ID: 1105663281

View in Genome Browser
Species Human (GRCh38)
Location 13:22523439-22523461
Sequence ACTGATATGCAGACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105663281 Original CRISPR ACTGATATGCAGACTGTGGA AGG Intergenic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
900716111 1:4145448-4145470 ACTGACATGCTGTCTGTGGTTGG + Intergenic
900894321 1:5472830-5472852 ACAGATAAGTAAACTGTGGAAGG + Intergenic
901572806 1:10175263-10175285 ACAGATATGCAGTCTGTCCATGG - Intronic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
904706527 1:32394939-32394961 ACTTAGATGCAGCCTTTGGAGGG + Intergenic
904866332 1:33581915-33581937 ACTGCCATGCAAACTGTGAAGGG + Intronic
907754863 1:57301658-57301680 AATGAAATGCAGCTTGTGGAAGG - Intronic
914286977 1:146236204-146236226 ACTGAGATCCAGACTGTGCCAGG - Intergenic
914548010 1:148686946-148686968 ACTGAGATCCAGACTGTGCCAGG - Intergenic
917680709 1:177363957-177363979 ACTGATGTGCATATAGTGGAAGG - Intergenic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918564131 1:185906855-185906877 CCTGATATGGAGACTGAAGAGGG - Intronic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
923737661 1:236626601-236626623 ACTGATATGCAGAATATTTAAGG + Intergenic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1063261224 10:4391743-4391765 AATGTTATGAAGACTGTGGTAGG + Intergenic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1063837221 10:10029517-10029539 ACTAATATCCAGAATGTGCAAGG + Intergenic
1064814669 10:19245971-19245993 ACTTAAATGCAGTCAGTGGAAGG + Intronic
1068246506 10:54378034-54378056 ACTAATCTGCAGACTGTGGTGGG - Intronic
1068703159 10:60041831-60041853 ACTGGTATGCAGAGTGCTGAGGG - Intronic
1073805545 10:107093770-107093792 AGTGATAGGCAGATTGTGTAAGG - Intronic
1073820068 10:107251710-107251732 AATGATGTGAATACTGTGGATGG - Intergenic
1073827711 10:107344464-107344486 ACTGATATCCAGAATGTATAAGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1076749296 10:132534334-132534356 CCTGACATATAGACTGTGGAAGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1083390610 11:62347127-62347149 GCTGATATACAGGTTGTGGAGGG - Intronic
1083529775 11:63409166-63409188 TGTGATATGCACACTGTTGAAGG + Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1087056846 11:93945167-93945189 ACTGAGATCCAGACTGTGCCAGG + Intergenic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1089632034 11:119789847-119789869 ACTGAGCTGGAGACTGTGGTGGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090790484 11:130089298-130089320 CCTGCTATGCATACTTTGGAAGG - Intronic
1091388093 12:107856-107878 ACTGATATCCATACTCTGTAAGG - Intronic
1092832050 12:12453709-12453731 ACTGAAATGCACACTGTAAAAGG - Intronic
1093180335 12:15960345-15960367 AATGATATGCGGGCTGGGGACGG + Intronic
1093456761 12:19372433-19372455 ACTAATATCCAGAATCTGGAAGG - Intronic
1093603794 12:21064846-21064868 ACTGATATGGAGGCGGTGGAAGG + Intronic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1096256272 12:50064009-50064031 ACTGCCATGCAGACAGGGGAAGG + Intronic
1097600258 12:61682869-61682891 ACTAATATTCAGACTCTAGAAGG - Intergenic
1098088197 12:66871183-66871205 TCTGGAATGCAGACTGTTGAAGG + Intergenic
1098571232 12:71989580-71989602 ACAGATGTGCAGATTTTGGATGG + Intronic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1103623012 12:122200356-122200378 ACAGAAGTGCAGCCTGTGGATGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106853615 13:33822042-33822064 AATCATATGCTGAGTGTGGATGG + Intronic
1109202439 13:59445936-59445958 ACTCATTTGAAGACTTTGGATGG - Intergenic
1109347736 13:61136180-61136202 TCTGATATGAAAACTGTGGCAGG - Intergenic
1110129391 13:71988449-71988471 ACCTATATTCAGACTGTGGTTGG - Intergenic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1112598009 13:100827299-100827321 ACTACTCTGGAGACTGTGGAGGG + Intergenic
1113272761 13:108692853-108692875 GCTGATGTCCACACTGTGGATGG + Intronic
1113303218 13:109045766-109045788 AGGGCTGTGCAGACTGTGGAAGG - Intronic
1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG + Intergenic
1118682224 14:68254346-68254368 ATGGATCTGCTGACTGTGGAGGG - Intronic
1119259650 14:73230208-73230230 ACTGAAAGGCAGACTGTGACGGG - Intergenic
1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG + Intronic
1122536412 14:102466691-102466713 ACTGAGCTGCACACTGTAGAAGG - Intronic
1202941843 14_KI270725v1_random:156414-156436 ACTTATATGCTGACTGTACACGG + Intergenic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1124554529 15:30712147-30712169 TCTGAAATGCAGAATGTGGCTGG - Intronic
1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1131858046 15:96620009-96620031 ACTGATATTCAGGCTGTGCTTGG + Intergenic
1132035795 15:98483112-98483134 AATGCTATGAAGAATGTGGATGG - Intronic
1132886194 16:2183294-2183316 ACTCACATGCAGACTGTAGGGGG - Intronic
1133901087 16:9975510-9975532 ATTTATTTGCAGTCTGTGGATGG - Intronic
1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG + Intronic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1140069534 16:71637161-71637183 AATGATATTCGGACTGTTGAAGG - Intronic
1140616073 16:76665841-76665863 ACTGAGCTGCAGACTGCAGAAGG - Intergenic
1142258790 16:89032470-89032492 ACTGAGATGTAGCGTGTGGATGG - Intergenic
1145413940 17:22697210-22697232 AGTAATATGCAGAATGTGCAGGG - Intergenic
1145414212 17:22701561-22701583 AGTAATATGCAGACTCTGCAGGG + Intergenic
1148710222 17:49674887-49674909 ACTGTTTTGCAGATTGGGGAGGG - Intronic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1149716730 17:58798149-58798171 ACTGATATTCAGAATGTGTTAGG - Intronic
1150924860 17:69522209-69522231 AATAATAGGCACACTGTGGAAGG - Intronic
1155553921 18:26996732-26996754 ACATACATGCACACTGTGGAGGG - Intronic
1155755413 18:29489051-29489073 ACAGAAATGAGGACTGTGGAAGG - Intergenic
1157928424 18:51791660-51791682 AGTGATATGTGGACTGGGGATGG - Intergenic
1158738884 18:60116310-60116332 ACTAATATCCAGACTCTAGAAGG + Intergenic
1158805650 18:60968861-60968883 ACAGAGATGCTGACTGTGTAGGG - Intergenic
1159081483 18:63740480-63740502 TCTGAGATTCAGACTGTGGTGGG + Intergenic
1159334938 18:67049926-67049948 ATTTATATGCAGACTGAAGAGGG - Intergenic
1160127200 18:76186488-76186510 ACACATATGCAGACTATGAAAGG + Intergenic
1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG + Intronic
1168516958 19:57016859-57016881 AGTGATATGAAAATTGTGGATGG + Intergenic
925110710 2:1334054-1334076 ACTAATATCCAGACTCTGCAAGG + Intronic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928296811 2:30090835-30090857 ACTGATGTGCATCCTTTGGAAGG - Intergenic
928882313 2:36111083-36111105 ACTGATATCCAGAATGTACAGGG - Intergenic
929843369 2:45495453-45495475 AGTGAGATGCTTACTGTGGAAGG - Intronic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG + Intronic
934776761 2:96943833-96943855 ACTGATCTGCAGCCTTTGGGCGG - Intronic
938191513 2:129285951-129285973 ACTAATATCTAGACTGTGTAAGG - Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941508141 2:166373425-166373447 ATTGATATGGAGGCTGTGGCAGG + Intronic
944312904 2:198254577-198254599 ACTGATATGCTGTCTGTGCCAGG - Intronic
945853983 2:215045322-215045344 ACTGATATGCAGGCTTGGAAAGG + Intronic
948014509 2:234677084-234677106 ACTCAGATGCAGACTGCAGATGG - Intergenic
1168780826 20:488293-488315 ACTGATGTGCAGGCTGGGCACGG - Intronic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1170758791 20:19230748-19230770 TGTGACATGCGGACTGTGGAAGG - Intronic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1173956914 20:47040411-47040433 ACTGAGGCTCAGACTGTGGAAGG - Intronic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1178028334 21:28493931-28493953 TCTGATATGTGAACTGTGGATGG + Intergenic
1178943532 21:36927205-36927227 GCTGAGATGCAGGCTGTGGGCGG - Intronic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG + Intergenic
1181656016 22:24299517-24299539 GCTGAGATGCAGACTGTTCAAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184569679 22:45314243-45314265 AATGATAAGCACACTGTGCAGGG + Intronic
949520595 3:4849963-4849985 ACTGATATCCCCACTCTGGAAGG - Intronic
950252264 3:11475594-11475616 GCTGATCTGCAGACTGCAGAGGG - Intronic
950939634 3:16880120-16880142 AAAGAAATGCAGACTTTGGAAGG + Intronic
951079629 3:18437727-18437749 AGTGATCTCCAGACTGTGGGAGG - Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
953277316 3:41514962-41514984 ACAGATATGCTGGCTGTGCATGG + Intronic
953458646 3:43063744-43063766 ACTGATAGGAAGACTTAGGAAGG + Intergenic
953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG + Intronic
954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG + Intronic
955375940 3:58397398-58397420 ACTGATTGGAAAACTGTGGAGGG + Intronic
957688464 3:83536371-83536393 ACTGATATCCAGAATTTGCAAGG + Intergenic
960886939 3:122405616-122405638 ACTATTAGGCAGACTGAGGAAGG - Intronic
961407897 3:126695341-126695363 ACTGATATCCAGAATCTGTAAGG - Intergenic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
965920789 3:173910382-173910404 ACTGATATCCAGTCTGTTGTAGG - Intronic
966921272 3:184613189-184613211 TCTGATACCCAGAGTGTGGATGG + Intronic
966986624 3:185186235-185186257 TCTGAGATGCAGCCTGTTGAGGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
970092651 4:12427606-12427628 ACTGCTATGCATACAGCGGAAGG - Intergenic
970671562 4:18402325-18402347 CCTGATATGCAGGCTTTTGAGGG + Intergenic
971315771 4:25566703-25566725 ACTGCATTGCAGACTGTGGTGGG - Intergenic
975830315 4:78362275-78362297 ACTGGTATACTGACTCTGGAAGG + Intronic
975931394 4:79527922-79527944 TCTGAGATTTAGACTGTGGAAGG - Intergenic
978110433 4:104958003-104958025 ACTAATACCCAGAATGTGGAAGG - Intergenic
978598557 4:110404245-110404267 ACTTATACGCAGACTTTTGACGG - Intronic
978917112 4:114140681-114140703 ACTGATATCCAGAATGTACAAGG - Intergenic
979795190 4:124837742-124837764 ACTGATACGCAGACTATGTAAGG - Intergenic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981968054 4:150630478-150630500 ACTGATATTCAGACTGAATAAGG - Intronic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
984901265 4:184588727-184588749 ACTAATACACAGAATGTGGATGG - Intergenic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
989468209 5:41782625-41782647 ACTAATATCCAGAGTCTGGAAGG - Intronic
994488649 5:100412012-100412034 ACTAATATCCAGAATGTGCAAGG - Intergenic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
996035360 5:118752703-118752725 ACTGCTATGTGAACTGTGGAAGG - Intergenic
996506465 5:124273311-124273333 ACTGATATGAAAACAGTGGGGGG + Intergenic
996694582 5:126379786-126379808 ACTGATATCCAGAATGTACAAGG - Intronic
996796154 5:127350636-127350658 AATGAAATACAAACTGTGGAAGG + Intronic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
997806646 5:136924520-136924542 ACTGATATGCAAGATGGGGAGGG + Intergenic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1002975769 6:2074388-2074410 ACTGATATCCAAAATGTGCAGGG - Intronic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1004254948 6:14054871-14054893 AGTGATATGCAGACAGTGGTGGG - Intergenic
1004642972 6:17533264-17533286 ACCAATATGCAGTGTGTGGAAGG - Intronic
1006250700 6:32781238-32781260 ACAAATATCCAAACTGTGGATGG - Intergenic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1006650822 6:35549879-35549901 ACTGCCAGGCTGACTGTGGAAGG + Intergenic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1016948355 6:149555580-149555602 ACTGATATCCAGAATCTGCAAGG + Intergenic
1019629334 7:2039062-2039084 AGTGATAGACAGCCTGTGGATGG - Intronic
1019972703 7:4554365-4554387 AGTGCTTTGCACACTGTGGAGGG - Intergenic
1020413770 7:7922619-7922641 ATTGCTATGCAGATTGTTGATGG + Intronic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1022731884 7:33034283-33034305 ACAGTTATTCAGACTGTTGAAGG - Intronic
1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG + Intronic
1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG + Exonic
1028026115 7:85842977-85842999 ACTGATATGCAGAATTTATAAGG - Intergenic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1030549312 7:110938068-110938090 ACTGATATGCATACTGGGAGAGG - Intronic
1030663140 7:112244510-112244532 ACTGATACGCAGAATGTCAATGG - Intronic
1031026521 7:116685765-116685787 ACCGACATGCAGACTCTGGTTGG - Intronic
1032332203 7:130990967-130990989 TCTGCTATGCATACTGTAGAAGG + Intergenic
1034743481 7:153500255-153500277 ACTGATATCCAGAATCTGCAAGG - Intergenic
1035966636 8:4199282-4199304 ATTGATATGCAGGCAGTGTATGG + Intronic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1036543391 8:9741449-9741471 ACTGCTATAAAGACTGTGAAAGG - Intronic
1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG + Intronic
1038032096 8:23651424-23651446 ACTGAAAGGAAGTCTGTGGATGG - Intergenic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1045455379 8:102373477-102373499 ACAGGTATTCAGAATGTGGATGG - Intronic
1046943388 8:119952846-119952868 TCTGATATGCAGGCTGGTGAAGG + Intronic
1047608255 8:126495980-126496002 ACTGATATGCATACTCTGCATGG - Intergenic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1049602524 8:143514502-143514524 ACTGACATGCACACGGTGGGCGG + Intronic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1050707256 9:8415726-8415748 ACAGACATGCAGACAATGGAGGG + Intronic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1052421501 9:28248485-28248507 AAGGATATGCAGATTGTTGACGG + Intronic
1053548045 9:39043733-39043755 CCTGATATGTAGACTCTTGAAGG + Intergenic
1054864671 9:69987852-69987874 ATTGATATGCATATTGGGGAGGG - Intergenic
1056039151 9:82643107-82643129 ACTAATATCCAGAATGTAGAAGG + Intergenic
1056998108 9:91483068-91483090 ACTGTTGAGCAGACTGTTGAGGG - Intergenic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1203611340 Un_KI270749v1:8567-8589 ACTTATATGCTGACTGTACACGG - Intergenic
1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG + Intergenic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG + Intronic
1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG + Intergenic
1196692170 X:118571594-118571616 ACTAATATGTAGACCGAGGAGGG - Intronic
1199026914 X:142950359-142950381 TCTAATATCCAGACTGTGCAAGG - Intergenic
1200695604 Y:6355985-6356007 TCTGATATTCAGCCTGGGGATGG - Intergenic
1201039673 Y:9818725-9818747 TCTGATATTCAGCCTGGGGATGG + Intergenic
1202047608 Y:20750291-20750313 ACTGAAATGCACACTTTTGAAGG + Intergenic