:98900524-98900546 TCTTTTAAGTAGAGAGTGAATGG + Intronic
977978044 4:103289844-103289866 TCTGTTAAGAACATACTGTAGGG + Intergenic
977979989 4:103309984-103310006 TATGTTAAGAATAGAGTGTACGG + Intergenic
984337566 4:178412694-178412716 TCTTTTCAGCAAATAGTGTTAGG + Intergenic
985410656 4:189680027-189680049 GCTTTTAAGCAGATAGAGGAAGG - Intergenic
986895490 5:12361816-12361838 TCTGTCAAGCAGTCAGCGTAAGG + Intergenic
987574940 5:19713375-19713397 GCTGTTAAGCAAACAGAGTAAGG - Intronic
987959568 5:24787936-24787958 TCATTTATGCAGATACTGTAAGG + Intergenic
987987746 5:25170874-25170896 TCTGTTATGCAGACAGACTAAGG + Intergenic
988177566 5:27746036-27746058 TCTCTTAAGCATCTATTGTAAGG - Intergenic
988773212 5:34452224-34452246 TCTGCTAAGCATATGCTGTATGG - Intergenic
992206509 5:74435285-74435307 TCAGTTAAGTAGATATTTTAGGG + Intergenic
995094191 5:108215932-108215954 TCTCTTAAGCACATGGTGCAAGG - Intronic
996748969 5:126870375-126870397 TTTATTTAGCAGATACTGTATGG - Exonic
1000207053 5:159071875-159071897 TCTGTTGAAAAGAAAGTGTACGG - Intronic
1002496707 5:179619191-179619213 TCTTTTAAGCAGAGAGAATATGG + Intronic
1002760141 6:195404-195426 TCTGTTCAGCAGATGGTGCTGGG + Intergenic
1002911117 6:1491569-1491591 TCTGATAAGCTGATGGTGTGAGG - Intergenic
1004775393 6:18838492-18838514 TCTGTAAAGCAGACAGTGTTAGG + Intergenic
1005059168 6:21760346-21760368 TGTGTTCAGCAGGTAGTGTGTGG - Intergenic
1007849911 6:44793049-44793071 TCTTTTAGGAAGATACTGTAGGG + Intergenic
1009426673 6:63521690-63521712 TCTGTTAATGAGTTACTGTAGGG - Intergenic
1011857737 6:91715846-91715868 TCTGTAAAGCAGATATTGTACGG - Intergenic
1012047286 6:94293965-94293987 TCTATTAACCAGAAAGTGTATGG + Intergenic
1012944910 6:105455043-105455065 TCTTTTAAGCAGAAAGGGAAAGG + Intergenic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1021898664 7:25261742-25261764 TCTGTTTTGCAACTAGTGTAGGG + Intergenic
1024144194 7:46495015-46495037 TCTTTTCAGCAAATAGTGTTGGG + Intergenic
1028182062 7:87735865-87735887 TCTATGAAGCATATAGTCTAGGG - Intronic
1034720065 7:153283895-153283917 TTCATTAGGCAGATAGTGTATGG + Intergenic
1037391781 8:18400442-18400464 TCTGTCAAGCAGAAAATGCAAGG - Exonic
1038985573 8:32805815-32805837 TCTGTTAAGGTGATAGTGATAGG + Intergenic
1039072911 8:33662389-33662411 TCTGTTAAGCACAGAGTGCTGGG + Intergenic
1042166348 8:65949570-65949592 TCTGTTCAGTAGACAGGGTATGG - Intergenic
1042725304 8:71868675-71868697 TCTGTTAGGCCTGTAGTGTAGGG - Intronic
1043179684 8:77071579-77071601 TCTTTTCAACAAATAGTGTAGGG - Intergenic
1046798323 8:118396817-118396839 TCTGTTGAGCCCATAGTTTATGG + Intronic
1047397943 8:124520134-124520156 TCTGTAAAGCAGAAGATGTAAGG + Intronic
1051931668 9:22393707-22393729 TCAATTTAGAAGATAGTGTAAGG - Intergenic
1052721990 9:32183042-32183064 TCTGTTGAGAAGAGACTGTAGGG + Intergenic
1055894733 9:81162240-81162262 TATGTTAAGAAGATGTTGTAAGG + Intergenic
1060360620 9:122952906-122952928 TCTGTAAAACAGATAGAATAAGG - Intronic
1060502558 9:124173025-124173047 TCTGTTAAGCAGATAGGATGGGG + Intergenic
1203672106 Un_KI270755v1:25399-25421 GCTTTTAAGCAGATAGAGGAAGG + Intergenic
1188394640 X:29665915-29665937 TCTGTCAAGCAAATATTGCATGG - Intronic
1190326963 X:49212466-49212488 AGTGTTAAGTAGATAGAGTAAGG + Intronic
1190384255 X:49869001-49869023 TCTGAAAAGTAGATAGTATAAGG - Intergenic
1191640425 X:63425591-63425613 CCTCTTAATCAGATAGTGAAAGG + Intergenic
1196492229 X:116281238-116281260 TCTGTTGAGCAGCTATTGTGAGG - Intergenic
1197627880 X:128823525-128823547 TCTGTGAAGTAGATATTGTGAGG - Intergenic
1197985527 X:132262709-132262731 TCTGTTAGGCAGATCAAGTAGGG - Intergenic
1198407380 X:136327182-136327204 TCTGTGAAGAGGATAGTGAAGGG - Intronic
1199927816 X:152487225-152487247 TTTGCTAGGCAGATAGAGTAGGG - Intergenic